diff options
Diffstat (limited to 'test/bench/fasta.go')
| -rw-r--r-- | test/bench/fasta.go | 206 |
1 files changed, 0 insertions, 206 deletions
diff --git a/test/bench/fasta.go b/test/bench/fasta.go deleted file mode 100644 index d13edd5dc..000000000 --- a/test/bench/fasta.go +++ /dev/null @@ -1,206 +0,0 @@ -/* -Redistribution and use in source and binary forms, with or without -modification, are permitted provided that the following conditions are met: - - * Redistributions of source code must retain the above copyright - notice, this list of conditions and the following disclaimer. - - * Redistributions in binary form must reproduce the above copyright - notice, this list of conditions and the following disclaimer in the - documentation and/or other materials provided with the distribution. - - * Neither the name of "The Computer Language Benchmarks Game" nor the - name of "The Computer Language Shootout Benchmarks" nor the names of - its contributors may be used to endorse or promote products derived - from this software without specific prior written permission. - -THIS SOFTWARE IS PROVIDED BY THE COPYRIGHT HOLDERS AND CONTRIBUTORS "AS IS" -AND ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE -IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE -ARE DISCLAIMED. IN NO EVENT SHALL THE COPYRIGHT OWNER OR CONTRIBUTORS BE -LIABLE FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR -CONSEQUENTIAL DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF -SUBSTITUTE GOODS OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS -INTERRUPTION) HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN -CONTRACT, STRICT LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) -ARISING IN ANY WAY OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE -POSSIBILITY OF SUCH DAMAGE. -*/ - -/* The Computer Language Benchmarks Game - * http://shootout.alioth.debian.org/ - * - * contributed by The Go Authors. - * Based on C program by by Petr Prokhorenkov. - */ - -package main - -import ( - "flag" - "os" -) - -var out = make(buffer, 0, 32768) - -var n = flag.Int("n", 1000, "length of result") - -const Line = 60 - -func Repeat(alu []byte, n int) { - buf := append(alu, alu...) - off := 0 - for n > 0 { - m := n - if m > Line { - m = Line - } - buf1 := out.NextWrite(m + 1) - copy(buf1, buf[off:]) - buf1[m] = '\n' - if off += m; off >= len(alu) { - off -= len(alu) - } - n -= m - } -} - -const ( - IM = 139968 - IA = 3877 - IC = 29573 - - LookupSize = 4096 - LookupScale float64 = LookupSize - 1 -) - -var rand uint32 = 42 - -type Acid struct { - sym byte - prob float64 - cprob float64 - next *Acid -} - -func computeLookup(acid []Acid) *[LookupSize]*Acid { - var lookup [LookupSize]*Acid - var p float64 - for i := range acid { - p += acid[i].prob - acid[i].cprob = p * LookupScale - if i > 0 { - acid[i-1].next = &acid[i] - } - } - acid[len(acid)-1].cprob = 1.0 * LookupScale - - j := 0 - for i := range lookup { - for acid[j].cprob < float64(i) { - j++ - } - lookup[i] = &acid[j] - } - - return &lookup -} - -func Random(acid []Acid, n int) { - lookup := computeLookup(acid) - for n > 0 { - m := n - if m > Line { - m = Line - } - buf := out.NextWrite(m + 1) - f := LookupScale / IM - myrand := rand - for i := 0; i < m; i++ { - myrand = (myrand*IA + IC) % IM - r := float64(int(myrand)) * f - a := lookup[int(r)] - for a.cprob < r { - a = a.next - } - buf[i] = a.sym - } - rand = myrand - buf[m] = '\n' - n -= m - } -} - -func main() { - defer out.Flush() - - flag.Parse() - - iub := []Acid{ - {prob: 0.27, sym: 'a'}, - {prob: 0.12, sym: 'c'}, - {prob: 0.12, sym: 'g'}, - {prob: 0.27, sym: 't'}, - {prob: 0.02, sym: 'B'}, - {prob: 0.02, sym: 'D'}, - {prob: 0.02, sym: 'H'}, - {prob: 0.02, sym: 'K'}, - {prob: 0.02, sym: 'M'}, - {prob: 0.02, sym: 'N'}, - {prob: 0.02, sym: 'R'}, - {prob: 0.02, sym: 'S'}, - {prob: 0.02, sym: 'V'}, - {prob: 0.02, sym: 'W'}, - {prob: 0.02, sym: 'Y'}, - } - - homosapiens := []Acid{ - {prob: 0.3029549426680, sym: 'a'}, - {prob: 0.1979883004921, sym: 'c'}, - {prob: 0.1975473066391, sym: 'g'}, - {prob: 0.3015094502008, sym: 't'}, - } - - alu := []byte( - "GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG" + - "GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA" + - "CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT" + - "ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA" + - "GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG" + - "AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC" + - "AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA") - - out.WriteString(">ONE Homo sapiens alu\n") - Repeat(alu, 2**n) - out.WriteString(">TWO IUB ambiguity codes\n") - Random(iub, 3**n) - out.WriteString(">THREE Homo sapiens frequency\n") - Random(homosapiens, 5**n) -} - - -type buffer []byte - -func (b *buffer) Flush() { - p := *b - if len(p) > 0 { - os.Stdout.Write(p) - } - *b = p[0:0] -} - -func (b *buffer) WriteString(s string) { - p := b.NextWrite(len(s)) - copy(p, s) -} - -func (b *buffer) NextWrite(n int) []byte { - p := *b - if len(p)+n > cap(p) { - b.Flush() - p = *b - } - out := p[len(p) : len(p)+n] - *b = p[:len(p)+n] - return out -} |