diff options
Diffstat (limited to 'test/bench/fasta.c')
| -rw-r--r-- | test/bench/fasta.c | 219 |
1 files changed, 0 insertions, 219 deletions
diff --git a/test/bench/fasta.c b/test/bench/fasta.c deleted file mode 100644 index 64c1c5205..000000000 --- a/test/bench/fasta.c +++ /dev/null @@ -1,219 +0,0 @@ -/* -Redistribution and use in source and binary forms, with or without -modification, are permitted provided that the following conditions are met: - - * Redistributions of source code must retain the above copyright - notice, this list of conditions and the following disclaimer. - - * Redistributions in binary form must reproduce the above copyright - notice, this list of conditions and the following disclaimer in the - documentation and/or other materials provided with the distribution. - - * Neither the name of "The Computer Language Benchmarks Game" nor the - name of "The Computer Language Shootout Benchmarks" nor the names of - its contributors may be used to endorse or promote products derived - from this software without specific prior written permission. - -THIS SOFTWARE IS PROVIDED BY THE COPYRIGHT HOLDERS AND CONTRIBUTORS "AS IS" -AND ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE -IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE -ARE DISCLAIMED. IN NO EVENT SHALL THE COPYRIGHT OWNER OR CONTRIBUTORS BE -LIABLE FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR -CONSEQUENTIAL DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF -SUBSTITUTE GOODS OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS -INTERRUPTION) HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN -CONTRACT, STRICT LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) -ARISING IN ANY WAY OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE -POSSIBILITY OF SUCH DAMAGE. -*/ - -/* - * http://shootout.alioth.debian.org/u32/program.php?test=fasta&lang=gcc&id=3 - */ - -/* The Computer Language Benchmarks Game - * http://shootout.alioth.debian.org/ - * - * contributed by Petr Prokhorenkov - */ - -#include <stdio.h> -#include <stdlib.h> -#include <string.h> - -#ifndef fwrite_unlocked -// not available on OS X -#define fwrite_unlocked fwrite -#define fputc_unlocked fputc -#define fputs_unlocked fputs -#endif - -#define ARRAY_SIZE(a) (sizeof(a)/sizeof(a[0])) -#define unlikely(x) __builtin_expect((x), 0) - -#define IM 139968 -#define IA 3877 -#define IC 29573 - -#define LINE_LEN 60 -#define LOOKUP_SIZE 4096 -#define LOOKUP_SCALE ((float)(LOOKUP_SIZE - 1)) - -typedef unsigned random_t; - -void -random_init(random_t *random) { - *random = 42; -} - -// Special version with result rescaled to LOOKUP_SCALE. -static inline -float -random_next_lookup(random_t *random) { - *random = (*random*IA + IC)%IM; - - return (*random)*(LOOKUP_SCALE/IM); -} - -struct amino_acid { - char sym; - float prob; - float cprob_lookup; -}; - -void -repeat(const char *alu, const char *title, int n) { - int len = strlen(alu); - char buffer[len + LINE_LEN]; - int pos = 0; - - memcpy(buffer, alu, len); - memcpy(buffer + len, alu, LINE_LEN); - - fputs_unlocked(title, stdout); - while (n > 0) { - int bytes = n > LINE_LEN ? LINE_LEN : n; - - fwrite_unlocked(buffer + pos, bytes, 1, stdout); - pos += bytes; - if (pos > len) { - pos -= len; - } - fputc_unlocked('\n', stdout); - n -= bytes; - } -} - -/* - * Lookup table contains mapping from real values to cumulative - * probabilities. Careful selection of table size allows lookup - * virtually in constant time. - * - * All cumulative probabilities are rescaled to LOOKUP_SCALE, - * this allows to save one multiplication operation on each iteration - * in randomize(). - */ - -void * -fill_lookup(struct amino_acid **lookup, struct amino_acid *amino_acid, int amino_acid_size) { - float p = 0; - int i, j; - - for (i = 0; i < amino_acid_size; i++) { - p += amino_acid[i].prob; - amino_acid[i].cprob_lookup = p*LOOKUP_SCALE; - } - - // Prevent rounding error. - amino_acid[amino_acid_size - 1].cprob_lookup = LOOKUP_SIZE - 1; - - for (i = 0, j = 0; i < LOOKUP_SIZE; i++) { - while (amino_acid[j].cprob_lookup < i) { - j++; - } - lookup[i] = &amino_acid[j]; - } - - return 0; -} - -void -randomize(struct amino_acid *amino_acid, int amino_acid_size, - const char *title, int n, random_t *rand) { - struct amino_acid *lookup[LOOKUP_SIZE]; - char line_buffer[LINE_LEN + 1]; - int i, j; - - line_buffer[LINE_LEN] = '\n'; - - fill_lookup(lookup, amino_acid, amino_acid_size); - - fputs_unlocked(title, stdout); - - for (i = 0, j = 0; i < n; i++, j++) { - if (j == LINE_LEN) { - fwrite_unlocked(line_buffer, LINE_LEN + 1, 1, stdout); - j = 0; - } - - float r = random_next_lookup(rand); - struct amino_acid *u = lookup[(short)r]; - while (unlikely(u->cprob_lookup < r)) { - ++u; - } - line_buffer[j] = u->sym; - } - line_buffer[j] = '\n'; - fwrite_unlocked(line_buffer, j + 1, 1, stdout); -} - -struct amino_acid amino_acid[] = { - { 'a', 0.27 }, - { 'c', 0.12 }, - { 'g', 0.12 }, - { 't', 0.27 }, - - { 'B', 0.02 }, - { 'D', 0.02 }, - { 'H', 0.02 }, - { 'K', 0.02 }, - { 'M', 0.02 }, - { 'N', 0.02 }, - { 'R', 0.02 }, - { 'S', 0.02 }, - { 'V', 0.02 }, - { 'W', 0.02 }, - { 'Y', 0.02 }, -}; - -struct amino_acid homo_sapiens[] = { - { 'a', 0.3029549426680 }, - { 'c', 0.1979883004921 }, - { 'g', 0.1975473066391 }, - { 't', 0.3015094502008 }, -}; - -static const char alu[] = - "GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTG" - "GGAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGA" - "GACCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAA" - "AATACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAAT" - "CCCAGCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAAC" - "CCGGGAGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTG" - "CACTCCAGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA"; - -int -main(int argc, const char **argv) { - int n = argc > 1 ? atoi( argv[1] ) : 512; - random_t rand; - - random_init(&rand); - - repeat(alu, ">ONE Homo sapiens alu\n", n*2); - randomize(amino_acid, ARRAY_SIZE(amino_acid), - ">TWO IUB ambiguity codes\n", n*3, &rand); - randomize(homo_sapiens, ARRAY_SIZE(homo_sapiens), - ">THREE Homo sapiens frequency\n", n*5, &rand); - - return 0; -} |