diff options
author | Ondřej Surý <ondrej@sury.org> | 2011-09-13 13:13:40 +0200 |
---|---|---|
committer | Ondřej Surý <ondrej@sury.org> | 2011-09-13 13:13:40 +0200 |
commit | 5ff4c17907d5b19510a62e08fd8d3b11e62b431d (patch) | |
tree | c0650497e988f47be9c6f2324fa692a52dea82e1 /test/bench/fasta.c | |
parent | 80f18fc933cf3f3e829c5455a1023d69f7b86e52 (diff) | |
download | golang-upstream/60.tar.gz |
Imported Upstream version 60upstream/60
Diffstat (limited to 'test/bench/fasta.c')
-rw-r--r-- | test/bench/fasta.c | 219 |
1 files changed, 219 insertions, 0 deletions
diff --git a/test/bench/fasta.c b/test/bench/fasta.c new file mode 100644 index 000000000..64c1c5205 --- /dev/null +++ b/test/bench/fasta.c @@ -0,0 +1,219 @@ +/* +Redistribution and use in source and binary forms, with or without +modification, are permitted provided that the following conditions are met: + + * Redistributions of source code must retain the above copyright + notice, this list of conditions and the following disclaimer. + + * Redistributions in binary form must reproduce the above copyright + notice, this list of conditions and the following disclaimer in the + documentation and/or other materials provided with the distribution. + + * Neither the name of "The Computer Language Benchmarks Game" nor the + name of "The Computer Language Shootout Benchmarks" nor the names of + its contributors may be used to endorse or promote products derived + from this software without specific prior written permission. + +THIS SOFTWARE IS PROVIDED BY THE COPYRIGHT HOLDERS AND CONTRIBUTORS "AS IS" +AND ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE +IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE +ARE DISCLAIMED. IN NO EVENT SHALL THE COPYRIGHT OWNER OR CONTRIBUTORS BE +LIABLE FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR +CONSEQUENTIAL DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF +SUBSTITUTE GOODS OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS +INTERRUPTION) HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN +CONTRACT, STRICT LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) +ARISING IN ANY WAY OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE +POSSIBILITY OF SUCH DAMAGE. +*/ + +/* + * http://shootout.alioth.debian.org/u32/program.php?test=fasta&lang=gcc&id=3 + */ + +/* The Computer Language Benchmarks Game + * http://shootout.alioth.debian.org/ + * + * contributed by Petr Prokhorenkov + */ + +#include <stdio.h> +#include <stdlib.h> +#include <string.h> + +#ifndef fwrite_unlocked +// not available on OS X +#define fwrite_unlocked fwrite +#define fputc_unlocked fputc +#define fputs_unlocked fputs +#endif + +#define ARRAY_SIZE(a) (sizeof(a)/sizeof(a[0])) +#define unlikely(x) __builtin_expect((x), 0) + +#define IM 139968 +#define IA 3877 +#define IC 29573 + +#define LINE_LEN 60 +#define LOOKUP_SIZE 4096 +#define LOOKUP_SCALE ((float)(LOOKUP_SIZE - 1)) + +typedef unsigned random_t; + +void +random_init(random_t *random) { + *random = 42; +} + +// Special version with result rescaled to LOOKUP_SCALE. +static inline +float +random_next_lookup(random_t *random) { + *random = (*random*IA + IC)%IM; + + return (*random)*(LOOKUP_SCALE/IM); +} + +struct amino_acid { + char sym; + float prob; + float cprob_lookup; +}; + +void +repeat(const char *alu, const char *title, int n) { + int len = strlen(alu); + char buffer[len + LINE_LEN]; + int pos = 0; + + memcpy(buffer, alu, len); + memcpy(buffer + len, alu, LINE_LEN); + + fputs_unlocked(title, stdout); + while (n > 0) { + int bytes = n > LINE_LEN ? LINE_LEN : n; + + fwrite_unlocked(buffer + pos, bytes, 1, stdout); + pos += bytes; + if (pos > len) { + pos -= len; + } + fputc_unlocked('\n', stdout); + n -= bytes; + } +} + +/* + * Lookup table contains mapping from real values to cumulative + * probabilities. Careful selection of table size allows lookup + * virtually in constant time. + * + * All cumulative probabilities are rescaled to LOOKUP_SCALE, + * this allows to save one multiplication operation on each iteration + * in randomize(). + */ + +void * +fill_lookup(struct amino_acid **lookup, struct amino_acid *amino_acid, int amino_acid_size) { + float p = 0; + int i, j; + + for (i = 0; i < amino_acid_size; i++) { + p += amino_acid[i].prob; + amino_acid[i].cprob_lookup = p*LOOKUP_SCALE; + } + + // Prevent rounding error. + amino_acid[amino_acid_size - 1].cprob_lookup = LOOKUP_SIZE - 1; + + for (i = 0, j = 0; i < LOOKUP_SIZE; i++) { + while (amino_acid[j].cprob_lookup < i) { + j++; + } + lookup[i] = &amino_acid[j]; + } + + return 0; +} + +void +randomize(struct amino_acid *amino_acid, int amino_acid_size, + const char *title, int n, random_t *rand) { + struct amino_acid *lookup[LOOKUP_SIZE]; + char line_buffer[LINE_LEN + 1]; + int i, j; + + line_buffer[LINE_LEN] = '\n'; + + fill_lookup(lookup, amino_acid, amino_acid_size); + + fputs_unlocked(title, stdout); + + for (i = 0, j = 0; i < n; i++, j++) { + if (j == LINE_LEN) { + fwrite_unlocked(line_buffer, LINE_LEN + 1, 1, stdout); + j = 0; + } + + float r = random_next_lookup(rand); + struct amino_acid *u = lookup[(short)r]; + while (unlikely(u->cprob_lookup < r)) { + ++u; + } + line_buffer[j] = u->sym; + } + line_buffer[j] = '\n'; + fwrite_unlocked(line_buffer, j + 1, 1, stdout); +} + +struct amino_acid amino_acid[] = { + { 'a', 0.27 }, + { 'c', 0.12 }, + { 'g', 0.12 }, + { 't', 0.27 }, + + { 'B', 0.02 }, + { 'D', 0.02 }, + { 'H', 0.02 }, + { 'K', 0.02 }, + { 'M', 0.02 }, + { 'N', 0.02 }, + { 'R', 0.02 }, + { 'S', 0.02 }, + { 'V', 0.02 }, + { 'W', 0.02 }, + { 'Y', 0.02 }, +}; + +struct amino_acid homo_sapiens[] = { + { 'a', 0.3029549426680 }, + { 'c', 0.1979883004921 }, + { 'g', 0.1975473066391 }, + { 't', 0.3015094502008 }, +}; + +static const char alu[] = + "GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTG" + "GGAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGA" + "GACCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAA" + "AATACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAAT" + "CCCAGCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAAC" + "CCGGGAGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTG" + "CACTCCAGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA"; + +int +main(int argc, const char **argv) { + int n = argc > 1 ? atoi( argv[1] ) : 512; + random_t rand; + + random_init(&rand); + + repeat(alu, ">ONE Homo sapiens alu\n", n*2); + randomize(amino_acid, ARRAY_SIZE(amino_acid), + ">TWO IUB ambiguity codes\n", n*3, &rand); + randomize(homo_sapiens, ARRAY_SIZE(homo_sapiens), + ">THREE Homo sapiens frequency\n", n*5, &rand); + + return 0; +} |