summaryrefslogtreecommitdiff
path: root/test
diff options
context:
space:
mode:
Diffstat (limited to 'test')
-rw-r--r--test/235.go5
-rw-r--r--test/alias.go33
-rw-r--r--test/alias1.go54
-rw-r--r--test/append.go24
-rw-r--r--test/args.go2
-rw-r--r--test/assign.go27
-rw-r--r--test/assign1.go5
-rw-r--r--test/bench/Makefile14
-rw-r--r--test/bench/garbage/Makefile (renamed from test/garbage/Makefile)18
-rw-r--r--test/bench/garbage/parser.go (renamed from test/garbage/parser.go)101
-rw-r--r--test/bench/garbage/peano.go (renamed from test/garbage/peano.go)22
-rw-r--r--test/bench/garbage/stats.go (renamed from test/garbage/stats.go)17
-rw-r--r--test/bench/garbage/tree.go (renamed from test/garbage/tree.go)6
-rw-r--r--test/bench/garbage/tree2.go89
-rw-r--r--test/bench/go1/binarytree_test.go63
-rw-r--r--test/bench/go1/fannkuch_test.go84
-rw-r--r--test/bench/go1/fasta_test.go164
-rw-r--r--test/bench/go1/gob_test.go95
-rw-r--r--test/bench/go1/gzip_test.go63
-rw-r--r--test/bench/go1/json_test.go84
-rw-r--r--test/bench/go1/jsondata_test.go1818
-rw-r--r--test/bench/go1/revcomp_test.go85
-rw-r--r--test/bench/go1/template_test.go76
-rw-r--r--test/bench/shootout/binary-tree-freelist.go (renamed from test/bench/binary-tree-freelist.go)0
-rw-r--r--test/bench/shootout/binary-tree-freelist.txt (renamed from test/bench/binary-tree-freelist.txt)0
-rw-r--r--test/bench/shootout/binary-tree.c (renamed from test/bench/binary-tree.c)0
-rw-r--r--test/bench/shootout/binary-tree.go (renamed from test/bench/binary-tree.go)0
-rw-r--r--test/bench/shootout/binary-tree.txt (renamed from test/bench/binary-tree.txt)0
-rw-r--r--test/bench/shootout/chameneosredux.c (renamed from test/bench/chameneosredux.c)0
-rw-r--r--test/bench/shootout/chameneosredux.go (renamed from test/bench/chameneosredux.go)20
-rw-r--r--test/bench/shootout/chameneosredux.txt (renamed from test/bench/chameneosredux.txt)0
-rw-r--r--test/bench/shootout/fannkuch-parallel.go (renamed from test/bench/fannkuch-parallel.go)0
-rw-r--r--test/bench/shootout/fannkuch-parallel.txt (renamed from test/bench/fannkuch-parallel.txt)0
-rw-r--r--test/bench/shootout/fannkuch.c (renamed from test/bench/fannkuch.c)0
-rw-r--r--test/bench/shootout/fannkuch.go (renamed from test/bench/fannkuch.go)0
-rw-r--r--test/bench/shootout/fannkuch.txt (renamed from test/bench/fannkuch.txt)0
-rw-r--r--test/bench/shootout/fasta-1000.out (renamed from test/bench/fasta-1000.out)0
-rw-r--r--test/bench/shootout/fasta.c (renamed from test/bench/fasta.c)0
-rw-r--r--test/bench/shootout/fasta.go (renamed from test/bench/fasta.go)3
-rw-r--r--test/bench/shootout/fasta.txt (renamed from test/bench/fasta.txt)0
-rw-r--r--test/bench/shootout/k-nucleotide-parallel.go (renamed from test/bench/k-nucleotide-parallel.go)0
-rw-r--r--test/bench/shootout/k-nucleotide-parallel.txt (renamed from test/bench/k-nucleotide-parallel.txt)0
-rw-r--r--test/bench/shootout/k-nucleotide.c (renamed from test/bench/k-nucleotide.c)0
-rw-r--r--test/bench/shootout/k-nucleotide.go (renamed from test/bench/k-nucleotide.go)0
-rw-r--r--test/bench/shootout/k-nucleotide.txt (renamed from test/bench/k-nucleotide.txt)0
-rw-r--r--test/bench/shootout/mandelbrot.c (renamed from test/bench/mandelbrot.c)0
-rw-r--r--test/bench/shootout/mandelbrot.go (renamed from test/bench/mandelbrot.go)0
-rw-r--r--test/bench/shootout/mandelbrot.txt (renamed from test/bench/mandelbrot.txt)bin5011 -> 5011 bytes
-rw-r--r--test/bench/shootout/meteor-contest.c (renamed from test/bench/meteor-contest.c)0
-rw-r--r--test/bench/shootout/meteor-contest.go (renamed from test/bench/meteor-contest.go)9
-rw-r--r--test/bench/shootout/meteor-contest.txt (renamed from test/bench/meteor-contest.txt)0
-rw-r--r--test/bench/shootout/nbody.c (renamed from test/bench/nbody.c)0
-rw-r--r--test/bench/shootout/nbody.go (renamed from test/bench/nbody.go)48
-rw-r--r--test/bench/shootout/nbody.txt (renamed from test/bench/nbody.txt)0
-rw-r--r--test/bench/shootout/pidigits.c (renamed from test/bench/pidigits.c)0
-rw-r--r--test/bench/shootout/pidigits.go (renamed from test/bench/pidigits.go)2
-rw-r--r--test/bench/shootout/pidigits.txt (renamed from test/bench/pidigits.txt)0
-rw-r--r--test/bench/shootout/regex-dna-parallel.go (renamed from test/bench/regex-dna-parallel.go)2
-rw-r--r--test/bench/shootout/regex-dna-parallel.txt (renamed from test/bench/regex-dna-parallel.txt)0
-rw-r--r--test/bench/shootout/regex-dna.c (renamed from test/bench/regex-dna.c)0
-rw-r--r--test/bench/shootout/regex-dna.go (renamed from test/bench/regex-dna.go)0
-rw-r--r--test/bench/shootout/regex-dna.txt (renamed from test/bench/regex-dna.txt)0
-rw-r--r--test/bench/shootout/reverse-complement.c (renamed from test/bench/reverse-complement.c)0
-rw-r--r--test/bench/shootout/reverse-complement.go (renamed from test/bench/reverse-complement.go)0
-rw-r--r--test/bench/shootout/reverse-complement.txt (renamed from test/bench/reverse-complement.txt)0
-rw-r--r--test/bench/shootout/spectral-norm-parallel.go (renamed from test/bench/spectral-norm-parallel.go)0
-rw-r--r--test/bench/shootout/spectral-norm.c (renamed from test/bench/spectral-norm.c)0
-rw-r--r--test/bench/shootout/spectral-norm.go (renamed from test/bench/spectral-norm.go)0
-rw-r--r--test/bench/shootout/spectral-norm.txt (renamed from test/bench/spectral-norm.txt)0
-rw-r--r--test/bench/shootout/threadring.c (renamed from test/bench/threadring.c)0
-rw-r--r--test/bench/shootout/threadring.go (renamed from test/bench/threadring.go)2
-rw-r--r--test/bench/shootout/threadring.txt (renamed from test/bench/threadring.txt)0
-rw-r--r--test/bench/shootout/timing.log (renamed from test/bench/timing.log)0
-rwxr-xr-xtest/bench/shootout/timing.sh (renamed from test/bench/timing.sh)6
-rw-r--r--test/bigalg.go4
-rw-r--r--test/bigmap.go4
-rw-r--r--test/blank.go45
-rw-r--r--test/blank1.go6
-rw-r--r--test/bugs/bug395.go22
-rw-r--r--test/chan/doubleselect.go6
-rw-r--r--test/chan/fifo.go4
-rw-r--r--test/chan/goroutines.go8
-rw-r--r--test/chan/nonblock.go7
-rw-r--r--test/chan/perm.go13
-rw-r--r--test/chan/powser1.go4
-rw-r--r--test/chan/powser2.go11
-rw-r--r--test/chan/select.go4
-rw-r--r--test/chan/select2.go13
-rw-r--r--test/chan/select3.go8
-rw-r--r--test/chan/select4.go8
-rw-r--r--test/chan/select5.go7
-rw-r--r--test/chan/select6.go4
-rw-r--r--test/chan/select7.go68
-rw-r--r--test/chan/sendstmt.go2
-rw-r--r--test/chan/sieve1.go4
-rw-r--r--test/chan/sieve2.go42
-rw-r--r--test/chan/zerosize.go4
-rw-r--r--test/chancap.go4
-rw-r--r--test/char_lit.go4
-rw-r--r--test/char_lit1.go5
-rw-r--r--test/closedchan.go31
-rw-r--r--test/closure.go29
-rw-r--r--test/cmp.go421
-rw-r--r--test/cmp1.go130
-rw-r--r--test/cmp2.go15
-rw-r--r--test/cmp3.go15
-rw-r--r--test/cmp4.go14
-rw-r--r--test/cmp5.go14
-rw-r--r--test/cmp6.go48
-rw-r--r--test/cmplx.go5
-rw-r--r--test/cmplxdivide.c1
-rw-r--r--test/cmplxdivide.go16
-rw-r--r--test/cmplxdivide1.go1
-rw-r--r--test/complit.go20
-rw-r--r--test/complit1.go42
-rw-r--r--test/compos.go4
-rw-r--r--test/const.go4
-rw-r--r--test/const1.go62
-rw-r--r--test/const2.go11
-rw-r--r--test/const3.go4
-rw-r--r--test/const4.go77
-rw-r--r--test/const5.go33
-rw-r--r--test/convert.go4
-rw-r--r--test/convert1.go99
-rw-r--r--test/convert3.go5
-rw-r--r--test/convlit.go25
-rw-r--r--test/convlit1.go5
-rw-r--r--test/copy.go4
-rw-r--r--test/crlf.go52
-rw-r--r--test/ddd.go18
-rw-r--r--test/ddd1.go9
-rw-r--r--test/ddd2.go4
-rw-r--r--test/ddd3.go2
-rw-r--r--test/decl.go4
-rw-r--r--test/declbad.go5
-rw-r--r--test/defer.go4
-rw-r--r--test/deferprint.go7
-rw-r--r--test/deferprint.out2
-rw-r--r--test/divide.go4
-rw-r--r--[-rwxr-xr-x]test/dwarf/linedirectives.go2
-rw-r--r--test/empty.go5
-rw-r--r--test/env.go17
-rw-r--r--test/eof.go5
-rw-r--r--test/eof1.go7
-rw-r--r--test/escape.go6
-rw-r--r--test/escape2.go1067
-rw-r--r--test/escape3.go36
-rw-r--r--test/escape4.go39
-rw-r--r--test/fixedbugs/bug000.go2
-rw-r--r--test/fixedbugs/bug002.go2
-rw-r--r--test/fixedbugs/bug003.go2
-rw-r--r--test/fixedbugs/bug004.go2
-rw-r--r--test/fixedbugs/bug005.go2
-rw-r--r--test/fixedbugs/bug006.go2
-rw-r--r--test/fixedbugs/bug007.go2
-rw-r--r--test/fixedbugs/bug008.go2
-rw-r--r--test/fixedbugs/bug009.go2
-rw-r--r--test/fixedbugs/bug010.go2
-rw-r--r--test/fixedbugs/bug011.go2
-rw-r--r--test/fixedbugs/bug012.go2
-rw-r--r--test/fixedbugs/bug013.go2
-rw-r--r--test/fixedbugs/bug014.go3
-rw-r--r--test/fixedbugs/bug015.go2
-rw-r--r--test/fixedbugs/bug016.go2
-rw-r--r--test/fixedbugs/bug017.go2
-rw-r--r--test/fixedbugs/bug020.go2
-rw-r--r--test/fixedbugs/bug021.go2
-rw-r--r--test/fixedbugs/bug022.go2
-rw-r--r--test/fixedbugs/bug023.go2
-rw-r--r--test/fixedbugs/bug024.go2
-rw-r--r--test/fixedbugs/bug026.go2
-rw-r--r--test/fixedbugs/bug027.go77
-rw-r--r--test/fixedbugs/bug028.go2
-rw-r--r--test/fixedbugs/bug030.go2
-rw-r--r--test/fixedbugs/bug031.go2
-rw-r--r--test/fixedbugs/bug035.go2
-rw-r--r--test/fixedbugs/bug036.go13
-rw-r--r--test/fixedbugs/bug037.go2
-rw-r--r--test/fixedbugs/bug038.go13
-rw-r--r--test/fixedbugs/bug039.go2
-rw-r--r--test/fixedbugs/bug040.go6
-rw-r--r--test/fixedbugs/bug045.go2
-rw-r--r--test/fixedbugs/bug046.go2
-rw-r--r--test/fixedbugs/bug047.go2
-rw-r--r--test/fixedbugs/bug048.go2
-rw-r--r--test/fixedbugs/bug049.go2
-rw-r--r--test/fixedbugs/bug050.go2
-rw-r--r--test/fixedbugs/bug051.go2
-rw-r--r--test/fixedbugs/bug052.go2
-rw-r--r--test/fixedbugs/bug053.go2
-rw-r--r--test/fixedbugs/bug054.go2
-rw-r--r--test/fixedbugs/bug055.go2
-rw-r--r--test/fixedbugs/bug056.go2
-rw-r--r--test/fixedbugs/bug057.go2
-rw-r--r--test/fixedbugs/bug058.go2
-rw-r--r--test/fixedbugs/bug059.go2
-rw-r--r--test/fixedbugs/bug060.go2
-rw-r--r--test/fixedbugs/bug061.go2
-rw-r--r--test/fixedbugs/bug062.go2
-rw-r--r--test/fixedbugs/bug063.go4
-rw-r--r--test/fixedbugs/bug064.go2
-rw-r--r--test/fixedbugs/bug065.go2
-rw-r--r--test/fixedbugs/bug066.go4
-rw-r--r--test/fixedbugs/bug067.go4
-rw-r--r--test/fixedbugs/bug068.go2
-rw-r--r--test/fixedbugs/bug069.go2
-rw-r--r--test/fixedbugs/bug070.go39
-rw-r--r--test/fixedbugs/bug071.go4
-rw-r--r--test/fixedbugs/bug072.go2
-rw-r--r--test/fixedbugs/bug073.go2
-rw-r--r--test/fixedbugs/bug074.go2
-rw-r--r--test/fixedbugs/bug075.go2
-rw-r--r--test/fixedbugs/bug076.go2
-rw-r--r--test/fixedbugs/bug077.go2
-rw-r--r--test/fixedbugs/bug078.go2
-rw-r--r--test/fixedbugs/bug080.go2
-rw-r--r--test/fixedbugs/bug081.go2
-rw-r--r--test/fixedbugs/bug082.go2
-rw-r--r--test/fixedbugs/bug084.go2
-rw-r--r--test/fixedbugs/bug085.go2
-rw-r--r--test/fixedbugs/bug086.go2
-rw-r--r--test/fixedbugs/bug087.go2
-rw-r--r--test/fixedbugs/bug089.go2
-rw-r--r--test/fixedbugs/bug090.go2
-rw-r--r--test/fixedbugs/bug091.go2
-rw-r--r--test/fixedbugs/bug092.go2
-rw-r--r--test/fixedbugs/bug093.go3
-rw-r--r--test/fixedbugs/bug094.go2
-rw-r--r--test/fixedbugs/bug096.go2
-rw-r--r--test/fixedbugs/bug097.go2
-rw-r--r--test/fixedbugs/bug098.go2
-rw-r--r--test/fixedbugs/bug099.go2
-rw-r--r--test/fixedbugs/bug101.go2
-rw-r--r--test/fixedbugs/bug102.go2
-rw-r--r--test/fixedbugs/bug103.go2
-rw-r--r--test/fixedbugs/bug104.go2
-rw-r--r--test/fixedbugs/bug107.go4
-rw-r--r--test/fixedbugs/bug108.go3
-rw-r--r--test/fixedbugs/bug109.go4
-rw-r--r--test/fixedbugs/bug110.go2
-rw-r--r--test/fixedbugs/bug111.go2
-rw-r--r--test/fixedbugs/bug112.go2
-rw-r--r--test/fixedbugs/bug113.go18
-rw-r--r--test/fixedbugs/bug114.go2
-rw-r--r--test/fixedbugs/bug115.go2
-rw-r--r--test/fixedbugs/bug116.go2
-rw-r--r--test/fixedbugs/bug117.go2
-rw-r--r--test/fixedbugs/bug118.go4
-rw-r--r--test/fixedbugs/bug119.go2
-rw-r--r--test/fixedbugs/bug120.go10
-rw-r--r--test/fixedbugs/bug121.go2
-rw-r--r--test/fixedbugs/bug122.go2
-rw-r--r--test/fixedbugs/bug123.go2
-rw-r--r--test/fixedbugs/bug126.go2
-rw-r--r--test/fixedbugs/bug127.go2
-rw-r--r--test/fixedbugs/bug128.go2
-rw-r--r--test/fixedbugs/bug129.go2
-rw-r--r--test/fixedbugs/bug130.go2
-rw-r--r--test/fixedbugs/bug131.go2
-rw-r--r--test/fixedbugs/bug132.go2
-rw-r--r--test/fixedbugs/bug135.go2
-rw-r--r--test/fixedbugs/bug136.go2
-rw-r--r--test/fixedbugs/bug137.go2
-rw-r--r--test/fixedbugs/bug139.go2
-rw-r--r--test/fixedbugs/bug140.go2
-rw-r--r--test/fixedbugs/bug141.go4
-rw-r--r--test/fixedbugs/bug142.go2
-rw-r--r--test/fixedbugs/bug143.go2
-rw-r--r--test/fixedbugs/bug144.go2
-rw-r--r--test/fixedbugs/bug145.go2
-rw-r--r--test/fixedbugs/bug146.go2
-rw-r--r--test/fixedbugs/bug147.go2
-rw-r--r--test/fixedbugs/bug148.go19
-rw-r--r--test/fixedbugs/bug149.go2
-rw-r--r--test/fixedbugs/bug150.go4
-rw-r--r--test/fixedbugs/bug151.go4
-rw-r--r--test/fixedbugs/bug1515.go2
-rw-r--r--test/fixedbugs/bug152.go2
-rw-r--r--test/fixedbugs/bug154.go2
-rw-r--r--test/fixedbugs/bug155.go2
-rw-r--r--test/fixedbugs/bug156.go2
-rw-r--r--test/fixedbugs/bug157.go2
-rw-r--r--test/fixedbugs/bug158.go2
-rw-r--r--test/fixedbugs/bug159.go2
-rw-r--r--test/fixedbugs/bug161.go2
-rw-r--r--test/fixedbugs/bug163.go2
-rw-r--r--test/fixedbugs/bug164.go2
-rw-r--r--test/fixedbugs/bug165.go2
-rw-r--r--test/fixedbugs/bug167.go2
-rw-r--r--test/fixedbugs/bug168.go2
-rw-r--r--test/fixedbugs/bug169.go2
-rw-r--r--test/fixedbugs/bug170.go2
-rw-r--r--test/fixedbugs/bug171.go2
-rw-r--r--test/fixedbugs/bug172.go2
-rw-r--r--test/fixedbugs/bug173.go2
-rw-r--r--test/fixedbugs/bug174.go2
-rw-r--r--test/fixedbugs/bug175.go4
-rw-r--r--test/fixedbugs/bug176.go2
-rw-r--r--test/fixedbugs/bug177.go2
-rw-r--r--test/fixedbugs/bug178.go2
-rw-r--r--test/fixedbugs/bug179.go2
-rw-r--r--test/fixedbugs/bug180.go2
-rw-r--r--test/fixedbugs/bug181.go2
-rw-r--r--test/fixedbugs/bug182.go2
-rw-r--r--test/fixedbugs/bug183.go2
-rw-r--r--test/fixedbugs/bug184.go2
-rw-r--r--test/fixedbugs/bug185.go2
-rw-r--r--test/fixedbugs/bug186.go2
-rw-r--r--test/fixedbugs/bug187.go2
-rw-r--r--test/fixedbugs/bug188.go2
-rw-r--r--test/fixedbugs/bug189.go2
-rw-r--r--test/fixedbugs/bug190.go2
-rw-r--r--test/fixedbugs/bug192.go2
-rw-r--r--test/fixedbugs/bug193.go2
-rw-r--r--test/fixedbugs/bug194.go2
-rw-r--r--test/fixedbugs/bug195.go4
-rw-r--r--test/fixedbugs/bug196.go2
-rw-r--r--test/fixedbugs/bug197.go2
-rw-r--r--test/fixedbugs/bug198.go2
-rw-r--r--test/fixedbugs/bug199.go2
-rw-r--r--test/fixedbugs/bug200.go4
-rw-r--r--test/fixedbugs/bug201.go2
-rw-r--r--test/fixedbugs/bug202.go2
-rw-r--r--test/fixedbugs/bug203.go2
-rw-r--r--test/fixedbugs/bug204.go18
-rw-r--r--test/fixedbugs/bug205.go2
-rw-r--r--test/fixedbugs/bug207.go2
-rw-r--r--test/fixedbugs/bug208.go2
-rw-r--r--test/fixedbugs/bug209.go2
-rw-r--r--test/fixedbugs/bug211.go2
-rw-r--r--test/fixedbugs/bug212.go2
-rw-r--r--test/fixedbugs/bug213.go4
-rw-r--r--test/fixedbugs/bug214.go2
-rw-r--r--test/fixedbugs/bug215.go2
-rw-r--r--test/fixedbugs/bug216.go2
-rw-r--r--test/fixedbugs/bug217.go2
-rw-r--r--test/fixedbugs/bug218.go2
-rw-r--r--test/fixedbugs/bug219.go4
-rw-r--r--test/fixedbugs/bug220.go14
-rw-r--r--test/fixedbugs/bug221.go2
-rw-r--r--test/fixedbugs/bug222.dir/chanbug.go4
-rw-r--r--test/fixedbugs/bug222.dir/chanbug2.go4
-rw-r--r--test/fixedbugs/bug223.go4
-rw-r--r--test/fixedbugs/bug224.go2
-rw-r--r--test/fixedbugs/bug225.go2
-rw-r--r--test/fixedbugs/bug226.dir/x.go9
-rw-r--r--test/fixedbugs/bug226.dir/y.go31
-rw-r--r--test/fixedbugs/bug226.go7
-rw-r--r--test/fixedbugs/bug227.go2
-rw-r--r--test/fixedbugs/bug228.go2
-rw-r--r--test/fixedbugs/bug229.go6
-rw-r--r--test/fixedbugs/bug230.go2
-rw-r--r--test/fixedbugs/bug231.go2
-rw-r--r--test/fixedbugs/bug232.go4
-rw-r--r--test/fixedbugs/bug233.go4
-rw-r--r--test/fixedbugs/bug234.go2
-rw-r--r--test/fixedbugs/bug235.go4
-rw-r--r--test/fixedbugs/bug236.go2
-rw-r--r--test/fixedbugs/bug237.go2
-rw-r--r--test/fixedbugs/bug238.go2
-rw-r--r--test/fixedbugs/bug239.go2
-rw-r--r--test/fixedbugs/bug240.go2
-rw-r--r--test/fixedbugs/bug241.go2
-rw-r--r--test/fixedbugs/bug242.go5
-rw-r--r--test/fixedbugs/bug243.go10
-rw-r--r--test/fixedbugs/bug244.go2
-rw-r--r--test/fixedbugs/bug245.go2
-rw-r--r--test/fixedbugs/bug246.go2
-rw-r--r--test/fixedbugs/bug247.go2
-rw-r--r--test/fixedbugs/bug248.dir/bug0.go4
-rw-r--r--test/fixedbugs/bug248.dir/bug1.go4
-rw-r--r--test/fixedbugs/bug248.dir/bug2.go6
-rw-r--r--test/fixedbugs/bug248.dir/bug3.go4
-rw-r--r--test/fixedbugs/bug249.go2
-rw-r--r--test/fixedbugs/bug250.go4
-rw-r--r--test/fixedbugs/bug251.go6
-rw-r--r--test/fixedbugs/bug252.go2
-rw-r--r--test/fixedbugs/bug253.go2
-rw-r--r--test/fixedbugs/bug254.go2
-rw-r--r--test/fixedbugs/bug255.go2
-rw-r--r--test/fixedbugs/bug256.go2
-rw-r--r--test/fixedbugs/bug257.go7
-rw-r--r--test/fixedbugs/bug258.go2
-rw-r--r--test/fixedbugs/bug259.go2
-rw-r--r--test/fixedbugs/bug260.go18
-rw-r--r--test/fixedbugs/bug261.go2
-rw-r--r--test/fixedbugs/bug262.go13
-rw-r--r--test/fixedbugs/bug263.go2
-rw-r--r--test/fixedbugs/bug264.go2
-rw-r--r--test/fixedbugs/bug265.go2
-rw-r--r--test/fixedbugs/bug266.go2
-rw-r--r--test/fixedbugs/bug267.go4
-rw-r--r--test/fixedbugs/bug268.go53
-rw-r--r--test/fixedbugs/bug269.go2
-rw-r--r--test/fixedbugs/bug270.go21
-rw-r--r--test/fixedbugs/bug271.go2
-rw-r--r--test/fixedbugs/bug272.go2
-rw-r--r--test/fixedbugs/bug273.go2
-rw-r--r--test/fixedbugs/bug274.go2
-rw-r--r--test/fixedbugs/bug275.go2
-rw-r--r--test/fixedbugs/bug276.go2
-rw-r--r--test/fixedbugs/bug277.go2
-rw-r--r--test/fixedbugs/bug278.go2
-rw-r--r--test/fixedbugs/bug279.go2
-rw-r--r--test/fixedbugs/bug280.go2
-rw-r--r--test/fixedbugs/bug281.go2
-rw-r--r--test/fixedbugs/bug283.go4
-rw-r--r--test/fixedbugs/bug284.go2
-rw-r--r--test/fixedbugs/bug285.go16
-rw-r--r--test/fixedbugs/bug286.go16
-rw-r--r--test/fixedbugs/bug287.go2
-rw-r--r--test/fixedbugs/bug288.go2
-rw-r--r--test/fixedbugs/bug289.go2
-rw-r--r--test/fixedbugs/bug290.go2
-rw-r--r--test/fixedbugs/bug291.go2
-rw-r--r--test/fixedbugs/bug292.go2
-rw-r--r--test/fixedbugs/bug293.go2
-rw-r--r--test/fixedbugs/bug294.go2
-rw-r--r--test/fixedbugs/bug295.go2
-rw-r--r--test/fixedbugs/bug296.go2
-rw-r--r--test/fixedbugs/bug297.go2
-rw-r--r--test/fixedbugs/bug298.go2
-rw-r--r--test/fixedbugs/bug299.go2
-rw-r--r--test/fixedbugs/bug300.go2
-rw-r--r--test/fixedbugs/bug301.go2
-rw-r--r--test/fixedbugs/bug302.go2
-rw-r--r--test/fixedbugs/bug303.go2
-rw-r--r--test/fixedbugs/bug304.go2
-rw-r--r--test/fixedbugs/bug305.go2
-rw-r--r--test/fixedbugs/bug307.go2
-rw-r--r--test/fixedbugs/bug308.go2
-rw-r--r--test/fixedbugs/bug309.go6
-rw-r--r--test/fixedbugs/bug310.go20
-rw-r--r--test/fixedbugs/bug311.go2
-rw-r--r--test/fixedbugs/bug312.go2
-rw-r--r--test/fixedbugs/bug314.go2
-rw-r--r--test/fixedbugs/bug315.go2
-rw-r--r--test/fixedbugs/bug316.go2
-rw-r--r--test/fixedbugs/bug317.go2
-rw-r--r--test/fixedbugs/bug318.go2
-rw-r--r--test/fixedbugs/bug319.go2
-rw-r--r--test/fixedbugs/bug320.go2
-rw-r--r--test/fixedbugs/bug321.go2
-rw-r--r--test/fixedbugs/bug323.go2
-rw-r--r--test/fixedbugs/bug325.go2
-rw-r--r--test/fixedbugs/bug326.go22
-rw-r--r--test/fixedbugs/bug327.go2
-rw-r--r--test/fixedbugs/bug328.go2
-rw-r--r--test/fixedbugs/bug328.out1
-rw-r--r--test/fixedbugs/bug329.go2
-rw-r--r--test/fixedbugs/bug330.go6
-rw-r--r--test/fixedbugs/bug331.go16
-rw-r--r--test/fixedbugs/bug332.go2
-rw-r--r--test/fixedbugs/bug333.go2
-rw-r--r--test/fixedbugs/bug334.go2
-rw-r--r--test/fixedbugs/bug336.go2
-rw-r--r--test/fixedbugs/bug337.go4
-rw-r--r--test/fixedbugs/bug338.go2
-rw-r--r--test/fixedbugs/bug339.go2
-rw-r--r--test/fixedbugs/bug340.go8
-rw-r--r--test/fixedbugs/bug341.go2
-rw-r--r--test/fixedbugs/bug342.go2
-rw-r--r--test/fixedbugs/bug343.go2
-rw-r--r--test/fixedbugs/bug344.go6
-rw-r--r--test/fixedbugs/bug345.dir/main.go4
-rw-r--r--test/fixedbugs/bug346.go2
-rw-r--r--test/fixedbugs/bug347.go2
-rw-r--r--test/fixedbugs/bug348.go2
-rw-r--r--test/fixedbugs/bug349.go4
-rw-r--r--test/fixedbugs/bug350.go10
-rw-r--r--test/fixedbugs/bug351.go4
-rw-r--r--test/fixedbugs/bug352.go2
-rw-r--r--test/fixedbugs/bug353.go4
-rw-r--r--test/fixedbugs/bug354.go12
-rw-r--r--test/fixedbugs/bug355.go2
-rw-r--r--test/fixedbugs/bug356.go2
-rw-r--r--test/fixedbugs/bug357.go5
-rw-r--r--test/fixedbugs/bug358.go8
-rw-r--r--test/fixedbugs/bug359.go26
-rw-r--r--test/fixedbugs/bug361.go2
-rw-r--r--test/fixedbugs/bug362.go8
-rw-r--r--test/fixedbugs/bug363.go8
-rw-r--r--test/fixedbugs/bug364.go6
-rw-r--r--test/fixedbugs/bug365.go6
-rw-r--r--test/fixedbugs/bug366.go37
-rw-r--r--test/fixedbugs/bug367.dir/main.go28
-rw-r--r--test/fixedbugs/bug367.dir/p.go19
-rw-r--r--test/fixedbugs/bug367.go7
-rw-r--r--test/fixedbugs/bug368.go26
-rw-r--r--test/fixedbugs/bug369.dir/pkg.go15
-rw-r--r--test/fixedbugs/bug369.go59
-rw-r--r--test/fixedbugs/bug370.go18
-rw-r--r--test/fixedbugs/bug371.go24
-rw-r--r--test/fixedbugs/bug372.go28
-rw-r--r--test/fixedbugs/bug373.go32
-rw-r--r--test/fixedbugs/bug374.go20
-rw-r--r--test/fixedbugs/bug375.go19
-rw-r--r--test/fixedbugs/bug376.go11
-rw-r--r--test/fixedbugs/bug377.dir/one.go10
-rw-r--r--test/fixedbugs/bug377.dir/two.go8
-rw-r--r--test/fixedbugs/bug377.go9
-rw-r--r--test/fixedbugs/bug378.go19
-rw-r--r--test/fixedbugs/bug379.go18
-rw-r--r--test/fixedbugs/bug380.go11
-rw-r--r--test/fixedbugs/bug381.go31
-rw-r--r--test/fixedbugs/bug382.dir/pkg.go7
-rw-r--r--test/fixedbugs/bug382.go14
-rw-r--r--test/fixedbugs/bug383.go13
-rw-r--r--test/fixedbugs/bug384.go12
-rw-r--r--test/fixedbugs/bug385_32.go14
-rw-r--r--test/fixedbugs/bug385_64.go15
-rw-r--r--test/fixedbugs/bug386.go12
-rw-r--r--test/fixedbugs/bug387.go30
-rw-r--r--test/fixedbugs/bug388.go39
-rw-r--r--test/fixedbugs/bug389.go12
-rw-r--r--test/fixedbugs/bug390.go16
-rw-r--r--test/fixedbugs/bug391.go14
-rw-r--r--test/fixedbugs/bug392.dir/one.go43
-rw-r--r--test/fixedbugs/bug392.dir/three.go13
-rw-r--r--test/fixedbugs/bug392.dir/two.go25
-rw-r--r--test/fixedbugs/bug392.go7
-rw-r--r--test/fixedbugs/bug393.go30
-rw-r--r--test/fixedbugs/bug394.go10
-rw-r--r--test/fixedbugs/bug396.dir/one.go9
-rw-r--r--test/fixedbugs/bug396.dir/two.go14
-rw-r--r--test/fixedbugs/bug396.go7
-rw-r--r--test/fixedbugs/bug397.go13
-rw-r--r--test/fixedbugs/bug398.go24
-rw-r--r--test/fixedbugs/bug399.go15
-rw-r--r--test/fixedbugs/bug401.go46
-rw-r--r--test/fixedbugs/bug402.go31
-rw-r--r--test/fixedbugs/bug403.go23
-rw-r--r--test/fixedbugs/bug404.dir/one.go19
-rw-r--r--test/fixedbugs/bug404.dir/two.go12
-rw-r--r--test/fixedbugs/bug404.go7
-rw-r--r--test/fixedbugs/bug405.go24
-rw-r--r--test/fixedbugs/bug406.go25
-rw-r--r--test/fixedbugs/bug407.dir/one.go20
-rw-r--r--test/fixedbugs/bug407.dir/two.go15
-rw-r--r--test/fixedbugs/bug407.go7
-rw-r--r--test/fixedbugs/bug409.go20
-rw-r--r--test/fixedbugs/bug409.out1
-rw-r--r--test/fixedbugs/bug410.go24
-rw-r--r--test/fixedbugs/bug411.go19
-rw-r--r--test/fixedbugs/bug412.go16
-rw-r--r--test/fixedbugs/bug413.go11
-rw-r--r--test/fixedbugs/bug414.dir/main.go18
-rw-r--r--test/fixedbugs/bug414.dir/p1.go21
-rw-r--r--test/fixedbugs/bug414.go7
-rw-r--r--test/fixedbugs/bug415.dir/main.go9
-rw-r--r--test/fixedbugs/bug415.dir/p.go14
-rw-r--r--test/fixedbugs/bug415.go9
-rw-r--r--test/fixedbugs/bug416.go13
-rw-r--r--test/fixedbugs/bug417.go32
-rw-r--r--test/fixedbugs/bug418.go22
-rw-r--r--test/fixedbugs/bug419.go17
-rw-r--r--test/fixedbugs/bug420.go14
-rw-r--r--test/fixedbugs/bug421.go17
-rw-r--r--test/fixedbugs/bug422.go11
-rw-r--r--test/fixedbugs/bug423.go277
-rw-r--r--test/fixedbugs/bug424.dir/lib.go16
-rw-r--r--test/fixedbugs/bug424.go99
-rw-r--r--test/fixedbugs/bug425.go17
-rw-r--r--test/fixedbugs/bug426.go15
-rw-r--r--test/fixedbugs/bug427.go39
-rw-r--r--test/fixedbugs/bug428.go19
-rw-r--r--test/fixedbugs/bug429.go13
-rw-r--r--test/float_lit.go4
-rw-r--r--test/floatcmp.go4
-rw-r--r--test/for.go4
-rw-r--r--test/func.go3
-rw-r--r--test/func1.go7
-rw-r--r--test/func2.go8
-rw-r--r--test/func3.go5
-rw-r--r--test/func4.go6
-rw-r--r--test/func5.go4
-rw-r--r--test/func6.go4
-rw-r--r--test/func7.go4
-rw-r--r--test/func8.go49
-rw-r--r--test/gc.go4
-rw-r--r--test/gc1.go4
-rw-r--r--test/gc2.go12
-rw-r--r--test/golden.out158
-rw-r--r--test/goprint.go4
-rw-r--r--test/goprint.out1
-rw-r--r--test/goto.go145
-rwxr-xr-xtest/hashmap.go181
-rw-r--r--test/helloworld.go4
-rw-r--r--test/helloworld.out1
-rw-r--r--test/if.go4
-rw-r--r--test/import.go13
-rw-r--r--test/import1.go5
-rw-r--r--test/import2.go5
-rw-r--r--test/import3.go2
-rw-r--r--test/import4.go6
-rw-r--r--test/import5.go55
-rw-r--r--test/index.go1
-rw-r--r--test/indirect.go4
-rw-r--r--test/indirect1.go6
-rw-r--r--test/init.go5
-rw-r--r--test/init1.go44
-rw-r--r--test/initcomma.go12
-rw-r--r--test/initialize.go4
-rw-r--r--test/initializerr.go5
-rw-r--r--test/initsyscall.go27
-rw-r--r--test/int_lit.go4
-rw-r--r--test/intcvt.go4
-rw-r--r--test/interface/bigdata.go5
-rw-r--r--test/interface/convert.go5
-rw-r--r--test/interface/convert1.go5
-rw-r--r--test/interface/convert2.go5
-rw-r--r--test/interface/embed.go4
-rw-r--r--test/interface/embed0.go4
-rw-r--r--test/interface/embed1.go2
-rw-r--r--test/interface/embed2.go4
-rw-r--r--test/interface/explicit.go5
-rw-r--r--test/interface/fail.go18
-rw-r--r--test/interface/fake.go4
-rw-r--r--test/interface/noeq.go40
-rw-r--r--test/interface/pointer.go7
-rw-r--r--test/interface/private.go3
-rw-r--r--test/interface/private1.go4
-rw-r--r--test/interface/receiver.go6
-rw-r--r--test/interface/receiver1.go5
-rw-r--r--test/interface/recursive.go4
-rw-r--r--test/interface/recursive1.go17
-rw-r--r--test/interface/recursive2.go22
-rw-r--r--test/interface/returntype.go17
-rw-r--r--test/interface/struct.go4
-rw-r--r--test/iota.go4
-rw-r--r--test/ken/array.go7
-rw-r--r--test/ken/chan.go4
-rw-r--r--test/ken/chan1.go4
-rw-r--r--test/ken/complit.go4
-rw-r--r--test/ken/convert.go5
-rw-r--r--test/ken/cplx0.go4
-rw-r--r--test/ken/cplx0.out4
-rw-r--r--test/ken/cplx1.go4
-rw-r--r--test/ken/cplx2.go16
-rw-r--r--test/ken/cplx3.go27
-rw-r--r--test/ken/cplx4.go33
-rw-r--r--test/ken/cplx5.go34
-rw-r--r--test/ken/divconst.go6
-rw-r--r--test/ken/divmod.go4
-rw-r--r--test/ken/embed.go4
-rw-r--r--test/ken/for.go3
-rw-r--r--test/ken/interbasic.go4
-rw-r--r--test/ken/interfun.go4
-rw-r--r--test/ken/intervar.go29
-rw-r--r--test/ken/label.go28
-rw-r--r--test/ken/litfun.go3
-rw-r--r--test/ken/mfunc.go4
-rw-r--r--test/ken/modconst.go6
-rw-r--r--test/ken/ptrfun.go3
-rw-r--r--test/ken/ptrvar.go3
-rw-r--r--test/ken/range.go4
-rw-r--r--test/ken/rob1.go61
-rw-r--r--test/ken/rob2.go264
-rw-r--r--test/ken/robfor.go4
-rw-r--r--test/ken/robfunc.go4
-rw-r--r--test/ken/shift.go4
-rw-r--r--test/ken/simparray.go4
-rw-r--r--test/ken/simpbool.go4
-rw-r--r--test/ken/simpconv.go4
-rw-r--r--test/ken/simpfun.go3
-rw-r--r--test/ken/simpprint.go13
-rw-r--r--test/ken/simpswitch.go28
-rw-r--r--test/ken/simpvar.go4
-rw-r--r--test/ken/slicearray.go4
-rw-r--r--test/ken/sliceslice.go4
-rw-r--r--test/ken/string.go20
-rw-r--r--test/ken/string.out1
-rw-r--r--test/ken/strvar.go3
-rw-r--r--test/label.go6
-rw-r--r--test/label1.go7
-rw-r--r--test/linkx.go17
-rw-r--r--test/literal.go4
-rw-r--r--test/malloc1.go25
-rw-r--r--test/mallocfin.go14
-rw-r--r--test/mallocrand.go92
-rw-r--r--test/mallocrep.go69
-rw-r--r--test/mallocrep1.go143
-rw-r--r--test/map.go206
-rw-r--r--test/map1.go44
-rw-r--r--test/method.go137
-rw-r--r--test/method1.go5
-rw-r--r--test/method2.go13
-rw-r--r--test/method3.go4
-rw-r--r--test/method4.go106
-rw-r--r--test/method4a.go40
-rw-r--r--test/named.go2
-rw-r--r--test/named1.go12
-rw-r--r--test/nil.go6
-rw-r--r--test/nilptr.go132
-rw-r--r--test/nilptr/arrayindex.go26
-rw-r--r--test/nilptr/arrayindex1.go31
-rw-r--r--test/nilptr/arraytoslice.go36
-rw-r--r--test/nilptr/arraytoslice1.go33
-rw-r--r--test/nilptr/arraytoslice2.go34
-rw-r--r--test/nilptr/slicearray.go32
-rw-r--r--test/nilptr/structfield.go34
-rw-r--r--test/nilptr/structfield1.go37
-rw-r--r--test/nilptr/structfield2.go36
-rw-r--r--test/nilptr/structfieldaddr.go34
-rw-r--r--test/parentype.go4
-rw-r--r--test/peano.go27
-rw-r--r--test/printbig.go4
-rw-r--r--test/printbig.out2
-rw-r--r--test/range.go8
-rw-r--r--test/recover.go29
-rw-r--r--test/recover1.go2
-rw-r--r--test/recover2.go10
-rw-r--r--test/recover3.go6
-rw-r--r--test/rename.go112
-rw-r--r--test/rename1.go72
-rw-r--r--test/reorder.go121
-rw-r--r--test/reorder2.go174
-rwxr-xr-xtest/run24
-rw-r--r--test/run.go465
-rw-r--r--test/rune.go47
-rw-r--r--test/runtime.go7
-rw-r--r--test/safe/main.go14
-rw-r--r--test/safe/nousesafe.go8
-rw-r--r--test/safe/pkg.go16
-rw-r--r--test/safe/usesafe.go8
-rw-r--r--test/shift1.go12
-rw-r--r--test/shift2.go4
-rw-r--r--test/sieve.go5
-rw-r--r--test/sigchld.go5
-rw-r--r--test/sigchld.out1
-rw-r--r--test/simassign.go4
-rw-r--r--test/sinit.go222
-rw-r--r--test/sizeof.go4
-rw-r--r--test/solitaire.go13
-rw-r--r--test/stack.go3
-rw-r--r--test/string_lit.go26
-rw-r--r--test/stringrange.go19
-rw-r--r--test/struct0.go34
-rw-r--r--test/switch.go296
-rw-r--r--test/switch1.go20
-rw-r--r--test/switch3.go61
-rw-r--r--test/syntax/chan.go2
-rw-r--r--test/syntax/chan1.go2
-rw-r--r--test/syntax/else.go12
-rw-r--r--test/syntax/forvar.go2
-rw-r--r--test/syntax/if.go2
-rw-r--r--test/syntax/import.go2
-rw-r--r--test/syntax/interface.go2
-rw-r--r--test/syntax/semi1.go2
-rw-r--r--test/syntax/semi2.go2
-rw-r--r--test/syntax/semi3.go2
-rw-r--r--test/syntax/semi4.go2
-rw-r--r--test/syntax/semi5.go2
-rw-r--r--test/syntax/semi6.go2
-rw-r--r--test/syntax/semi7.go2
-rw-r--r--test/syntax/topexpr.go2
-rw-r--r--test/syntax/typesw.go2
-rw-r--r--test/syntax/vareq.go2
-rw-r--r--test/syntax/vareq1.go2
-rw-r--r--test/test0.go92
-rw-r--r--test/testlib44
-rw-r--r--test/turing.go57
-rw-r--r--test/typeswitch.go9
-rw-r--r--test/typeswitch1.go4
-rw-r--r--test/typeswitch2.go27
-rw-r--r--test/typeswitch3.go43
-rw-r--r--test/undef.go5
-rw-r--r--test/utf.go36
-rw-r--r--test/varerr.go5
-rw-r--r--test/varinit.go4
-rw-r--r--test/vectors.go64
-rw-r--r--test/zerodivide.go15
772 files changed, 11168 insertions, 3227 deletions
diff --git a/test/235.go b/test/235.go
index 03143a60d..6745dde41 100644
--- a/test/235.go
+++ b/test/235.go
@@ -1,9 +1,12 @@
-// $G $F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
+// Solve the 2,3,5 problem (print all numbers with 2, 3, or 5 as factor) using channels.
+// Test the solution, silently.
+
package main
type T chan uint64
diff --git a/test/alias.go b/test/alias.go
new file mode 100644
index 000000000..ec93a2d10
--- /dev/null
+++ b/test/alias.go
@@ -0,0 +1,33 @@
+// errorcheck
+
+// Copyright 2011 The Go Authors. All rights reserved.
+// Use of this source code is governed by a BSD-style
+// license that can be found in the LICENSE file.
+
+// Test that error messages say what the source file says
+// (uint8 vs byte, int32 vs. rune).
+// Does not compile.
+
+package main
+
+import (
+ "fmt"
+ "unicode/utf8"
+)
+
+func f(byte) {}
+func g(uint8) {}
+
+func main() {
+ var x float64
+ f(x) // ERROR "byte"
+ g(x) // ERROR "uint8"
+
+ // Test across imports.
+
+ var ff fmt.Formatter
+ var fs fmt.State
+ ff.Format(fs, x) // ERROR "rune"
+
+ utf8.RuneStart(x) // ERROR "byte"
+}
diff --git a/test/alias1.go b/test/alias1.go
new file mode 100644
index 000000000..4219af8cd
--- /dev/null
+++ b/test/alias1.go
@@ -0,0 +1,54 @@
+// run
+
+// Copyright 2011 The Go Authors. All rights reserved.
+// Use of this source code is governed by a BSD-style
+// license that can be found in the LICENSE file.
+
+// Test that dynamic interface checks treat byte=uint8
+// and rune=int or rune=int32.
+
+package main
+
+func main() {
+ var x interface{}
+
+ x = byte(1)
+ switch x.(type) {
+ case uint8:
+ // ok
+ default:
+ println("byte != uint8")
+ }
+
+ x = uint8(2)
+ switch x.(type) {
+ case byte:
+ // ok
+ default:
+ println("uint8 != byte")
+ }
+
+ rune32 := false
+ x = rune(3)
+ switch x.(type) {
+ case int:
+ // ok
+ case int32:
+ // must be new code
+ rune32 = true
+ default:
+ println("rune != int and rune != int32")
+ }
+
+ if rune32 {
+ x = int32(4)
+ } else {
+ x = int(5)
+ }
+ switch x.(type) {
+ case rune:
+ // ok
+ default:
+ println("int (or int32) != rune")
+ }
+}
diff --git a/test/append.go b/test/append.go
index 96421c36b..3f6251ee5 100644
--- a/test/append.go
+++ b/test/append.go
@@ -1,10 +1,10 @@
-// $G $F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2010 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
-// Semi-exhaustive test for append()
+// Semi-exhaustive test for the append predeclared function.
package main
@@ -27,6 +27,7 @@ func main() {
}
verifyStruct()
verifyInterface()
+ verifyType()
}
@@ -63,6 +64,11 @@ var tests = []struct {
{"byte i", append([]byte{0, 1, 2}, []byte{3}...), []byte{0, 1, 2, 3}},
{"byte j", append([]byte{0, 1, 2}, []byte{3, 4, 5}...), []byte{0, 1, 2, 3, 4, 5}},
+ {"bytestr a", append([]byte{}, "0"...), []byte("0")},
+ {"bytestr b", append([]byte{}, "0123"...), []byte("0123")},
+
+ {"bytestr c", append([]byte("012"), "3"...), []byte("0123")},
+ {"bytestr d", append([]byte("012"), "345"...), []byte("012345")},
{"int16 a", append([]int16{}), []int16{}},
{"int16 b", append([]int16{}, 0), []int16{0}},
@@ -225,3 +231,17 @@ func verifyInterface() {
verify("interface l", append(s), s)
verify("interface m", append(s, e...), r)
}
+
+type T1 []int
+type T2 []int
+
+func verifyType() {
+ // The second argument to append has type []E where E is the
+ // element type of the first argument. Test that the compiler
+ // accepts two slice types that meet that requirement but are
+ // not assignment compatible. The return type of append is
+ // the type of the first argument.
+ t1 := T1{1}
+ t2 := T2{2}
+ verify("T1", append(t1, t2...), T1{1, 2})
+}
diff --git a/test/args.go b/test/args.go
index ba9a377a6..db624e9c2 100644
--- a/test/args.go
+++ b/test/args.go
@@ -4,6 +4,8 @@
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
+// Test os.Args.
+
package main
import "os"
diff --git a/test/assign.go b/test/assign.go
index 59471388c..da0192f83 100644
--- a/test/assign.go
+++ b/test/assign.go
@@ -1,9 +1,12 @@
-// errchk $G -e $D/$F.go
+// errorcheck
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
+// Verify simple assignment errors are caught by the compiler.
+// Does not compile.
+
package main
import "sync"
@@ -16,38 +19,38 @@ type T struct {
func main() {
{
var x, y sync.Mutex
- x = y // ERROR "assignment.*Mutex"
+ x = y // ok
_ = x
}
{
var x, y T
- x = y // ERROR "assignment.*Mutex"
+ x = y // ok
_ = x
}
{
var x, y [2]sync.Mutex
- x = y // ERROR "assignment.*Mutex"
+ x = y // ok
_ = x
}
{
var x, y [2]T
- x = y // ERROR "assignment.*Mutex"
+ x = y // ok
_ = x
}
{
- x := sync.Mutex{0, 0} // ERROR "assignment.*Mutex"
+ x := sync.Mutex{0, 0} // ERROR "assignment.*Mutex"
_ = x
}
{
- x := sync.Mutex{key: 0} // ERROR "(unknown|assignment).*Mutex"
+ x := sync.Mutex{key: 0} // ERROR "(unknown|assignment).*Mutex"
_ = x
}
{
- x := &sync.Mutex{} // ok
- var y sync.Mutex // ok
- y = *x // ERROR "assignment.*Mutex"
- *x = y // ERROR "assignment.*Mutex"
+ x := &sync.Mutex{} // ok
+ var y sync.Mutex // ok
+ y = *x // ok
+ *x = y // ok
_ = x
_ = y
- }
+ }
}
diff --git a/test/assign1.go b/test/assign1.go
index 71e5b4064..b9e0325ce 100644
--- a/test/assign1.go
+++ b/test/assign1.go
@@ -1,9 +1,12 @@
-// errchk $G -e $D/$F.go
+// errorcheck
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
+// Verify assignment rules are enforced by the compiler.
+// Does not compile.
+
package main
type (
diff --git a/test/bench/Makefile b/test/bench/Makefile
deleted file mode 100644
index 145fe0cea..000000000
--- a/test/bench/Makefile
+++ /dev/null
@@ -1,14 +0,0 @@
-# Copyright 2011 The Go Authors. All rights reserved.
-# Use of this source code is governed by a BSD-style
-# license that can be found in the LICENSE file.
-
-include ../../src/Make.inc
-
-all:
- @echo "make clean or timing"
-
-timing:
- ./timing.sh
-
-clean:
- rm -f [568].out *.[568]
diff --git a/test/garbage/Makefile b/test/bench/garbage/Makefile
index e83384382..98838453a 100644
--- a/test/garbage/Makefile
+++ b/test/bench/garbage/Makefile
@@ -2,26 +2,22 @@
# Use of this source code is governed by a BSD-style
# license that can be found in the LICENSE file.
-include ../../src/Make.inc
-
ALL=\
parser\
peano\
tree\
+ tree2\
-all: $(addsuffix .out, $(ALL))
-
-%.$O: %.go stats.go
- $(GC) $*.go stats.go
+all: $(ALL)
-%.out: %.$O
- $(LD) -o $@ $*.$O
+%: %.go
+ go build $*.go stats.go
-%.bench: %.out
- ./$*.out
+%.bench: %
+ time ./$*
bench: $(addsuffix .bench, $(ALL))
clean:
- rm -f *.[$(OS)] $(addsuffix .out, $(ALL))
+ rm -f $(ALL)
diff --git a/test/garbage/parser.go b/test/bench/garbage/parser.go
index 19a96bc63..d66281b6b 100644
--- a/test/garbage/parser.go
+++ b/test/bench/garbage/parser.go
@@ -12,27 +12,27 @@ import (
"go/ast"
"go/parser"
"go/token"
+ "log"
+ "net/http"
+ _ "net/http/pprof"
"os"
"path"
"runtime"
"strings"
"time"
- "http"
- _ "http/pprof"
- "log"
)
var serve = flag.String("serve", "", "serve http on this address at end")
-func isGoFile(dir *os.FileInfo) bool {
- return dir.IsRegular() &&
- !strings.HasPrefix(dir.Name, ".") && // ignore .files
- path.Ext(dir.Name) == ".go"
+func isGoFile(dir os.FileInfo) bool {
+ return !dir.IsDir() &&
+ !strings.HasPrefix(dir.Name(), ".") && // ignore .files
+ path.Ext(dir.Name()) == ".go"
}
-func isPkgFile(dir *os.FileInfo) bool {
+func isPkgFile(dir os.FileInfo) bool {
return isGoFile(dir) &&
- !strings.HasSuffix(dir.Name, "_test.go") // ignore test files
+ !strings.HasSuffix(dir.Name(), "_test.go") // ignore test files
}
func pkgName(filename string) string {
@@ -49,7 +49,7 @@ func parseDir(dirpath string) map[string]*ast.Package {
_, pkgname := path.Split(dirpath)
// filter function to select the desired .go files
- filter := func(d *os.FileInfo) bool {
+ filter := func(d os.FileInfo) bool {
if isPkgFile(d) {
// Some directories contain main packages: Only accept
// files that belong to the expected package so that
@@ -57,7 +57,7 @@ func parseDir(dirpath string) map[string]*ast.Package {
// found" errors.
// Additionally, accept the special package name
// fakePkgName if we are looking at cmd documentation.
- name := pkgName(dirpath + "/" + d.Name)
+ name := pkgName(dirpath + "/" + d.Name())
return name == pkgname
}
return false
@@ -66,18 +66,14 @@ func parseDir(dirpath string) map[string]*ast.Package {
// get package AST
pkgs, err := parser.ParseDir(token.NewFileSet(), dirpath, filter, parser.ParseComments)
if err != nil {
- println("parse", dirpath, err.String())
+ println("parse", dirpath, err.Error())
panic("fail")
}
return pkgs
}
func main() {
- runtime.GOMAXPROCS(4)
- go func() {}()
- go func() {}()
- go func() {}()
- st := &runtime.MemStats
+ st := new(runtime.MemStats)
packages = append(packages, packages...)
packages = append(packages, packages...)
n := flag.Int("n", 4, "iterations")
@@ -86,16 +82,19 @@ func main() {
flag.Parse()
var lastParsed []map[string]*ast.Package
- var t0 int64
+ var t0 time.Time
+ var numGC uint32
+ var pauseTotalNs uint64
pkgroot := runtime.GOROOT() + "/src/pkg/"
for pass := 0; pass < 2; pass++ {
// Once the heap is grown to full size, reset counters.
// This hides the start-up pauses, which are much smaller
// than the normal pauses and would otherwise make
// the average look much better than it actually is.
- st.NumGC = 0
- st.PauseTotalNs = 0
- t0 = time.Nanoseconds()
+ runtime.ReadMemStats(st)
+ numGC = st.NumGC
+ pauseTotalNs = st.PauseTotalNs
+ t0 = time.Now()
for i := 0; i < *n; i++ {
parsed := make([]map[string]*ast.Package, *p)
@@ -109,8 +108,11 @@ func main() {
runtime.GC()
runtime.GC()
}
- t1 := time.Nanoseconds()
+ t1 := time.Now()
+ runtime.ReadMemStats(st)
+ st.NumGC -= numGC
+ st.PauseTotalNs -= pauseTotalNs
fmt.Printf("Alloc=%d/%d Heap=%d Mallocs=%d PauseTime=%.3f/%d = %.3f\n",
st.Alloc, st.TotalAlloc,
st.Sys,
@@ -124,7 +126,7 @@ func main() {
}
*/
// Standard gotest benchmark output, collected by build dashboard.
- gcstats("BenchmarkParser", *n, t1-t0)
+ gcstats("BenchmarkParser", *n, t1.Sub(t0))
if *serve != "" {
log.Fatal(http.ListenAndServe(*serve, nil))
@@ -132,26 +134,21 @@ func main() {
}
}
-
var packages = []string{
"archive/tar",
- "asn1",
- "big",
+ "encoding/asn1",
+ "math/big",
"bufio",
"bytes",
- "cmath",
+ "math/cmplx",
"compress/flate",
"compress/gzip",
"compress/zlib",
"container/heap",
"container/list",
"container/ring",
- "container/vector",
"crypto/aes",
- "crypto/block",
- "crypto/blowfish",
"crypto/hmac",
- "crypto/md4",
"crypto/md5",
"crypto/rand",
"crypto/rc4",
@@ -162,25 +159,17 @@ var packages = []string{
"crypto/subtle",
"crypto/tls",
"crypto/x509",
- "crypto/xtea",
"debug/dwarf",
"debug/macho",
"debug/elf",
"debug/gosym",
- "debug/proc",
- "ebnf",
+ "exp/ebnf",
"encoding/ascii85",
"encoding/base64",
"encoding/binary",
- "encoding/git85",
"encoding/hex",
"encoding/pem",
- "exec",
- "exp/datafmt",
- "exp/draw",
- "exp/eval",
- "exp/iterable",
- "expvar",
+ "os/exec",
"flag",
"fmt",
"go/ast",
@@ -189,49 +178,47 @@ var packages = []string{
"go/printer",
"go/scanner",
"go/token",
- "gob",
+ "encoding/gob",
"hash",
"hash/adler32",
"hash/crc32",
"hash/crc64",
- "http",
+ "net/http",
"image",
"image/jpeg",
"image/png",
"io",
"io/ioutil",
- "json",
+ "encoding/json",
"log",
"math",
"mime",
"net",
"os",
- "os/signal",
- "patch",
+ "exp/signal",
"path",
- "rand",
+ "math/rand",
"reflect",
"regexp",
- "rpc",
+ "net/rpc",
"runtime",
- "scanner",
+ "text/scanner",
"sort",
- "smtp",
+ "net/smtp",
"strconv",
"strings",
"sync",
"syscall",
- "syslog",
- "tabwriter",
- "template",
+ "log/syslog",
+ "text/tabwriter",
+ "text/template",
"testing",
"testing/iotest",
"testing/quick",
"testing/script",
"time",
"unicode",
- "utf8",
- "utf16",
- "websocket",
- "xml",
+ "unicode/utf8",
+ "unicode/utf16",
+ "encoding/xml",
}
diff --git a/test/garbage/peano.go b/test/bench/garbage/peano.go
index b4d318561..6c7e52314 100644
--- a/test/garbage/peano.go
+++ b/test/bench/garbage/peano.go
@@ -1,4 +1,4 @@
-// $G $F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
@@ -12,31 +12,25 @@ import (
"time"
)
-
type Number struct {
next *Number
}
-
// -------------------------------------
// Peano primitives
func zero() *Number { return nil }
-
func is_zero(x *Number) bool { return x == nil }
-
func add1(x *Number) *Number {
e := new(Number)
e.next = x
return e
}
-
func sub1(x *Number) *Number { return x.next }
-
func add(x, y *Number) *Number {
if is_zero(y) {
return x
@@ -45,7 +39,6 @@ func add(x, y *Number) *Number {
return add(add1(x), sub1(y))
}
-
func mul(x, y *Number) *Number {
if is_zero(x) || is_zero(y) {
return zero()
@@ -54,7 +47,6 @@ func mul(x, y *Number) *Number {
return add(mul(x, sub1(y)), x)
}
-
func fact(n *Number) *Number {
if is_zero(n) {
return add1(zero())
@@ -63,7 +55,6 @@ func fact(n *Number) *Number {
return mul(fact(sub1(n)), n)
}
-
// -------------------------------------
// Helpers to generate/count Peano integers
@@ -75,7 +66,6 @@ func gen(n int) *Number {
return zero()
}
-
func count(x *Number) int {
if is_zero(x) {
return 0
@@ -84,7 +74,6 @@ func count(x *Number) int {
return count(sub1(x)) + 1
}
-
func check(x *Number, expected int) {
var c = count(x)
if c != expected {
@@ -92,7 +81,6 @@ func check(x *Number, expected int) {
}
}
-
// -------------------------------------
// Test basic functionality
@@ -117,19 +105,17 @@ func verify() {
check(fact(gen(5)), 120)
}
-
// -------------------------------------
// Factorial
-
func main() {
- t0 := time.Nanoseconds()
+ t0 := time.Now()
verify()
for i := 0; i <= 9; i++ {
print(i, "! = ", count(fact(gen(i))), "\n")
}
runtime.GC()
- t1 := time.Nanoseconds()
+ t1 := time.Now()
- gcstats("BenchmarkPeano", 1, t1-t0)
+ gcstats("BenchmarkPeano", 1, t1.Sub(t0))
}
diff --git a/test/garbage/stats.go b/test/bench/garbage/stats.go
index 474e6ad4a..cdcb32f9b 100644
--- a/test/garbage/stats.go
+++ b/test/bench/garbage/stats.go
@@ -8,12 +8,14 @@ import (
"fmt"
"runtime"
"sort"
+ "time"
)
-func gcstats(name string, n int, t int64) {
- st := &runtime.MemStats
+func gcstats(name string, n int, t time.Duration) {
+ st := new(runtime.MemStats)
+ runtime.ReadMemStats(st)
fmt.Printf("garbage.%sMem Alloc=%d/%d Heap=%d NextGC=%d Mallocs=%d\n", name, st.Alloc, st.TotalAlloc, st.Sys, st.NextGC, st.Mallocs)
- fmt.Printf("garbage.%s %d %d ns/op\n", name, n, t/int64(n))
+ fmt.Printf("garbage.%s %d %d ns/op\n", name, n, t.Nanoseconds()/int64(n))
fmt.Printf("garbage.%sLastPause 1 %d ns/op\n", name, st.PauseNs[(st.NumGC-1)%uint32(len(st.PauseNs))])
fmt.Printf("garbage.%sPause %d %d ns/op\n", name, st.NumGC, int64(st.PauseTotalNs)/int64(st.NumGC))
nn := int(st.NumGC)
@@ -22,13 +24,14 @@ func gcstats(name string, n int, t int64) {
}
t1, t2, t3, t4, t5 := tukey5(st.PauseNs[0:nn])
fmt.Printf("garbage.%sPause5: %d %d %d %d %d\n", name, t1, t2, t3, t4, t5)
-
-// fmt.Printf("garbage.%sScan: %v\n", name, st.ScanDist)
+
+ // fmt.Printf("garbage.%sScan: %v\n", name, st.ScanDist)
}
type T []uint64
-func (t T) Len() int { return len(t) }
-func (t T) Swap(i, j int) { t[i], t[j] = t[j], t[i] }
+
+func (t T) Len() int { return len(t) }
+func (t T) Swap(i, j int) { t[i], t[j] = t[j], t[i] }
func (t T) Less(i, j int) bool { return t[i] < t[j] }
func tukey5(raw []uint64) (lo, q1, q2, q3, hi uint64) {
diff --git a/test/garbage/tree.go b/test/bench/garbage/tree.go
index c5eae9760..0a3ec234d 100644
--- a/test/garbage/tree.go
+++ b/test/bench/garbage/tree.go
@@ -68,7 +68,7 @@ const minDepth = 4
func main() {
flag.Parse()
- t0 := time.Nanoseconds()
+ t0 := time.Now()
maxDepth := *n
if minDepth+2 > *n {
@@ -93,8 +93,8 @@ func main() {
}
fmt.Printf("long lived tree of depth %d\t check: %d\n", maxDepth, longLivedTree.itemCheck())
- t1 := time.Nanoseconds()
+ t1 := time.Now()
// Standard gotest benchmark output, collected by build dashboard.
- gcstats("BenchmarkTree", *n, t1-t0)
+ gcstats("BenchmarkTree", *n, t1.Sub(t0))
}
diff --git a/test/bench/garbage/tree2.go b/test/bench/garbage/tree2.go
new file mode 100644
index 000000000..3db0a0ba3
--- /dev/null
+++ b/test/bench/garbage/tree2.go
@@ -0,0 +1,89 @@
+// Copyright 2012 The Go Authors. All rights reserved.
+// Use of this source code is governed by a BSD-style
+// license that can be found in the LICENSE file.
+
+package main
+
+import (
+ "flag"
+ "fmt"
+ "log"
+ "os"
+ "runtime"
+ "runtime/pprof"
+ "unsafe"
+)
+
+const BranchingFactor = 4
+
+type Object struct {
+ child [BranchingFactor]*Object
+}
+
+var (
+ cpus = flag.Int("cpus", 1, "number of cpus to use")
+ heapsize = flag.Int64("heapsize", 100*1024*1024, "size of the heap in bytes")
+ cpuprofile = flag.String("cpuprofile", "", "write cpu profile to file")
+
+ lastPauseNs uint64 = 0
+ lastFree uint64 = 0
+ heap *Object
+ calls [20]int
+ numobjects int64
+ memstats runtime.MemStats
+)
+
+func buildHeap() {
+ objsize := int64(unsafe.Sizeof(Object{}))
+ heap, _ = buildTree(float64(objsize), float64(*heapsize), 0)
+ fmt.Printf("*** built heap: %.0f MB; (%d objects * %d bytes)\n",
+ float64(*heapsize)/1048576, numobjects, objsize)
+}
+
+func buildTree(objsize, size float64, depth int) (*Object, float64) {
+ calls[depth]++
+ x := &Object{}
+ numobjects++
+ subtreeSize := (size - objsize) / BranchingFactor
+ alloc := objsize
+ for i := 0; i < BranchingFactor && alloc < size; i++ {
+ c, n := buildTree(objsize, subtreeSize, depth+1)
+ x.child[i] = c
+ alloc += n
+ }
+ return x, alloc
+}
+
+func gc() {
+ runtime.GC()
+ runtime.ReadMemStats(&memstats)
+ pause := memstats.PauseTotalNs
+ inuse := memstats.Alloc
+ free := memstats.TotalAlloc - inuse
+ fmt.Printf("gc pause: %8.3f ms; collect: %8.0f MB; heapsize: %8.0f MB\n",
+ float64(pause-lastPauseNs)/1e6,
+ float64(free-lastFree)/1048576,
+ float64(inuse)/1048576)
+ lastPauseNs = pause
+ lastFree = free
+}
+
+func main() {
+ flag.Parse()
+ buildHeap()
+ runtime.GOMAXPROCS(*cpus)
+ runtime.ReadMemStats(&memstats)
+ lastPauseNs = memstats.PauseTotalNs
+ lastFree = memstats.TotalAlloc - memstats.Alloc
+ if *cpuprofile != "" {
+ f, err := os.Create(*cpuprofile)
+ if err != nil {
+ log.Fatal(err)
+ }
+ pprof.StartCPUProfile(f)
+ defer pprof.StopCPUProfile()
+ }
+ for i := 0; i < 10; i++ {
+ gc()
+ }
+}
diff --git a/test/bench/go1/binarytree_test.go b/test/bench/go1/binarytree_test.go
new file mode 100644
index 000000000..c64c4b881
--- /dev/null
+++ b/test/bench/go1/binarytree_test.go
@@ -0,0 +1,63 @@
+// Copyright 2011 The Go Authors. All rights reserved.
+// Use of this source code is governed by a BSD-style
+// license that can be found in the LICENSE file.
+
+// This benchmark, taken from the shootout, tests garbage collector
+// performance by generating and discarding large binary trees.
+
+package go1
+
+import "testing"
+
+type binaryNode struct {
+ item int
+ left, right *binaryNode
+}
+
+func bottomUpTree(item, depth int) *binaryNode {
+ if depth <= 0 {
+ return &binaryNode{item: item}
+ }
+ return &binaryNode{item, bottomUpTree(2*item-1, depth-1), bottomUpTree(2*item, depth-1)}
+}
+
+func (n *binaryNode) itemCheck() int {
+ if n.left == nil {
+ return n.item
+ }
+ return n.item + n.left.itemCheck() - n.right.itemCheck()
+}
+
+const minDepth = 4
+
+func binarytree(n int) {
+ maxDepth := n
+ if minDepth+2 > n {
+ maxDepth = minDepth + 2
+ }
+ stretchDepth := maxDepth + 1
+
+ check := bottomUpTree(0, stretchDepth).itemCheck()
+ //fmt.Printf("stretch tree of depth %d\t check: %d\n", stretchDepth, check)
+
+ longLivedTree := bottomUpTree(0, maxDepth)
+
+ for depth := minDepth; depth <= maxDepth; depth += 2 {
+ iterations := 1 << uint(maxDepth-depth+minDepth)
+ check = 0
+
+ for i := 1; i <= iterations; i++ {
+ check += bottomUpTree(i, depth).itemCheck()
+ check += bottomUpTree(-i, depth).itemCheck()
+ }
+ //fmt.Printf("%d\t trees of depth %d\t check: %d\n", iterations*2, depth, check)
+ }
+ longLivedTree.itemCheck()
+ //fmt.Printf("long lived tree of depth %d\t check: %d\n", maxDepth, longLivedTree.itemCheck())
+}
+
+func BenchmarkBinaryTree17(b *testing.B) {
+ for i := 0; i < b.N; i++ {
+ binarytree(17)
+ }
+}
diff --git a/test/bench/go1/fannkuch_test.go b/test/bench/go1/fannkuch_test.go
new file mode 100644
index 000000000..ae45bfd88
--- /dev/null
+++ b/test/bench/go1/fannkuch_test.go
@@ -0,0 +1,84 @@
+// Copyright 2011 The Go Authors. All rights reserved.
+// Use of this source code is governed by a BSD-style
+// license that can be found in the LICENSE file.
+
+// This benchmark, taken from the shootout, tests array indexing
+// and array bounds elimination performance.
+
+package go1
+
+import "testing"
+
+func fannkuch(n int) int {
+ if n < 1 {
+ return 0
+ }
+
+ n1 := n - 1
+ perm := make([]int, n)
+ perm1 := make([]int, n)
+ count := make([]int, n)
+
+ for i := 0; i < n; i++ {
+ perm1[i] = i // initial (trivial) permutation
+ }
+
+ r := n
+ didpr := 0
+ flipsMax := 0
+ for {
+ if didpr < 30 {
+ didpr++
+ }
+ for ; r != 1; r-- {
+ count[r-1] = r
+ }
+
+ if perm1[0] != 0 && perm1[n1] != n1 {
+ flips := 0
+ for i := 1; i < n; i++ { // perm = perm1
+ perm[i] = perm1[i]
+ }
+ k := perm1[0] // cache perm[0] in k
+ for { // k!=0 ==> k>0
+ for i, j := 1, k-1; i < j; i, j = i+1, j-1 {
+ perm[i], perm[j] = perm[j], perm[i]
+ }
+ flips++
+ // Now exchange k (caching perm[0]) and perm[k]... with care!
+ j := perm[k]
+ perm[k] = k
+ k = j
+ if k == 0 {
+ break
+ }
+ }
+ if flipsMax < flips {
+ flipsMax = flips
+ }
+ }
+
+ for ; r < n; r++ {
+ // rotate down perm[0..r] by one
+ perm0 := perm1[0]
+ for i := 0; i < r; i++ {
+ perm1[i] = perm1[i+1]
+ }
+ perm1[r] = perm0
+ count[r]--
+ if count[r] > 0 {
+ break
+ }
+ }
+ if r == n {
+ return flipsMax
+ }
+ }
+ return 0
+}
+
+func BenchmarkFannkuch11(b *testing.B) {
+ for i := 0; i < b.N; i++ {
+ fannkuch(11)
+ }
+}
diff --git a/test/bench/go1/fasta_test.go b/test/bench/go1/fasta_test.go
new file mode 100644
index 000000000..dcb2d1055
--- /dev/null
+++ b/test/bench/go1/fasta_test.go
@@ -0,0 +1,164 @@
+// Copyright 2011 The Go Authors. All rights reserved.
+// Use of this source code is governed by a BSD-style
+// license that can be found in the LICENSE file.
+
+package go1
+
+// Not a benchmark; input for revcomp.
+
+var fasta25m = fasta(25e6)
+
+func fasta(n int) []byte {
+ out := make(fastaBuffer, 0, 11*n)
+
+ iub := []fastaAcid{
+ {prob: 0.27, sym: 'a'},
+ {prob: 0.12, sym: 'c'},
+ {prob: 0.12, sym: 'g'},
+ {prob: 0.27, sym: 't'},
+ {prob: 0.02, sym: 'B'},
+ {prob: 0.02, sym: 'D'},
+ {prob: 0.02, sym: 'H'},
+ {prob: 0.02, sym: 'K'},
+ {prob: 0.02, sym: 'M'},
+ {prob: 0.02, sym: 'N'},
+ {prob: 0.02, sym: 'R'},
+ {prob: 0.02, sym: 'S'},
+ {prob: 0.02, sym: 'V'},
+ {prob: 0.02, sym: 'W'},
+ {prob: 0.02, sym: 'Y'},
+ }
+
+ homosapiens := []fastaAcid{
+ {prob: 0.3029549426680, sym: 'a'},
+ {prob: 0.1979883004921, sym: 'c'},
+ {prob: 0.1975473066391, sym: 'g'},
+ {prob: 0.3015094502008, sym: 't'},
+ }
+
+ alu := []byte(
+ "GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG" +
+ "GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA" +
+ "CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT" +
+ "ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA" +
+ "GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG" +
+ "AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC" +
+ "AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA")
+
+ out.WriteString(">ONE Homo sapiens alu\n")
+ fastaRepeat(&out, alu, 2*n)
+ out.WriteString(">TWO IUB ambiguity codes\n")
+ fastaRandom(&out, iub, 3*n)
+ out.WriteString(">THREE Homo sapiens frequency\n")
+ fastaRandom(&out, homosapiens, 5*n)
+ return out
+}
+
+type fastaBuffer []byte
+
+func (b *fastaBuffer) Flush() {
+ panic("flush")
+}
+
+func (b *fastaBuffer) WriteString(s string) {
+ p := b.NextWrite(len(s))
+ copy(p, s)
+}
+
+func (b *fastaBuffer) NextWrite(n int) []byte {
+ p := *b
+ if len(p)+n > cap(p) {
+ b.Flush()
+ p = *b
+ }
+ out := p[len(p) : len(p)+n]
+ *b = p[:len(p)+n]
+ return out
+}
+
+const fastaLine = 60
+
+func fastaRepeat(out *fastaBuffer, alu []byte, n int) {
+ buf := append(alu, alu...)
+ off := 0
+ for n > 0 {
+ m := n
+ if m > fastaLine {
+ m = fastaLine
+ }
+ buf1 := out.NextWrite(m + 1)
+ copy(buf1, buf[off:])
+ buf1[m] = '\n'
+ if off += m; off >= len(alu) {
+ off -= len(alu)
+ }
+ n -= m
+ }
+}
+
+const (
+ fastaLookupSize = 4096
+ fastaLookupScale float64 = fastaLookupSize - 1
+)
+
+var fastaRand uint32 = 42
+
+type fastaAcid struct {
+ sym byte
+ prob float64
+ cprob float64
+ next *fastaAcid
+}
+
+func fastaComputeLookup(acid []fastaAcid) *[fastaLookupSize]*fastaAcid {
+ var lookup [fastaLookupSize]*fastaAcid
+ var p float64
+ for i := range acid {
+ p += acid[i].prob
+ acid[i].cprob = p * fastaLookupScale
+ if i > 0 {
+ acid[i-1].next = &acid[i]
+ }
+ }
+ acid[len(acid)-1].cprob = 1.0 * fastaLookupScale
+
+ j := 0
+ for i := range lookup {
+ for acid[j].cprob < float64(i) {
+ j++
+ }
+ lookup[i] = &acid[j]
+ }
+
+ return &lookup
+}
+
+func fastaRandom(out *fastaBuffer, acid []fastaAcid, n int) {
+ const (
+ IM = 139968
+ IA = 3877
+ IC = 29573
+ )
+ lookup := fastaComputeLookup(acid)
+ for n > 0 {
+ m := n
+ if m > fastaLine {
+ m = fastaLine
+ }
+ buf := out.NextWrite(m + 1)
+ f := fastaLookupScale / IM
+ myrand := fastaRand
+ for i := 0; i < m; i++ {
+ myrand = (myrand*IA + IC) % IM
+ r := float64(int(myrand)) * f
+ a := lookup[int(r)]
+ for a.cprob < r {
+ a = a.next
+ }
+ buf[i] = a.sym
+ }
+ fastaRand = myrand
+ buf[m] = '\n'
+ n -= m
+ }
+}
diff --git a/test/bench/go1/gob_test.go b/test/bench/go1/gob_test.go
new file mode 100644
index 000000000..00eeed57a
--- /dev/null
+++ b/test/bench/go1/gob_test.go
@@ -0,0 +1,95 @@
+// Copyright 2011 The Go Authors. All rights reserved.
+// Use of this source code is governed by a BSD-style
+// license that can be found in the LICENSE file.
+
+// This benchmark tests gob encoding and decoding performance.
+
+package go1
+
+import (
+ "bytes"
+ "encoding/gob"
+ "encoding/json"
+ "io/ioutil"
+ "log"
+ "reflect"
+ "testing"
+)
+
+var (
+ gobbytes []byte
+ gobdata *JSONResponse
+)
+
+func gobinit() {
+ // gobinit is called after json's init,
+ // because it uses jsondata.
+ gobdata = gobResponse(&jsondata)
+
+ var buf bytes.Buffer
+ if err := gob.NewEncoder(&buf).Encode(gobdata); err != nil {
+ panic(err)
+ }
+ gobbytes = buf.Bytes()
+
+ var r JSONResponse
+ if err := gob.NewDecoder(bytes.NewBuffer(gobbytes)).Decode(&r); err != nil {
+ panic(err)
+ }
+ if !reflect.DeepEqual(gobdata, &r) {
+ log.Printf("%v\n%v", jsondata, r)
+ b, _ := json.Marshal(&jsondata)
+ br, _ := json.Marshal(&r)
+ log.Printf("%s\n%s\n", b, br)
+ panic("gob: encode+decode lost data")
+ }
+}
+
+// gob turns [] into null, so make a copy of the data structure like that
+func gobResponse(r *JSONResponse) *JSONResponse {
+ return &JSONResponse{gobNode(r.Tree), r.Username}
+}
+
+func gobNode(n *JSONNode) *JSONNode {
+ n1 := new(JSONNode)
+ *n1 = *n
+ if len(n1.Kids) == 0 {
+ n1.Kids = nil
+ } else {
+ for i, k := range n1.Kids {
+ n1.Kids[i] = gobNode(k)
+ }
+ }
+ return n1
+}
+
+func gobdec() {
+ if gobbytes == nil {
+ panic("gobdata not initialized")
+ }
+ var r JSONResponse
+ if err := gob.NewDecoder(bytes.NewBuffer(gobbytes)).Decode(&r); err != nil {
+ panic(err)
+ }
+ _ = r
+}
+
+func gobenc() {
+ if err := gob.NewEncoder(ioutil.Discard).Encode(&gobdata); err != nil {
+ panic(err)
+ }
+}
+
+func BenchmarkGobDecode(b *testing.B) {
+ b.SetBytes(int64(len(gobbytes)))
+ for i := 0; i < b.N; i++ {
+ gobdec()
+ }
+}
+
+func BenchmarkGobEncode(b *testing.B) {
+ b.SetBytes(int64(len(gobbytes)))
+ for i := 0; i < b.N; i++ {
+ gobenc()
+ }
+}
diff --git a/test/bench/go1/gzip_test.go b/test/bench/go1/gzip_test.go
new file mode 100644
index 000000000..fe4c480eb
--- /dev/null
+++ b/test/bench/go1/gzip_test.go
@@ -0,0 +1,63 @@
+// Copyright 2011 The Go Authors. All rights reserved.
+// Use of this source code is governed by a BSD-style
+// license that can be found in the LICENSE file.
+
+// This benchmark tests gzip and gunzip performance.
+
+package go1
+
+import (
+ "bytes"
+ gz "compress/gzip"
+ "io"
+ "io/ioutil"
+ "testing"
+)
+
+var (
+ jsongunz = bytes.Repeat(jsonbytes, 10)
+ jsongz []byte
+)
+
+func init() {
+ var buf bytes.Buffer
+ c := gz.NewWriter(&buf)
+ c.Write(jsongunz)
+ c.Close()
+ jsongz = buf.Bytes()
+}
+
+func gzip() {
+ c := gz.NewWriter(ioutil.Discard)
+ if _, err := c.Write(jsongunz); err != nil {
+ panic(err)
+ }
+ if err := c.Close(); err != nil {
+ panic(err)
+ }
+}
+
+func gunzip() {
+ r, err := gz.NewReader(bytes.NewBuffer(jsongz))
+ if err != nil {
+ panic(err)
+ }
+ if _, err := io.Copy(ioutil.Discard, r); err != nil {
+ panic(err)
+ }
+ r.Close()
+}
+
+func BenchmarkGzip(b *testing.B) {
+ b.SetBytes(int64(len(jsongunz)))
+ for i := 0; i < b.N; i++ {
+ gzip()
+ }
+}
+
+func BenchmarkGunzip(b *testing.B) {
+ b.SetBytes(int64(len(jsongunz)))
+ for i := 0; i < b.N; i++ {
+ gunzip()
+ }
+}
diff --git a/test/bench/go1/json_test.go b/test/bench/go1/json_test.go
new file mode 100644
index 000000000..5a3012167
--- /dev/null
+++ b/test/bench/go1/json_test.go
@@ -0,0 +1,84 @@
+// Copyright 2011 The Go Authors. All rights reserved.
+// Use of this source code is governed by a BSD-style
+// license that can be found in the LICENSE file.
+
+// This benchmark tests JSON encoding and decoding performance.
+
+package go1
+
+import (
+ "compress/bzip2"
+ "encoding/base64"
+ "encoding/json"
+ "io"
+ "io/ioutil"
+ "strings"
+ "testing"
+)
+
+var (
+ jsonbytes []byte
+ jsondata JSONResponse
+)
+
+func init() {
+ var r io.Reader
+ r = strings.NewReader(jsonbz2_base64)
+ r = base64.NewDecoder(base64.StdEncoding, r)
+ r = bzip2.NewReader(r)
+ b, err := ioutil.ReadAll(r)
+ if err != nil {
+ panic(err)
+ }
+ jsonbytes = b
+
+ if err := json.Unmarshal(jsonbytes, &jsondata); err != nil {
+ panic(err)
+ }
+ gobinit()
+}
+
+type JSONResponse struct {
+ Tree *JSONNode `json:"tree"`
+ Username string `json:"username"`
+}
+
+type JSONNode struct {
+ Name string `json:"name"`
+ Kids []*JSONNode `json:"kids"`
+ CLWeight float64 `json:"cl_weight"`
+ Touches int `json:"touches"`
+ MinT int64 `json:"min_t"`
+ MaxT int64 `json:"max_t"`
+ MeanT int64 `json:"mean_t"`
+}
+
+func jsondec() {
+ var r JSONResponse
+ if err := json.Unmarshal(jsonbytes, &r); err != nil {
+ panic(err)
+ }
+ _ = r
+}
+
+func jsonenc() {
+ buf, err := json.Marshal(&jsondata)
+ if err != nil {
+ panic(err)
+ }
+ _ = buf
+}
+
+func BenchmarkJSONEncode(b *testing.B) {
+ b.SetBytes(int64(len(jsonbytes)))
+ for i := 0; i < b.N; i++ {
+ jsonenc()
+ }
+}
+
+func BenchmarkJSONDecode(b *testing.B) {
+ b.SetBytes(int64(len(jsonbytes)))
+ for i := 0; i < b.N; i++ {
+ jsondec()
+ }
+}
diff --git a/test/bench/go1/jsondata_test.go b/test/bench/go1/jsondata_test.go
new file mode 100644
index 000000000..7d42c9665
--- /dev/null
+++ b/test/bench/go1/jsondata_test.go
@@ -0,0 +1,1818 @@
+// Copyright 2011 The Go Authors. All rights reserved.
+// Use of this source code is governed by a BSD-style
+// license that can be found in the LICENSE file.
+
+// Input for JSON and other benchmarks.
+// This was generated by starting with a 2MB JSON file with actual data
+// about open source revision history, then compressing with bzip2 -9,
+// then encoding to base64 with openssl enc -e -base64.
+// The result is 125kB of source instead of 2MB.
+// We compile the data into the binary so that the benchmark is
+// a stand-alone binary that can be copied easily from machine to
+// machine. json_test.go decodes this during init.
+
+package go1
+
+var jsonbz2_base64 = "QlpoOTFBWSZTWZ0H0LkG0bxfgFH8UAf/8D////q////6YSvJveAAAAAH3ddt7gAN" +
+ "FrKppN9gw0gA++fGB9xKkUpX0YWTENCgqzUW1tlsyMB2w9nnvNSigNyS+3cui5zA" +
+ "AAAAAAAAAI4kILu6ytuWTLBbaPXfc+A+PQEgNAG1ZMBYWnWwPoFrGjoBnYMumlUF" +
+ "UKA7NVBQgut30zzu8eM2tsoapJ7u41djLsxZarplSoJouxrdfHrHPSiqAGgkAD6D" +
+ "QfT0ABu7gG1qDtdVHVXp7vWuBoBk2wEOjKChQ5bvbh3riupXZycASbaiQEECRKib" +
+ "ZFJFtqWjR7bsGoaa1lIFPRoKVQKoJFyqbWr5OB1Aie2pobm1EJKqVBU1EE2lCg6a" +
+ "AUBV9hqL00q9btQ0J9hqu2zavWVdjI6aAusU22tNa+8m70GjRqarKRWtUDW2yFBI" +
+ "1kBrrqrxeX3AyB9AD0wAAAeZ6weqV1rVu8UVICgAAABeDn2cAAd9gAACI+7DvjHo" +
+ "j73u8X2dDXT2x6adeFOTNe7BvavozFezkV1xXtJzu8H0983QAHr5aPT42iem53fX" +
+ "23IDr7YejQNtVVZr24gGgB0VQffPXH18g9DoaDW8vt729h9bt72XsKth0ANxgodG" +
+ "iRxvYclAAAAAnpqRtgGvcbo9ABpy6aPQADRZ3aACjyox4NawKCqNdA6offa1WtPc" +
+ "fdjQUPvauprcLoPe2oaplp2w7cnOHdlF27xvPY1QU67vc8goBRttLYKaHXkPAAAA" +
+ "AAdyFFaYCVClAVSlCqVSilFUKEgoNT0CAQCBAk00g1T0jQNNPSbKADQxAJEBESIg" +
+ "Seomk9EB6mjQ0NNGgAAAAkEgkiGk0CR6U9CNNNNNPQRo0ANAaAAk9UpEQmoNNRqe" +
+ "U02o00AAADQABoACJEAlKamUCjZT9UGnqAAG1AGgAAAFRJCAQCBA0SYjTKbQmqea" +
+ "p6YU2o09Q9TT00nAlwPEuSelCeXl28B3IYIQHEwXUMSCvlAYS5LkrZn+XhHHAXZz" +
+ "FTJHAzrKZzYWC0pthA9SCmbkyVzoHbSUjhnAfBrYpwWYIB7GRjOjDQqokMbJENSO" +
+ "SBCN0WhaRhQWpVuoOLN0NPRed7eO5eW2lv5L+X/jf7EpJkEUNMJKZREogmkjMgZJ" +
+ "BiEEEliRIUKAoiaSEoDQZJBhKEZEQySQCAIIFNIMwCiSYRSYzKMkSSlI0xZMZKko" +
+ "RKlRtkmWJIrNNIBEJEYiJBhGMMkWYxRqUsmjKJMmCFJMaSmiyDSaEJtBIJpANKMN" +
+ "JEkpGQAYjLNETGUBRAlBKURgsC0wzKZhRmhiYIQZIsZCIIMiiNmFCCiSZNjI0khE" +
+ "AYSEUkjTMSZskZKRQWJoRNBI2IojZmMhTIkQEgyREEMoomDSiYxAZMECFCSKIkGg" +
+ "kIDIw2MNAlgyA0SmKWSSyIaRCSDDIkZmNGghgyAEoERokkWTA0xZBEQhmUSBGmaQ" +
+ "aQBFmRJMokwxIyRSWbAkbCUFlAhgUISJIRkySYhAxoUARCSaIJMkyiZJNBMyGRIh" +
+ "Y0komKImgMDI/038qLf/av/bWSNVEtmFRx/2aaDVmKkY0NkIRDGJEWoEGLf9g9MV" +
+ "UJWGSu0pWVpSOdWDVjQJGRSChGBGDGhNNMYYwjEsaFISGPT3TbFXk873Xq8vPa9b" +
+ "0dcco0UEPXIl/+em0IMHNYJaXBEsiKQh/7QwsC9gAauDvWtMEBWhGBIBAerIYlBU" +
+ "SzPasze15BfAyGrr284QNjGNEmaUphiMxEMwCZjAYRpMiZBMpEMkkQzIwTDu5zru" +
+ "Xd1xdQ6A6E7m7d03OLnXOxd3HBu50dl0JOhxS4HdHczuO647uuLu6650O67t3Duu" +
+ "3DucukzRKIMhsUjSQQxDIzQJgxohEkYTYkZsAxSDGCJJERhpEAygoZRESSEjMpFE" +
+ "0UpJlBkIYwoyQ7/2f9H/Py8roY3wEn8nr7+72ybZtybdqY06yp1tjGVmsmJvG48y" +
+ "89EXnvy9F6OvX0vpBSIEiSRAmgSASYSkCGBkyc5J63pgiRBNsJW2xjGmmNsf9v7R" +
+ "z1rueFmZcfXzw/zTGRYxsYm2NjbbfXD64GtivKx5t9eubzmsMTbf9rTfKRsYx7YR" +
+ "jHWL7OoAJpsFBJgyAEzSJiLHxfJKWQgSlJjGduRqRxDIoETG4wj+VgUjnMt5PXnm" +
+ "vEQwO7ojzu7lxu7uasg9T00zjrtcaG2RKIwyHx2vUcbjd0OXXvfNafFE3u3t7bu9" +
+ "TpJ1t6SKh9vi13hQUX4d307pPHt553zxxHMGb4KrbbvJGTCcNs3WmOyG2fg5vsuZ" +
+ "jMi+lacpNcvr0XeKDnafDcIvhyL7927rr7/Pzfj7qLVW5dFKIg8+fKpuxf+vfhB+" +
+ "73vWXz3qCPPfw32Mn4c/9mtONctW/fc1sYad9JYn/D1DlDPoyyc7D5bSi3ncMPNH" +
+ "bWmvm42eODHImqooiuXwn95XZlmKYKGK7KdA6lrgzZpEiUccypzKofPy4kbjq6Nh" +
+ "o/ou++j5g2i5alDG/G3Cb0yaOY3lH7wd83fLG1uQ0nDG18UHnnOOsy+Y4u2Nv5Hl" +
+ "jTCKmSJYyBhnB1Lbbafjgaat8zzctvDjPPy7e5IdyZHPSTxq/zkHjinrI5v0/nmG" +
+ "Pp+JUz4odkc9b4/cze19oRNOjG2wb+PkWtt4RRjbBsfupHPO3Mmgc18az57U+TM7" +
+ "gQsH90UPHJCZN4WsaY383qkbxxO20pI23JHbCr3ssnqkVFJG/lN5x6yQydwiaSA6" +
+ "rcgBoSxEDRKIuS1slJsq1MtS6koA5+jFGb17XFu0owrTZZSqsjrkmLVo2tSN44ac" +
+ "fvD3aWfOerth5lG/Jlkfp6bqUbOZs2FpVptDIwCuWVgqIgkgJMtDBFi+2FpRDhEI" +
+ "JAKJtPXloMoKGWpU0YvH9h2nx/hxra8/8UoaoWbia9EeoTlN7Bd5PNdcCDKemn+L" +
+ "cY2qMUXGibc0a33/wjqMN0s8PmTeeup76JA7aKr1nMbhIkn1aX4m5rTPH4aOBlTQ" +
+ "I35HXHwtJ9z1XuF9EQDwDnCS3S9W358a/E4pTeTSVvyKGWTK/n4Xp7V4dB64Ua3Q" +
+ "BIaDtzTsXpXV1k9E54ousxG/XtEhuaGmyCefTL/r3478anc78deNRjg9uchGVxVD" +
+ "Fq6cMZqIdp0ihq0xoIf1zldyBS011SFzq08qfSxV8u0cT70dZgp8ebjk800pU8m2" +
+ "s1kKdj+zvmBEEU+P0+FlzrhOf/ifG2tOsmrlp7B88bbCY9u1VFK7YavjSQ7xtE94" +
+ "3aiJb59/et60wn2vrgeV/jeNd+O/Wt/fp6dNf7iJA5QICcGyiKgpFEFQiCjEGEQC" +
+ "LBIioACSIqiCxSCqIxJIw1GQ0Ua1Vam2qYsmg1rVTbQlmjVbWbaGLbU1kWtlqWrN" +
+ "LVNNaaQICZqIhD/QiASyQCUEBKiRKRAJSUiASySKRAJSD/zAgJUghMIgEojKiCf+" +
+ "CIBP9wICfq+/889/0uxkuba/pJdybzbJvEsZ/CpEx89uGn3OONVtyYDHCGIxNyIx" +
+ "JsYgJYbH+I5RK73DuMZminldjp3e8QpDJju1QToo7pQFEpABpEV4CLQo2QicBAbo" +
+ "SEINjsMsDt9BO4nJzGstqAmgEJwhRyggJYoMJE0sJoa0zOdEgXdwiQssy4L3pzbM" +
+ "CwOaLEYFDBQKzaJCjFh2yhQOHbgLVMHXFUf7jhKTXPWsNDuEPXRHfJuLlKqls5Tx" +
+ "pCC1IgIHnTm5PeWkwwjobODcCdTCa0YoDvMlcZwvmQTkg8KC06oALrhzZqrQmQq6" +
+ "E28rdrSUxBeLkBshIKRh04g4LDdsmTCpNKSszbu9lHOoAwkmTDrOKCmSqExdOsOV" +
+ "D1XsAQpFVMukLCcGYGVFpAp4Bg0VnXFFjjdC8avBE6BepA3q6bOgot8LtHTiIlkb" +
+ "ARVEcldJoYt4Pimls9rpBzDNzeMwOdNAdSkWo4CrsTZ065yPaODXMCkcZCarR0LU" +
+ "voX1R3nDEsLtlyklMo3qrYHIguO1Ci7xRXFwJZjfTrtZfAyzUKhgJcLOIzeTvWjG" +
+ "zDE27OYME6dM3Z2kVeKcV1I4jKga0x3vCKlcUmkjRE1Zzsmxsq7L3zOnQ8wzeGDZ" +
+ "pQO0uN0NpZhcQSuVETbLL2zvKTzqjtBhwIXGaksi8rYKx2Wi6C1J3Ulb1dwqkjat" +
+ "FU6mO1F5Ii+bGnOMaOlc5EKekFDaQ9tjCU1yqcE66xRVh1ndLcBt7ThNI8LbowKP" +
+ "Md0AHRNhdYOJksYIQETYuK3ytX1UEkFHZLCghijoBdFzCgKJmlJSADdF5CnsMoIp" +
+ "pMjeqUgBrXACCcshXWsqyAgenB7IMoT6ZghKl5ljwkJTUVQuhTp3YIWgQCl8eBO7" +
+ "FTzwWGBEw8BDaLuSqMmM0wWE6QVsFIpRwmCRA128BCKpdaVunHbkyuScBsqeFjLJ" +
+ "qAw0WUUIhMN3S5Keua7Wynjnew31G8jecPcVIYxGw3trGziGoCdTHKPOEpO5732V" +
+ "4lnVA4VvKsc+R4OHHQz2JkHFdwSzeiDBUGBiQAJcznd7Z0oCmMykE5KjZuKCyKhd" +
+ "5nTSBBtu1sj6s2JCiZBgpYdOIM4luy6evBlYUYldUQQZKOoAiZL4d7fe003l07CD" +
+ "omKNzZgXiveIrzXjCZel4BcyY752rec3eRoT6jAGZAGEc3kkZQhLcVNCq+qVFSim" +
+ "BuCKZeQr5FF85WTJZzIXXwto0cB2CpntlWr0xWTfLt1yrDg8503VJAdH0uqes4bJ" +
+ "d5wsYFakMZlVS7lsEko6gj0LqyENh3rvG7qYJiQ9xoY33UthsUwRtEF6HUjtHWGA" +
+ "1q5N1HNgiI7rFa5QiEzuCDZ03KzKswfM7185zaRUkRyiUUssQSPAwlc6CAaa2KwB" +
+ "CwsOVTUrpamy4uS+mkF2pVMrpWpG7eYkYjcqSMY+pyDKhDILMmR5HGGc5ml4LJEa" +
+ "A2sxQOlwRDZ0WyiDjMTFnLRKRw6sK02ph9cZnMe8fZrmsJ0710vNY0uY4QFbSrzd" +
+ "WY7FvR2oW0ZI0zyUKMETaoJFAUTUyWuaSjAQt4DbxyqAYcj2ysQneAWKMQAWMoBB" +
+ "hIT0HPY5ne8L49gqYBFQhCXlCmzuzQImhRcjCApqiwAmbWJbzsY5reBB1xT5l5T1" +
+ "ybWy6V0tnJKrLM5WHNy+RpkM2cyZ5hebCcdg7aCc7IdY80lCFwSGCAXNmQXb2QRQ" +
+ "x7k3NRDGXELYQ1gsQhhUDum3ZE72ughHRdRDe5Te6qw1u1LB7lbNrJow7QT1uAV3" +
+ "LMgyxdGjCMORl8Gn2BQuwIUzm8BtHWJnZGBtieoICDTvKJbIMisQ2U1BCZoZlhQX" +
+ "ygQBW0jtgQdslCYNcrXVNnBA+zLTmqmqYeS9YapA12zNGgCPsUFmdoio3ByWaNXs" +
+ "7NrZuGMrSZWRJA0vOHdOWzMw8kjKrskdtyHLanDtiyJzpWVgjo+aaaAkqTKWLcdw" +
+ "xANHQyoZ1XdCK2biAxFgjnDMsxEk4wrWTKgmoae5DQbpESptb1u3Dbpe6qOAZBKa" +
+ "UBJKBZeiCwEJ0WgjFAInS4JGF6SCWBfA6F3ud3YtJTVontzKvsRDk5lipuE0+KVI" +
+ "KnHbGmhhDdShYAZ20BJi8hNs22nd3MxNWKTyqlNVdr1vFs1kiRRBRoZYJt1SAw2W" +
+ "IVY7gXmtBFNaclgFQFjwnNh/g2AZt0p2YbFHgZ1ZkUHIuCAEMTDITBEMBgx4Ecgg" +
+ "OwyuETQ7GUQsGRFZENlWXORDAZBg5I2Qg0CU0NEcuCVhf8E4pyCmHivNaJAP8Dg6" +
+ "HMU/BCCcRX/CAZi3FTsR+gqagg7gfXVQF3AFS45ig+iMnICOKROLlQG9QyjKyxqt" +
+ "rL7DL2NWEoOARpsJENtjCQigyaiVbD8RcRpvD0dJYxh4KmINWGAOAshCD2ihhCBU" +
+ "w7Rz2iEeFpgIN0kKqUcbsJC1I9OQR1ARqIJlDBA9OIaiEhhK4RqJxpaG4HNX26+L" +
+ "L2uVbzYr6uxSpDYDItapRNSDSPMC40zShplaragEHVTTzmCYzRWDaG4boqxNVpQe" +
+ "/U/8feVF+H1z3Iy2hnvDyeOt5n1QI23zarZHe9m7tUTEm75vIImeGztcNqf8/DK0" +
+ "7AS3hyuujbWlvld0RqQIdaW8VAyyAqKpJUEU5BBqICLiixEH2fZwoinThP1ruaww" +
+ "Wxs79RpIWIc1I6VkHrWTkb36HKsT8aCEdYQp8dyc8nHc5Tn1GZ9DqfXs+w6jU5vi" +
+ "5KOwjHVB4s9RJbGxesXpEnueovCTuXRSXfPMqMjxq9le4We74avJg7nrh8fkY4r3" +
+ "uTybuqrI5WCNRuBiLUVuMAR02HDRwNFmhVQC0wOxtAjoECQdIAuc+ZfaLo6O0IVM" +
+ "EV4FEtlx4W2FCCd0Phvqkylm+T5VSzgZCqK7UNZc+X11LEfD369NnPNn684h236W" +
+ "bTiIcgobiiYguzQoGj4YxXj++cs4Tz0qdHkwXXYuqOxh4RlKlgXcTb+ZT58LL54/" +
+ "X5UkWd6UwSUtKWg8ezAgn3LlVGy99KvHea5jdcQUuTpOwzdqe2VOu9t12gz7+79S" +
+ "tp9hZGnb9KZ0+UWVGOfa8PL8MePzZ2jpXPc6c8Sz56UZnuR7VyqryWOdve7uxH+f" +
+ "7i9zTaJuakt23DIbPPKW3WvwvI5hyr5WOMzSpMgcRs3ZkcLrNrzmzOP/kkQSPs/c" +
+ "fx/623+62xX7H7t/15ZmW2yT/C26fxC/1B/Nm/4vHf4Y/W83vZdxnDDNatLLf4zJ" +
+ "2SOOSTXtmh6bgfkM/aUg/9rYz+ROs5f0f7Np83tXE0ON27ynOf4eduzHucnkr/bP" +
+ "/xPo+Tm1N30cm7RXZ2cox/U5Js3cZ8ctGrXWkfP6/AuC4YHo+wmtGj+jDpRjOnhC" +
+ "Rui6MS/oi+aX3Nt6cccYzh37RNxmjpw854P83H24dWtaabtnmK/F6q09XRzP6HOT" +
+ "UEd6oETQUHmXUt2toYLMjFiMiAgDhaE2Dii0fPTcNGH7p5jf0kPg3fXkttKDMGej" +
+ "3IKP2KJOlt/R+CT7PcY3AZxsoa+WREFD5vk4TdXR6uRq+MzKxSvDrq2ak+c2275m" +
+ "d5ettnJp+4/Y+HV6qxudXLdedt6uSdTKGaMJP6jNbZZww68/M8PzplDqYusu8ZQB" +
+ "AFQUJ8y9CB2DjMriYXiyEoiFRoNAmCWWSMuP4EvGSYUfk7ut8CD78n+j+iqqihWU" +
+ "fmZb8RVjX9LiIokXhgfqc+hjbZR8xHTSG2NvltyeEkBoz+i+EBqwZMS3bqJsEaIa" +
+ "GhUYwpTgGQIwCHFSPHf9PH5soVQwNtyu3LdB4H7h7qHvPtJPgw2vhhBmwPscrZ9i" +
+ "B0ofZ8/K22LZTR+R6NBmMbWj+o8N5NK4btPxmPo3Yvl53M08zTwps2Ux8n29W7or" +
+ "ecnOTH4LDyKfk9eenmurrptb6EDAylMSyCFoPt68A+P2W2rxpvgRO7eOTE06p78T" +
+ "pM095szdT5dJNkqV9yvdk2KjRq7ZNv2M/zD1uISNH5LRt2dPbXxwgg+aSTdJarr4" +
+ "+t4IO5+isaqdYSfl2IOJ0ntA756tsBY3I66SOBHlU+0+8bWUbHdtxa1P2y83z5Pv" +
+ "NqJ29h6ymz5tztPN04yw5+OsUx767u+t4Wb68vvztvPsCb27OnbrgHffegij8Dbt" +
+ "R+cpqFnrpoO2jCj+dtrCBfwtFtxfNrZd9ZcQzVPa9qbeq8duMYmVfF+2cTONb3u2" +
+ "m+N7LwZwK24TMUPA/s1xS2PJ211vg1JfBUXQLO2tMacGtLJmttPE59YWnForCNrr" +
+ "vbv4+/xy7+NG7BfXbnqKVTuo0DMuFW6c/DBvb4i5+crr56qLSmCHWi131w0DRNem" +
+ "G8J8mWF6/BavOE5YJruAqh/e19oRd79a8j2xXHhVteYnEW9a1AvE2WHFHnr7Wf43" +
+ "p9q/GjSGtZb51XBDR5fZe/afXwzt1jTi0aTqd5pQ9xPS9+tflc68V3+R30RS3anM" +
+ "Z7/OYoK83au2vY962u/PmnmvWmcymeWxxPne1H49bc+va/KVHaqJxTgrqcN7zDZ2" +
+ "TweudXvavlknvqpsg6zC6+IavvB2enbrx754TjNRir97rpG62S7VPnth+nn9KvmF" +
+ "thTinXkTrfbYcr54eVPbFQRF11vTW9+CcB+4r3XRpMtsKWHnhn3dFDF7PYpQoLeU" +
+ "zh639UyDF5ouhQerfW+FKROlO2lJwm+UDcwvkjwQ51nx2aQ+iINt/lkDDTrmb2vr" +
+ "xryHii648Xu/tF6QHbUcIFxgYRp4+V7eaLG64b2su+ONNxKEDlYjMR1Fuhvauj8z" +
+ "eus/aeYa2iB/Va1tuuH2zjOvxxxonwsbYInfrnTPNs504yedSRkJR0jeaBvNr5mG" +
+ "nFr5TFHNub0FVE3034E+q7tfF5n54uuT4o+28bYpzjhtI6mfB4jbVMEd31VAR4vi" +
+ "GN8Tu4umaeq9qLGLNUsvpQu/8faJd34UW2pXhjvaq0NFmKDNZ7UjVrNM4aXvd5pS" +
+ "g7LW/5p7955Vtvf6tsMfFl9rs3VvkKnfvemaXnFPGd4je+Y3iU3nXv37xz8/Ot5b" +
+ "nc6a2J+dPSXnLYpvqfBk7ZifA8RiUeNNauSKONwZWKpMDsKhPt+f5X25+dAjco/6" +
+ "X52E/Ys3128FfCeI+sV1Ngs+8/j7+sqrWwKe/0ydfK2xlW+++7Sx8Nr09NQEOaq5" +
+ "Z21TVe+3euawND9LPk1eaTWOD2M1bXSfq32fH5WrqCSRodPHmm85a3Gq8/ldR8zn" +
+ "NtO6s/E5oRyyZ1pX09q7BTxk/n5j1O8Yr8nSj+qezJTO/bzuIo9vLwYbxnRYVVut" +
+ "OL7dQJYPFNnRyNDLjWmONtQBd1AxDZA39o0QEps8eiBrSOQO+M2yN/b3A0Mr9bVG" +
+ "5A42A3LcI0uBvqcxzal1tziFTfaXakSnUaaNpTxpS+3avWO1hvyyUtPUe+uu45yi" +
+ "4aeNNM2GnS0nrucvjF/OGhoOnW1aB+Lxnmzq3GyztaXeuQpomp1FUXt7Rffavj8e" +
+ "Jxqux8eyex3ftOU4rXxtxMYwPRqwXX3Rcbx8dn9s3YtPa1XrnZx3dqikI3E1b3fP" +
+ "b83aGWPme0CcoGvA1o2PWLs1K+ceH4fTFuVHzrGWGpHci+dabeFi0V6m3aE68H73" +
+ "Zw10nviGOyJI6DzqzFDysrN7Vt3elS/jFreqKx+UpRu/mfHbO2Jz7663zp9WvTov" +
+ "vvvi14Hr7KrTbRduDN4R+UTmqrtsy2L5ZVHyb3Y6t0R06bVXuuJsOJpv5TdGqPBn" +
+ "vjuRp2u8z2WyNdKcny5v9uOfk2vv7aaeetW8z7wtz15nB6WenehxSnftgbkj3tWd" +
+ "Mah+7rRbrONx6m49l1arhpoQIQzabRKaTwFVPoKPOmlsaT9tWeFUp8/XrDuFrtXT" +
+ "1Ap74Ub+kFY8KMkmQ4I7OOw17bYmTediZ0ZtqXZakoO7cey6d0rpPrCrpmfgHM/b" +
+ "a7hjUcJ7c3OM2GCCHLLJ9KNHOb1c199tbZc8EKX0o9vETvYazOKX1tnTN9u/0fij" +
+ "7WpVRTrmmb7c73x2zlpOsWq3PBNjMryyVim+k6qIHV8cZzrm1NNNtGG3WiU222+q" +
+ "WvilXLVPDTtuujYqnq92HkjtPrnhn8wfFVRtPKbMlam+ja2nZNWzVGx40FOJoI1m" +
+ "jzX8RMGuvpd/eu+lF81TFb00pDIz9nRKTd6RSnvt2s+s7+qqt/jhaRHwyffKQ/z0" +
+ "/tG3K+dUXivrmu3jC03fjSsNvPfd9sob+3xr8iPBlBljpK63v6fnbHtxKpDNFNx4" +
+ "fWXi+m1XLycVHAWwI7iooCKfX4XX8vjqgNOk/E9udJqie7fMu3gr4Snj7XtqUiPX" +
+ "k/dmGsfHvAp85erxqS/xs1bwlgkOcUNz9VxavzsJ6RvKmczE3Qfa3x8N7dfP19fV" +
+ "5zBafd0+t4Gv1r9dSf3T6+afWJ0nyP0YagjzqAokAsvA5HMvICycScGRH5DZSUA+" +
+ "4yHCgQfxOdfUK0SiI3A5uCNvta9mxHytvJydnbe2vh3ekY7Rp0aKfJeTkcPDZ8Nm" +
+ "PB3NTaen67W1s5nLDjLOzJpdra8zzbuJp5Pt6W7cnZU5vM2/Y6dMPz9e5Tcsdwed" +
+ "g3dJ1jb2DdpxJIz0Z0kNPqBsn92/s4FF+N/glGnYgij0wPhQuH0EH5P7jwhh/JyC" +
+ "zw+Z3IMdOXTp3K3ZOHCvyezHJs5atrTSjQcMZLMtxWHd4dXKNgxw4aZq3nzb+1vu" +
+ "cjpvN/b6mqqpFQxWMPRn6H4LFK8ID7PD0s4SMs9KL0KMPT9CxUqLPxoSUfQf0KPy" +
+ "Lhh9D1vz6H9jW/B0emjPs4eCR1R8HP7MbkZSDnGyW2fQzpoFHCz0g/k0/c8XzYzM" +
+ "Xg5v2dmmnecnavJvG6+L5VVNPmrir5NP/86vZ5HJ8Nnbq3mj04tjyV4Y9nm2eh0f" +
+ "qafNu7Pns6K05Gnm+zfa1ps3fD43tuO76Gt3pHDu2Z4fN0c3eclcM5W46KqvgrfL" +
+ "ZZ8Ozk5zj2t+GJ1OZux01LfBLof2MVLIb+iTTw/Qko8MWFEI2oiP1WGGjYyKLrbb" +
+ "fh6PuDD7yk3srttD0dPqECggsURwgcKHFYVt9Z+a1C4nm6Upa9L3uLtW7mx0YcK4" +
+ "Kx0dfZa/Ltw8n9hXZ89reu1qDcLLcHUQNwHtoWoGtuURwwrIGERCPzCr0EbZJDNy" +
+ "QYwp37N0hT9ZQ2foLh0PmQ4bKfLwekfRti0fBA/YfU4d3PrbbDZ6xtdCy8gjwLiJ" +
+ "ERJhI2+1B1WIF0FdF1DCwjKkl0UI4z0M6fVMf6venWbllsbtgcPvILqxNlq6efK2" +
+ "Sq6vRw6K51ebu01V9Z5ui4IUOJjUBhQUeqIhoDPBJAf0TLYPoToLip4WdGkzxt/Z" +
+ "762yzA4Qhhh4oHIv3KIDT5KmZlTKwtaWOeREM8623/B6elo8Q1JxiWAgQncQECgM" +
+ "LAiWAQRUxWNHd3dxdjkaybr2VslNjq7NlVT2j4cJ2ejho/Rk05YtfCzu1xat+Hdu" +
+ "91cvNxDspIbRFIVURFCyHQYewlUKLjAgdUHOqqFXQdDAGooOZKIyENwSUKq4sEFR" +
+ "yNRMUadp0PLpEZlE3GfqYaDKGQcHDf7nD8kmHDRh4fwWWYffjxw24caYWfk0mkeN" +
+ "D4SFGhHiVFbu2EkgtHFezxIqaWnaEdzJFsqSNEFKpZXphid250aNmnZo7ZMVlx7m" +
+ "zFVXDo03KvK3TTdqZZZ0j34LqeGyvh6K8ns4bdrequzHYrNt5jMmO7tq3Hk9GTU6" +
+ "GMOGnzTTgbO08zq5PJjdy74zObhx6M8nJu5Vc+Lbm9uVj1ezk3q17t3D0exwYMKB" +
+ "pTOURDWRGaXREECYuJhxzxhETUu8mXv9Vjp48d1lC0/f0WGgxkH1HjiPyUUeFBGO" +
+ "am8bm7o07t3Vu5lah4OzS3020qqBK4ICgQPb8h8fj69n+3hleET5+1Kk1maNSlav" +
+ "R9c8+++/Pnenwej1erxtb6HV2SCSSdrJHVYHikZUg1ZVkDtUEypDVQZTN8kDSwll" +
+ "keMwS78akNOMiJQQc3dihLlKj+oCG7aEM7oG4kZW1NVLsxIVjJxmQMVBiUTaWsgY" +
+ "DYxiQYyPuBXhdUKWrZb79D15ra7uMfLW1eW8dXOaiNhdxQslkuUzMFKgagC1Ehom" +
+ "iOOZC4AyO5qNxXMVogEhIpqSNRe4grNtR7emHctEhpNtsXLSm9xOTBmOSDYeNILY" +
+ "2DG2ibk3hUFnKtvTMXYBFsiI1xxoHjiBJg0ZhC2Vig602I1PKTNWvbUbYm/JAG0U" +
+ "aUsNNFafJHs1SpG5rY8UsGwe7VRhp+PJFmpjr15ahtvTFpqhuKWCg24WKj7kpybZ" +
+ "c6V5CsG96jMayx1GWUOgDVCIZKqhixI3lLuejpuwX0E8/UR6+vsvzdYqEqnmqYPr" +
+ "ynyiMGXW2W+XV42wNasYmujHR/B20ne7B8uftj52a23ykGf0r2Fya3xEEDcibiTQ" +
+ "0lZLgyC2ePfZkNiK8bqa+t/uN5kVHlxN3dckC7FJia9ve/Uugg2wm6UBkqXOGuys" +
+ "qBJmITKhYQIImk5o5EECZQKpHrRxXGOTi2LXQmqWh6LhdyTi01SqSQ3VOEDXmHyx" +
+ "eGS7oe6mzQZ5CDD00rOtqeKJjKBw+ee+cWoiUVDVLJ/FhK0iGh1VeKiES0TeYm9Y" +
+ "aEWwQmDQoQiRwvF1pOMzCkqwS5CmptDqzik403jShJgqi2UaBbWZmCIlgrKzuoHE" +
+ "I80UvVUMTR9bJIWy6iiIAxXukg2P4TDx8uds7uzmTTj2cu9+82j892bLO1fYjuV1" +
+ "nOX+0ET1+9s/q59/SSQJI/0pffnnpk32yWNNLZIyLEInER1S3+6lv+L1te04VnqI" +
+ "JI1eRIDos0ygqI/u84V/ySnvUfr5/o6avXhuP26/+dG413/yfDY/hOza/3m6353D" +
+ "FQf4gPLyckmNf0/Z+79v75+CaSQkY8In6aqSH03WX6Z0X9VQB/vFWq6C5csRuvBZ" +
+ "nX9ytV12MkIm7FR+DLJ9H6IBOuiLogQGQ/eRgyJJAx+aYLFFoFE+nXZEmdeEk51K" +
+ "K8zR4ejlk1Rjyd9OlGOU1IHRC4Twt1lj8fuDSl+toyn7KlPBdN9GfhbdlfyOpi2j" +
+ "7n1z3jf4hxzT5xvpenii/OQ9atPRJOV8YpWSsyBkCMSKpoqNVJ4qi6kbGS0oTp5U" +
+ "Ze+1/H5LYmU6Uu362dTHpJsyInEO5DvTRhC0noXDbUrY0aAqh/N252CZJLYxRLww" +
+ "eDIgJvhTpSsrEJ4SVDvd9S6BwlgfShNMd9KmGrWk3I52ZEqkIKJiiDZgpwVrTuGm" +
+ "0Uo/ZLXM3bFdFTPSQCOxHSpDGrWnDhd5Y05Lm5qtLILG02ERoixRXRkaboZjM9Fm" +
+ "XShtFC7OcoJwLVrbJ2vpmlco5wxxJm17X2pWtUowXbS88ViaVfl1mbDdKMZhHFFV" +
+ "CHEiCc2ed3C08Xm0T2nd6Uv1K0yITQlBsslUGWxQP4OXJVEfYPWUXA+kdcuh/+HP" +
+ "wWUH7diyuFPB1lyF6ZrDIprJE4SEZ7msK+k6P1h5hh3qskj4roZNzZTZjCbg2ePa" +
+ "UWtQoyUuGzm+j26e5Sjd6d8bPnh8J/3oPU17aMyljAcLyiBhr8j7ZOg/Q3IF/0Ta" +
+ "f6XwNY0RdbAzegLT47336Ne7qtUughSk2m77D7Kk/viknCAADCufnfnmfRa+PuZ8" +
+ "GbDsi+jRFrzw3ixPHSw07DIXufXiw4eHq9LyQfWZnFx+S0TQXRM1QT6QbNSZJj8m" +
+ "7UMbjp4V/ZPnp3lbJ4dvxkSfH+zJaG1+r41D+t7jCD0giVFEsaiSGe8yzuQcIPsg" +
+ "7JTIOFnT68Mlm/XtHO4/DVboellFEFwpf9tkkmQRHs6yXoRCkuKPxU4Z4SueGdIi" +
+ "CB3cE9RKuhrCdlwcyTChsiIXrJwrTvs9M61zkDIsOaTPnYckuRlvrVGxZx0zpzzt" +
+ "8L7s4WtdLbRACW2FaHvN2uU7i5n0qt00Kgy9iK7Jba3/3pNiLNMrM1XhIIBPZHET" +
+ "RypdGC5pZhk1rtje4i3zM6TWPeYQEE2ICad2RgNnBwoZOXY1T9NwigxKQAH9P9Hz" +
+ "7gx+I7Cg/gWYSkB3Ml8YRVoO+7qZcd04606nOv7+wkB9/5D9dwJKJD9w/pOUxtmf" +
+ "p+39YZxm/5BaSsnQxtYbRsXraiFwqdRNWIdK5L46DjXUSMMKSKJGX16puhl1MLFs" +
+ "NjnoaUBMXnCJ+Kus2EV8F1F0KGG54HeshTQt8laFCKcUvV0VSQaPOy1KydMvj2Ez" +
+ "AewDB4P7DzDchscafa/a6vq62dZRm3G2jIrBxhr3MevBrYhskfQQhIEa0BTQhzBU" +
+ "xFWQUuAIPIiFQc+2IfQGI/BwLEPA90bT/w9O6Hlgj+ABZZYIk4UKMgIv5BFETg9o" +
+ "QqCd/YV/CKsIEgWiK+Iqgr+QaKBHSWPIIpYAYOlqJTAzWgXcJAWQkSQfBkVzkTkt" +
+ "EBuCK4412dduYOlRLbTkd6BOG9mJ3lkOMIivftOjRKpUQ1n8N8AXRv85sESi9I3B" +
+ "wqNAL+SbEH87kA4Q0iLxfAXQzIiiJA+Dio0PfHBFET4KwoGEuhuF0X0+Od6iPDZB" +
+ "vqe2ZbNmwwwQNnblG4ZREfEADnQldENc+vyD2hPFPDVaTmO6ErcB2CSrJHawjBeT" +
+ "Lu1HHXecOXpfFifajXzf803to/li3IQraCMnXE7aNaF+UhNCJJ6bST1yCMSEkvrk" +
+ "EZsiJnq9YnIRyfoE3qs1+5g4qCjgAB/d3LXII3r+NecgG/A/EBhNc2cEhOijxJO0" +
+ "FJewHGBzK1YnNiLkAPBkUztU2GMpL0j31B6VEaAuiEtObw0ViA2Qo2CQrPgdgapv" +
+ "FCGKU5zwAX48rSmSGfCh0sBAp5Vw+mHYBmgyfBvQ2gE9Qiw2eCK950Urem/KrOD7" +
+ "tAApA2iLxtGRmFUGVZgNFMIQi7APICVtlUdVP5fqGLX9TEJBSYcWuJiEgyD+whr8" +
+ "Qt4j0BCvhFy3AUJAHpE2ATCfY/XP0YM68EHwJaHTWChL8gPdCT9IoJW04ShPtj4h" +
+ "rXUO1N+9eNBzh958PwJ3onum3eftLwTIIDagDw+o2Baej5qT77qlol7lfPlQODAr" +
+ "7Qiue8ErGKQIVtOQ+yuebQ9jz0QHR0XSF1f1oB0wm+nhBsV5Dgxx5TjC7ifRJgWQ" +
+ "JQKDKZ5QcF8aA+2FRB9siyFbQEtXEFsiyD1KeYp4vn1kdk65sBN3fx5t3nO/Y59A" +
+ "R189AT77u6pOAXgcINOFPg0rAnT4ODvDpDvB+Q6AjhNjrJ2a9VBRzOAGZ6eDgd4b" +
+ "NoM0UeBxPD5FreuGt6Dwo9RFdb8nAiAa2R1p49xif5Sm4cGGg5x+6ZreF2MUxiIK" +
+ "+gryR/PfnDI6Q9Gn57KlMJ5766E3pkiWtHqD0EedIKlAC3QaBfbl/j82SCLdu7yW" +
+ "v6Hmk/T9Y/qXglgiQ/aIREU3sfkhFsOhToBSbFaUQBrYeBo78wWrCIiT9D1wcVo4" +
+ "GjuBz3joxqZU7bQDFwmjB5e74MBLoK0PA4QkclbwijNF7qEEoFkFRROi0IZfN0sI" +
+ "zwihRtDz4T7ibJnxZdmKq4qOeIUAbh8KmERXb9nKQ+5QdzgDPcJjvxw6bZ3TBIWY" +
+ "SSeN4U3EZkhKxct8oIiTDi7lqOt3Kvi/tFCQEsImhN98ZBnWjLEBK6dw+FxgB1I+" +
+ "dDUAkMR8mm+NWReOPvBhDZjk4boMpjxoBGF5Lqkt7tL3kyTUNCK+PoZx3oUqB7h4" +
+ "5wEXO/lduTg4NfIqAh8ZfJSAcG/jGkuHA8qr7Ro13OwIJLia9u+yBZ0dicUAxwCA" +
+ "kEDreMjHsNGLghIQjFyrYc98oQaGSKediKrHfuebY7DkhSaKvv+X/oH7Ij+oKSLw" +
+ "2kgfoPv0+vpfWeMjRqQk6L7QtAATi0oNZJzgYxP1w4HgU8+oYPhFESAjAyvt302e" +
+ "CDaAWgGAh7Xub6oUY6dMeNnQh4yl+Nm1AA19panR4CYHnOGiidVdfdsdGvhv6Zx0" +
+ "jjJBqQawcqukBR4Ux34pXobqCIL3lHdgOad5nLqYjUZgE4QvtAltbhvPRFES+goc" +
+ "QfyAkiF/e4WiKYNUIFjKWJZA5fwJczRRibFGT6zCHofhgW8eydxvZ1UFHu97Toow" +
+ "8FguNJpiKoCc0GQAn4ceHt3K0i1feYVcihrJaNBCZJgh3FO6ENqkEW9eLD7vi6wf" +
+ "fT7OU2J7Zn4VPfXdnohaADg6HCzQSKlLKttUpsb9HGGYyM1kdbG3LRyKBaAlAEQi" +
+ "6K3SwEpXNuY3BAQX+wSMOhQK6JuJ9BbiQxBRmAuim0FUeeYULAUKioFQBh8aR3Mo" +
+ "71V1gxByA7oX2gGDQe8klFNQQNSjx5kWPD8XwbJrOHhrmPG1eVz2hyCeCzw70QRm" +
+ "PBaXfmHpq4d6Cj30CwL4FmzRhVE1Z3PXGd4oUT3RT2fXIk3Tn6hAxuw6R4ZKzAfB" +
+ "E2O4JIhAk0YDAlY3e4AHkEgAr74ycQwAnQW7rtlcpF6JZA7VNu66JrCcgjUCEFCE" +
+ "RpghIiGj2TWA7EMd0aiCjpcIQOLL43hkAKrIRD57bdINOGQ01LwiQc32iwDYCMaA" +
+ "kHwImA5vu3GtiupPVup02YPe4G+iICJJzomO2gryY5W3M5zx7DfU8YCDsEXiG6zV" +
+ "+xuOJIG8KOYoQjJHHsGD13J0uAvNmGVfCbv+KJrzyu7cZk07DszWZjii34Z5Oq4J" +
+ "YoGxovONSVdyqdDaiI5o1E9gZEO+MOknbKrd3vCGjWOSCrnI7Ux2qgrF1ozkJ12i" +
+ "qiB+Qq2iQl6eKyIKevnnG4vy6vIfKJt1EpCX9n+P6PQpAeBRKJQ1sOYCWlkXAgV6" +
+ "zM7YJl8sa21D2vb7geeO2SpmkzN+KTwlzt0iohA2AcDPLw1FWDBUJvFW9ggVk6Dx" +
+ "nW8ShTWwRlT1sHHJyMsXFDhNL6q7kI6WJJzpELbUQNVIhmsRVy0ajWqqiK9NrXLa" +
+ "rEhagikVJEOvbHSFh2axoim1j1bJkioWVpJnTIwotJdInhXvflf6SU/PPQX0bTPh" +
+ "CdsP29ywEL0SWUfTCD7EJL6ETkKMZq+XfvOV9/V1w3yP6vw8Bs00Num+z8M7mbcc" +
+ "Nyaf49zDIxUaQ2EvqlaeEBsxpWMXnJV3xw2Tk85CvjXKxcvj69eMUfMr8bW8bRbU" +
+ "onKyW5YZYTLbI2sO+23t750Nk8klcxbgYLeIcQe/QCQJFkWj+oMfqaThzaIrMI2P" +
+ "7OfFp/TvReP9gGjSGXxEeEVFAmDkEvv9VUZSkBPbMF8w/60D9GpeH1QCFw55QkLu" +
+ "z9IAXDqKnNMEC9ziBCmelf4wfDqr8bOBhgIc0RJII4qPuV5Nz9AAJ6ARU+oPi6hT" +
+ "+q8gwvYgoidW+M0fbI8rtLFtXO8iTUFlJvXeyFxmJtnkC7zuiaT8nGztzQSqBLOU" +
+ "ovW3gp+vzfBxm7PhlVblQM2bd+/Rh4dPRBvEDSXngueiAwyDAY7g52aB58+eG+XC" +
+ "rEW8lGS1QUeWOAT3cakjvwRHNevLrWRGxOBmTNeUHz5BNT4o+AkxZAgM8CgQuYt7" +
+ "U5ikqOco13h+zN5A3dAfUbWApJdeQtkMkEkG1iAUlofiG95daxu0Xul4UwF56lZ8" +
+ "3m8LyQBioWOMnxAZw8H19FHnTZSfCQ8UKukI6IKbgi2EROEVBFDkVQRmNCWiK5gK" +
+ "gjqIqofRAygkWCEQQOEBE3AUBUywFE+iCoPxHKo4qQYSR0uWSDgsC3LBC2FUgIbA" +
+ "gEIgr0IFBFEV2beEGgOV2VCEkasTeUI35YWoqjQQJBJsaVFsgnIIYIegAZiYinAC" +
+ "KCHIB8L9aSU2jqpgHDRm0jioEdaHayC8iYiN6RSgqyRLYbpYJZUhzsQdYEVBA3EU" +
+ "HoIwQQ3BFaiKBRPagNKp4YAbiYCICDIIOliTxeOOGnL2EcaOMNDMGJjKNGgchDj/" +
+ "BKwYSZqRlgLQR7nzcAWpLACURHNK7oqAsUjajiiYMTUESEVX6ICF+TFgwSIL3tKF" +
+ "+9aliQFdBBB/IK0AryCL37njuaj74l8yZNHN1lSjgfcTgmPsJRZVGcrSr8IEjldQ" +
+ "KtmKapHX0QlsIki0IuSRcABgN0Gs+4HbDqPIFBxJiVh3OSukGiQvd5nogLDQRteh" +
+ "2MyW2SI9oRhikH4T0jXdxNxJF2Xnskl3AVffHjA67x2y8y73Yo5mAE1DhsMmXJEc" +
+ "XQigaZcogCwOAJSmvkK59/AZt5r6CHoKYtZF6XRWBxO/0HFiG/lmwBS0IXvAvwXw" +
+ "uNK56cJCuiEUIhAnVsVC0oQ/LDomFtpZXfIu324pRnto5FdNUA7OBqemCvdxU76w" +
+ "rnterFGPG+6Q45tXnD6WRacT+nbNIk1JCPpi9vz6KPo0aWTYVCFR78pPNQgpwlQo" +
+ "7nZl96ldo0qhd6oAriD7PYX3YjYi6+KtyURx0Dh5o389ggNbU0B+KOiBJNO/YO34" +
+ "6a7wfKK5PBjVqgozX5yrvYe4b+g/eQESyAJYADkx6QeCQZ6hHDToVxoz61c19ymI" +
+ "QUB4ySSEGSTHhMs0Tr7Of7v5ZHrYzWRqmxy/D2PVnfrHr7nmk6vMiLt6Pfbbft76" +
+ "NqFfrnncwD0EdL8qWqmCRcAGdrsAgwQV6XyemW3csQRzF17hRM8sNaA5u41TovvJ" +
+ "lL6Jmj0Qdj3rXVUPYlIJEIbMcN6Qo+y6+Gy6V0pk2Gw6o2eXyfFnBOzAXCDYADzR" +
+ "CSnRaQYZ+hwQZ0h7sXXIQK0DQwbFchiJ7Akq/buuqEJT+FvwSPhCs1JX34emWkc1" +
+ "+0JlH7mgV6fdrze3n1BaU/HP0Ip6Az60FlmH0F+FDieRNSpsh3JnZieg899kMapx" +
+ "A2AgedvbfYhjt7fwdfgTf5O/lUCeRAZEpJHwvsvi+d3wMBEna+Z6+GGGgCoek/BW" +
+ "dQo/JYryYiLihedIULrmV2fAYIU15yOAfqwHuI8EwYI7aM8kO0X6aYygiiUvGaA5" +
+ "AqKrb3bLK3Bu/ws6awNQMldRV/OihvSGeGuLuQ5zhdKQyvBbunGHiqbSVBLCBBR3" +
+ "sJmkCunDAXHHd4eQxhEGRYdBzZu7UXXMiBb3M0jRVaMN1xw04qyJ8G6DCyAXnHwZ" +
+ "RDcJFX32jyXoosS3eitAOfuZFfqdLyQBCCB3aIfY2OMhjfbVA5gUvI4NI0ulOm0b" +
+ "1FDfrFHR10hZU+ODKMCViSStxuklLxyrOzBrvpkTD7nncH/YWN/xZ/cWB4MEWMjo" +
+ "uNq+pDjINyCJIMft7GzDNPmQMmfKO8C3BCupq3ah8aC+3PLydaANlYxbybhnNhxC" +
+ "RTyS5wfe8lJ5C60b3pGVdQBEF12XTIjMtk1B3sJLjW843JTV6tmmB3szzW8PCNWR" +
+ "3yd28o27CnITe6LTd1rriEPv+r+W/Lr2jtO7uzN3c4O+Tfc02jcUkrJR8QctADA0" +
+ "gXSiA676RwOkRHURdCHLXIqelq5LOSTVlo0mrcKsbgjhEjApzpaorkBLDgWikaMD" +
+ "WBmkEQLF3ZzJGd55Vbo6iJbSXTzOm0HEagBiaN6SrGSjgMe8kJ1BRvIDKb2rTVuv" +
+ "UjayCQnFgki2WkEJGRQCMRewEqK/x1GDBcgGSKNrCGtI59lyNKkdOrQ0UCJT/tYC" +
+ "QsXuKTErgmB/L7qWQAgjObGxtYRpoNAhObSe0Yb86I/8koc5eNsi+mHWzWtVmg20" +
+ "+QHoAlFmGJHkyHlQ13uGhptHj5jDJQi8LDIbkOBvKk72hX8sJ7ueW16GHGq4y9iI" +
+ "j3yMYtSIbDhrWwlmqZXVJRCqouUAUhKKoGCwqjpq43WTfM2qub+jk2T4GKHeyOVj" +
+ "tYdlk++2vs+/+x5NvlJOLPYmGRLWSHhDrPt8vLxjo69Xl+W2ESbJz6o+epO91qFW" +
+ "HfEcnfU/36UAcqgbZ7xi7DdKjmP6OdAd8+vBt/QtBnxhQ5Y55yjps21VoCjTyYLL" +
+ "1CSAQTQgB7K2FHCvBzdvNMXNbRQpcZKHabwUfuGc374PhwMYpCQXoDnJZi+6wEgi" +
+ "AiX71dMRdTfvYRIwt14Tk5HPrJ9sRIYwCUOkZlDd4TvtfPdgHxB1w21pzT08CJyh" +
+ "7Xc8oYd9ZaSpdBvqDRYUDhA4KO7b0HDw6Hwa7XttFLJvwUIDpRXAcDIRWHS+aUSz" +
+ "xocp5qowJUFyIVcKHx7WHevE5XHZxO+4peTzkklyu0YuiXbLEIJQUcsg9pabkI/h" +
+ "od3gISwZ4fwv1Xzc/OeFHgwtN7OIIX02fD0/FYKloiIWHTB7PYJwBsz1ERDlrZJE" +
+ "YDEhYassKO0HhjnoW2l4pHuKoFBPAi0IHcnEsMNIUlBMw4wqCkAz69wRdbCpCqYV" +
+ "IiZOnuCR9k4a5ZjWNKYUSxiFzpNQQUVwU0iIm9GbESmCr3RFQr1Uigjc4jisu4pJ" +
+ "puPoO5yOeZt1LgztDDSQtUkU+DXS9idDpAhOhoTBeU7AAikkj6CLUxCIImIIc+BM" +
+ "GVzqBtTlqMISI1Sc4AgyKiD4gcWAivyJqEowpHETkhIOIUiJAsq4g6inSDsxKRWg" +
+ "Yt+3owIGgQI7FgKRip6JhDOMYUVRT0TqgKJELhtSrt5BLVIqtKhEQLggZJ4QhiQR" +
+ "Gq0Cqrhtk6wQnTdrZdiQdLJbBMJNwoI5yOuHOpAbHCioJ0J6YhibSGY1HllCJmB4" +
+ "jcrMaFD0ewXkW4ejjFIZTGKo4JHcpSBBPtd0Qxs1vmR1w4jyA/Q8IHSlHwHq+Ee/" +
+ "WKYiGSG4HC6NiRUCLF32CGopcnwE7g8WC7D27ysTrEzHoRC9BQyGYAhkqhOQBwpF" +
+ "wUlY3keYQrRXorRFPA+GhTj5pDpAE7BLgAlbrkDpk7XdBkMCe7aC56ythMcLyB5M" +
+ "qB1IiizVK6jgSzmXFAgGIgqwIgA6EtEewNxEDMEKsvoUzTnlKA5iDnmtY0XrFdi7" +
+ "oO1avSIz4+XbDYhpYNbXls12lualldWW6Rmvp3XiSn4tr7H2DBIdge2UHx5TmHNI" +
+ "B0iD6NlFC9gO0A7Si+DLWvYUsE7DYKO6BRETeHLcg6SAFuaZ2hO+UAetihqZiOFA" +
+ "GI9nCa1gvgaJXoNNThLNEDOVQpTOKJxUxb7ouRUN5KMOSuV3bdQuokVEdMKFDQPm" +
+ "AmkMhmx1/f2bHBC8ijYJk50C6E0XqgwMJ6K9wOKaAATyGEoaSjjPogj2CyAOQRZk" +
+ "JxFQViYRM0i+Ei8gAZiihW1WUkg7JgoKGBijbIMenRopoooFjRhdB5EbkD0B3K05" +
+ "69Q6zqcbkOM1FpwnoGyJMqYsuqUojv8cZ1sKM4tO5+rCm9ZZJCE6fbttA7APREM1" +
+ "9CSIPRp816UCN9JJBPsHGQVvYZdivqFy+EDnwVAwp4cGED2KJDVUXA7yrAlwDiMK" +
+ "5xTOPCYrIplcSlucCUpqSpZoxggu32wzjnF2FlIidoAllPOFbJzD2SICWniGwEiA" +
+ "3QNDcV1ngXIKepNW41sRWLhvPSg1vwFIhjFd0VnVLBR9WMhksUIIoiX6b6aI6gwm" +
+ "eWGTazqFhRbYz6BwdaC+k9L6lESGVK0KgKYufORB0fYYzTnBemj4BH2gEaHaaIrv" +
+ "fxwDWvTnqdY6WgKUpgSoZrcEXkiQwPFhy9jFIQUORTJpUAFrhENwKQV1OLa5FQdh" +
+ "FEEkFVhFQCQVCRUlRhtibMFYg7DmjWQ0vBThVntDVh0KBEg8z0VFZ1dnlwvOxCyV" +
+ "yFg6KORRzKtb9eVaU6PsPpQ6vqCxMQymmlu1MoOofNGJrbSJqCnCG0ZkU3SmgEqj" +
+ "ljqxILxoC0NXXqMYPKZsTNGgseiQX1Um+tDnWCzEFM5KYaQwiK2hebBFtFvWbIKl" +
+ "A0gySQIKEVUFY1qkKQisEBDEYcpVOMqLjVHCwFV4coAKcGYVaniPIi0IDFCEO6py" +
+ "iK3Sb5QtwUTkeVRqSZvgtiPRiC9YmOGphARNmQ6kLF5Mm9RN5UknKirNlCkLBMDw" +
+ "LZGwouEWmYel0VvPJk0f9vqDgB1OMRmKZKIzWahOGd6NWRFAnCIXEL6B0Uc2fl5P" +
+ "sIeQC1FobsyuXXTiCpCs4yTW8WkdGVi02BNTSDmtnKPWeq9Y4twF4gEpDgiKRGKA" +
+ "rATvQoMREzE7FMRAK9ixd+aTuQoIDMYQZSoQTcKEAaDgwLsSRHUTmeBlwAjqJW12" +
+ "haMGnPdB7Rko8t7UYLQRAzDoHldEqn4zfIlR+ahTFDj40bkEs7N9ubb1r5Pkz4P7" +
+ "KmacMbzsQ60kjr28eWZT5fOlM3PVqKOMRxDR3mUfp54ZLqzcSJorg+9hoxMGzVzk" +
+ "E32DW2JtbU2qrPLpN5Xpxamjzu8wb1lW8jakUx6dIsLnCxQwpEzLzYbSCTWTEZrw" +
+ "p0sG2G5EvMnZyhFFF5tTkG1AZohFJveaYcvskKd5SozIJ5nClUEHKNtLZSLNdA29" +
+ "uDYo7sXxjC44bazLkkiHu8qrYzJnnJ2oQ08SqTZVlzXJN05fOLkVt9y4SAdhsUds" +
+ "ETItUioA4xSCJRd2ihTicgxYcOnBhN2OXCLbNOTBhkqTgh2g0U4XAdMYmaJDRnHR" +
+ "R4Lu3sBvFYojVUFkFCHnDpF0yh0wkgezuLUwW6maOnVNAne9DRbH+AAHETar2+Ft" +
+ "41Wuaum2jm5bd3WKQkCQUMg9FB/ynAQTMVeIB8oh6CKP0EAQxoFOUgEEvm7+N6n5" +
+ "WSrmuWdsdiR+nu8pv3szvUcbeXbM8Y2rYHrC4l+zyLjDfmIMYVsENPkK9m6v+lyT" +
+ "5D1f3aEZuONmS117lX6NWkjPZo21sYFwu55fns3WZHrU9bIXYmXLdyesJJhtZsyP" +
+ "8XuYeY2qPLzk8i2eMXprLlTUee8pZwCQX5F0LaW8MCu2YWI+FoVCAHBD2BOl9jQc" +
+ "oGoiISmkexUTRuFCkqlW4ITOGyomsKYHBjZrY5wncn7k8ejM3ET0XYlJU8VglCrh" +
+ "D1mEVbUgnLS6ENcMUAAwOwooznxlE7lPuAKOBPjKFlnYC6ADqLSrEfFWgZgi07lQ" +
+ "JqzHsmsUg1ZBbG7lW9a5qOWxHURNRDgomOIhVc+e4RuBqAVWjExp9ZXgMJ2l+KEV" +
+ "vOwwHQfplT6irimoKktr1mTvMn1AI6Nj8IOjnF6dHXSm3bQx3SNAEqFigcKwa6F/" +
+ "BubLQ9vcq85KsS6AydGpaE6qtgkARpz1BKuNSoGBOgBQ5A1kBa73YHOdtULNUiHq" +
+ "pDygDESZngsBXWfdQdUGGBnhtbsFzJEXO68eFC4N2M3gCnwhLjo2sgkKuQ/2GLWH" +
+ "g0I67776B8O/3enHovnD5QgD5SX19KJhml4fQjZ7+0Q5JZrA6YidgWYyY4jl8xSV" +
+ "sK0myHtg0AKidGTG7nAv1K6y5UVikEpJJeVcrzdb0hpFKVRzLlSn17KMaMkjCTLM" +
+ "QQ0FPTr0SQkXhEVoyWhvoQ9yPsIB3yDPeHXPwPw9rkIoDOGz49jxbEtALl682Rhs" +
+ "0JwxZeyKgGTMoB+YAhZz8Qa9iOMdcWRB55QGYQwryLwiXDkQLgYR9ATDOHVU8lId" +
+ "eOvOCO8PhtQKPJPaSS5gH9u2h8QPjqFhzWX1iUDkBGGRdQFORGvidcljOQQDzVBl" +
+ "TGG2UR07istKQkPDezFCw0PURkJVk1fFtUDEY3CtDUhqIFYmbk+TNC9bRLgC1B2Q" +
+ "hmoGNNdEXHTlVNGEVIJL1zKJJcvOiDo0nuITwMO7aogoMQulp1Uzxq+a5SU07uZm" +
+ "vE1CJnZZ70OyN16aWcbe7CfhB0W5dv9C6SR3sHAFMHzkGZVhljT9BtpAZFGb0IBh" +
+ "iANn4yVtUWWNjZlODZOyQgvvs4J4XQtR3HQo1zIKaCGoA3MHDeDBQRyGSIusq+Iu" +
+ "UOnPeNgBZsMVdUK/MA7M74eXN+cCMybrgKkJpI2AViGsH9t9NE2mTXEAH2u1lnrn" +
+ "3EhxUTGqz2uqtiqAhUVEQ7IFAI05ncwTfKHWxRzwOqtWiKznM7zWPbVzw4j5iIaD" +
+ "SHW84UBRM2Z3vmt3R7bnF9KAsRXK5MOIWdxy1IhO4yIpyYRjiTl6klPndDcCERED" +
+ "fIAlT9GeQO/FHYQ4IvbAcQGRxYyPYeZewWBoEX3dzOxpl0F2A6Xk4RptVObwVYvR" +
+ "JgUdJSoUBw0WAB93YAWGu4uiaiu2D0oQ6CQqYz2svjWxM5GLngT4hPu9PIny6IsR" +
+ "ZwrtKctQEYHDXdoRqg5oQ2uSsX4bCJ3NGGNxFpY9K9jfyTMPt60P9tHlUE941bvY" +
+ "0CWQSCsNUdyq41StOyY05v6ryYNfhWLruNAJjmG6yfUmfUshkQw5BAYqlskE4XZZ" +
+ "0rCcTJIRvQcxBsbodFNqdCpMhmSYhrWBxkg7XIf371jehCbUwexm4dGgVDsU5gmy" +
+ "ARYrMvjRHnRAjrEi0GYc5Y6OiwRdCNAUhDcJxjcBNIBhrUp2G6ndXbO7n1V1kivl" +
+ "8XxGjFDj0HsLjFztVYhL2gQARiRjzTgeTHDnuVV3Z6EWdEVx3o6ECjQ5rCJk6KO7" +
+ "JyyngW7FaBI8Q0m90Hkz6/HSOXw7wPcGEkM3MXsytQGxEqIOeR5s569+9oW4M1qt" +
+ "CS6KKEewSrVVQ9Z2x1nmgZsV5A2G0sh3RXUp64xy5NrrMXvw/jH9rrG9Vbajixah" +
+ "aXPO4PyEx5aentlmgg3UzPNcyQmn8jm7WpaxrIJeGcWmiyb2JVHMgUcgNYWQZ8qR" +
+ "l9nHMTRw3MikGYWca2t3QhhaYddzCOLk1SxmG3vec1U7jhzaLKrbNpl7cveuJ4GT" +
+ "VKmHNOGIKDJJCa1hZpVTd9ddzdqXynyK3LQF/1fvHvFwDEEAgG7s21nIU4+UAFqO" +
+ "BOzZXxvafGAJlsTLa0vUiRYNbsqb6jMCVwky24SylLvbtzhy4U047dzRIGiqxGqI" +
+ "kIjQID2qNEqudsyoALL7RxclL04W5tQJ5QDpK7RHXccMSIKzBREj6ROmSpdaVrt4" +
+ "adqfw1EQX0QzEHsCa660tktLxhOLIkn2OyUnq6l1++dxH9/n3L2c8+25+V4ffTlL" +
+ "WbIZ6mIoWFkymTGcEwjhh9wUdmPPecx/I04eIAX8Pfv3s8Jw7Rz+F57P356BfL1E" +
+ "2R485lDJBs/Jx45HbNb+1znkLrlQVg2n3Z3ePSJuR7bhMxd8mt5Ml7Cna2v47Av2" +
+ "ShobDchLus/dr8YRijOCfI/aoS1CEk62/SwaX0d+zqSS4TLcKBNHf3WDoO6NgvqD" +
+ "AcAR82hL32rdu4FRZaPc4BSzInYiK90PsiBLMdwBZzGeZDD4g5u3gUBylQUbarAR" +
+ "BUBIVnQqbgplEWh9veEZod7p4BlUkk5VEijGEoh0dAiX2FHNFOZcC5CaW4XLEDTI" +
+ "SgogmLJAKIqAY78+xmDgxem8eRwYA+e+7Gs7BLa59uFG8ZoVeVgy9USRkUkhykQ2" +
+ "gdhQBuNLAzEGQWz6uWiSqgkgPFhL1X2+0eYLcIcj3iZyxIJ5vmkDHss1UAY9Kwmu" +
+ "cUvi7vEKuyu0GwhCTA/yoyJyKgfHT7x1mgrpxkN4KkOQXU5C2Mg4GpNJatXYSKiD" +
+ "qMyBxJCb3pESGxB3ecBzpYGNW/OquelOkMMQhLMNvp2CszyQXClDLJFNasPABkrG" +
+ "Mqh3NC4P2iBrGm2BOkclnvhVhaRISz3tcWC4e3pxcma792AaxCl7oESlxfjoIKJ7" +
+ "a2FiDuAweHtnbwXS5c7GQzEPRFNwEFkCQFcwLhdUKEAz2x8RGVU4dMOHfKVIFIhm" +
+ "2iWtGuVMhENpjLWFciSZlotHBr+3aNL0JXa8XgqPAEd6EVpKnkMUG11O6XJWr5Yd" +
+ "e1Z9xlu5eR7mJ0wHvDupi0w9qHg0QgciAVh2IX6IXeOlrntOQTFZdBawzrREld3j" +
+ "PlFqXVGJkUYTNlohLiPDOszjjML0boQtWicWm1LQfEJgpwVZEwVAf1rpwKDiWeW2" +
+ "T44FofGx9X7FflnTv57B7RWfe+Ko/xh7BrfbW16MdhYNV5PvlOkBqBZnJhkCwWXb" +
+ "ALoENInGVVyEpJHrMH1FM5yhFxZi6xvmHQaSOdy8vvLlDQ0cip0Q10A0glmjphjg" +
+ "AtXhh5sC2DuE7wOi1ogHvNgoaKThOzB1lxriiGCeshTQvqL89HPQ+io6J1Omxss5" +
+ "Zv6kfi67wFWe2dNZFCyzJZwresuVNd9sV2RTnE5N7GjnjtGhDOLCGejhEM4VqEAY" +
+ "I4iKBkRFL4BZuzJlfc28UAYvBA0puE6ZecsRdO8V2w3M1t4YGKaBMQ9gzlCEQ22W" +
+ "BSqbwKaRdjkQHC4ixmWzxGIaJQxyRAxHr6FlXRHCtOM7Ur2KSG17m5xIKQuaUIjp" +
+ "KPU4oul3DGBPUe9XNE5SjJ7usYsvJroDQcDTaLFrKnCLS1aqHqo1vSGEySRhymq1" +
+ "0Ub2JdLjui5Cg0OgAyFwRzuTtrLIETnek84awMtCp9ESClI6GC70L6VcHG5I5VRM" +
+ "DxkDYaht0wnKaDRTpUruQQOhrJt5eU9zwnDZsQC8XLboLBCToaxiPIoixht299g1" +
+ "eAN4RdbBM3PFsKrg6ERTws9wPEE53AHu9HnSjwnUOBSNrBA70oCmilLYPe+DGDgh" +
+ "6AG94FT/EZfpoKj3EISVg8QpAngqM8vmA3SBJCvRSw6yhCJNdyVUolCjZPDeXsG9" +
+ "6bxkCEDL4kgQb0NHSghSvjbgTCRImOgQX9g5YQnK1JnCHQir06levMFKVYkHy0hY" +
+ "Iko0oj33Fl52C2vKsBIXYs0AwtC0BAVsqkEI2A51DCQ4czmzpfPFmm+b8ANnSoK6" +
+ "NuBO5JsE9wB54ZFkSd6awB68gOzx6BZkU0W41kPJp0tdlQoNWMl5ouXnVwAAOBQV" +
+ "QtmwACYSMN8JJSXDEpDDXCxMzIoc1vtUCyI83wsQowQmOdEQeu+6wUTUVTUZ6V0G" +
+ "BjiUxQLwwVYDEAdoXZoZo9PK2kLxhW04FenMCowg8QhwJC6ISvJoZdAMI4RxmXl9" +
+ "WGpq1m5QDogASIegEgDIpUXcDP6wOlBb2oB2J7FIYiZ3rGZXNIJf2atRcQbYVDkx" +
+ "Cz1D0GsdMvIO8NzFYSwtpbyZ1nGAWozaQYNERCAeNIRK/KCxiAvTnMSeKBcSoITt" +
+ "OIamG40xIsICd7QGYq7g5yMZSfYIBjSC8cIthVOmEmzl5cjRRQSFEKnIqSKUG2y0" +
+ "d4pDaUQkJ5CMiAKrdvrMLFEIFbQrfWW0hD7GB2FrFcwCpSROwIDjxYYPX3mjKzEA" +
+ "oiIESUYpR3ygcvabgvYb5JsUBDar6xA08yYdnJ3dmc8KkH6un9F+sESctLBFkQGm" +
+ "Ta0bPig+sM/K4rcNlicUhXGvkeO2yqSZ5oKmK7mzQnIIpTd6txohrPWxC+w7O7Xd" +
+ "9LQtO6uqZLhzsHZpRcxYOi1CFignFLhwDuxorIb1rsUMRBHkUkH9+wAqL2aiyPoA" +
+ "lLwUclJO0yK/pNNLRBkAgxgRJDowL+MDbn7aFmDs3Zum7TMmpl6eNnnKXjW+cIZL" +
+ "KTUDBhEK8ciqkQeV7o9nO+RdjYhyConjMQRTBWmeLu3GkKYbSDZ+NFythpRclB0u" +
+ "+MM9hIPy379/P5JvRp9K7Hh8rACxIThkR9bC/mjT79r7kMrZfL3DsQq9dPzd80jy" +
+ "omUQ0MGQccce3Fj7MWzP6VNxLUm/pBuxmmyioIE45y9suzCqg25nIpkvY49evNI1" +
+ "vdkD9EHHY32D6/Wt95wXiY14QGHv6Tupr4QlovqZsUxN/gppAOiLCJKKRQoB3Tq7" +
+ "wOD2KVRzt/RlCRyIOQHSOSr3uh4krxkmwT/BsrQ79YvUxmCBsaLPe3BE9rd44cRs" +
+ "EtHttA6UiBxgHNHMBs2t3WoqicOUCJ/pdOhWwXx0xzvjx3O0KVN84or1DOx3VbmY" +
+ "XBKjiLHHQ6cosigwdb8KKicNL3O90EPY3XkwoBs5FPf48Tw4m8Z4osEyHXmsb2fA" +
+ "Ok4HFRdQRcU7OGXaHlQhmiCfcEzj2hQNDNA6MRu4t68O2Z1CjKZpojvIZ6gSyZPH" +
+ "rL9rdnsgo9LEDXNXd1XbuepmStaOYiD4/r5zmElX0N6F0Tz3VCoRv4sIsFhYUIgI" +
+ "numbH4pN2G+IcL7ABCaNu1mNj6QkUIMAhtoR0MMPiEUwHvdwMF50hG8QYCTnhfkt" +
+ "UMX5FQVzDOdATVLQbTBOoetSGcCjNrjgN51GgITFdoNWnL64lJHbNklnJKcjAsED" +
+ "6LlEuu3zlPY6SEcibIy1pLUAd0IHMRZuIwhRlzAXsU1wRK4F5NYIkTsbgaGKAOrk" +
+ "3mDdrs9oHE5vbz3eO7IwqJxcJxDru7DPr5kZnfTpXLnLVEx7eQEex5Vc10EW/bNS" +
+ "/UN3fOWkQhgOwHG8e4Yi8HiGe47HhLNWwnMlMsrBHoa5VyAyXB8ny2xOvMcOHDgH" +
+ "b3EqkrzSChHUyZmLI+6hu7wISKUqFFKTFWDllLromzIiucDwBOQQ1kp6KGChwrGN" +
+ "IdiidKkg6IolNojcrO0BeJ7r7kxA8TUb1OsJ0DwXlDQCiVkWTKjwgEQoLqhDMXRo" +
+ "Qo9pGorE3XPYHlVcm/Fl0ZUNWuXAbPgxVowsObJtykwDZmd3Rs9kF7ovtgP9gQ+4" +
+ "ImoCUYDVbTqWeNIfHhQ3fcGSykKPKGvzG0gw0ZETg97odgi+CtWJvpYu2qwoTAIs" +
+ "E9R6CGlAcEl9tTTwETIhk6KNV2KAPhQLimtCFryG/Hiw3nYgO3u3TfEJHQuFVBHi" +
+ "QGsiLqgzs4bdm1MO8CUwBqvDVp0jQlTrbg64FHW97NcVIgioHQCAjzim4h2byc6c" +
+ "ANEWA7Wm3xWoYIRbEHeZqnzzDMAxmjmtCjoyJRko4E6qJSoabUiR5UHY4rwkhjGi" +
+ "57nGCJQGyYa6EIE1ZkbQuFKKxvM0KGlAUTD2PCxzTTr3sa2oAwP2Ie5M1JRb4eh8" +
+ "NazCTDn7w1nJjXI8EDCKsUADgQVYSIv0oS9b+UA6gPIs1SOiIhCIbAeri0sZgp2q" +
+ "Cjt1qVoBinB93WUFd3i+GNTr0BMoqCtDIo66aNKIkZtiCtBFYTxRAkbRGHW4E2Qa" +
+ "wGELRMBSlDORfaNHjJo8HetTIRdgB0R/fXAbO2dWJb6DfUEsipYiw5A0GnF8Ezhv" +
+ "GlTxeCaEA4SjJdyifLMm9GUIqQiABhBNrSrnBJZwcLnsUPG8AVmRARIaJRIAl2Aq" +
+ "vN8GsE1zgnAAG4OQm/dxkQHKoewTW3RsFeU7RIFDvSeKq6tmLIwK8gvYW2oipkRT" +
+ "wRjRc2uNOhMZYE5yw8o4PRldld0CRW1Do6zyeWGLAfbpCqPTGDSqcoJXE1eKBT20" +
+ "VES/Gir1g0EQCpg7m5ZtoK5GATGOZsXKcwCUdiYw78huOate6CDObwFxCKBgXHBB" +
+ "V6vNFaO1koc5AG7nTRtcl9SatzUT+2esG3qOOQchoqjI0MZiYEGiTyVZp67hPaez" +
+ "0Y0m6xKBzy6R5ZAO9vJiMqshjhrIky5HVSaeZ5qEyNVLWOJtWG+4jGMGDZuXubu+" +
+ "1BVxAySGWyePnaGc7uXgXUFUo7J3BHWdzfN0ndx97DRHhMuD3FIbtcmDu9FIUiHM" +
+ "wvJzV1rl7V3DAElvIjuzuAN5aVFegjAg8oRCh3gtOg4EUlSNQ+g+YCsNL0DFoWiB" +
+ "8GhSYOOE2b5zZHnFEUAwcmIWCMHBxMSoJhWMWrtE4EJmAmGLhxoTvSHCijrgpjFw" +
+ "YaJ00WnSJr+RmC5jFqtEbUiI3kQFaXgg7vKLYF/fBgwaV+EnRk9XQKQPOgkBdnA8" +
+ "kKDUtNQ28kWcA2LCiCujWK5nSsg+u2au4siUCIIuFgTFpAqiDAnZW7L63Tx5sg/t" +
+ "IR5eMo5HINaaOXDMrHyG8ytg+NvLtlHBkBo9kRnrKYt8/qyVqWjj5VEqVy3GpUqV" +
+ "hixKBqJGzkfhHgoFl/X1yrlEscB5vLEAKPAYyGQRirBKEZm6RZfA9cJGIMRHO5ca" +
+ "CEW/DnIynaC2XohJQkB3yhFrMFq3qxHJ4+QOtEUb2wG1dJBDDTr2sZrvJ4RcRMbT" +
+ "qH2Jdooaxt0NjDiScucKju2YzYaBBzvUkkz7Rs5QxX2gwjkdYD4UtQubOAigAFmX" +
+ "wNXZ4di59KNNkgtapzDO5Ze1RNDg3lGlzmLiBgSsl48e7xxrPEEVA8DigDOnCoWC" +
+ "NyRTfSavpnxLQ91Rqpqq7DJKoyD2FuCLkgrmASASJuqhEdivR0jzeV9CZNSuy7ox" +
+ "U34bo3ZBM43NBAmhDigDK71FQEKZjWNaenQQjAhUwtFmR3diUG9KvqSEILrtcrnK" +
+ "JYMYsRyZAMUMhxGC3SmHeUddC8aQDaajNAGHbXfMJnKQ3Io5u809jIeOAiCmGwEc" +
+ "SGxFf2Mh3Ck7Q8NmAQs8MQPGwLfoDFgfOCTl3U4o3sLxM3kkQktElpUOIQi8KGes" +
+ "JJoQV1lFdBdVKBU8i65cXjg3ziOG1RVyGUA5EA1Bz2PdlZvXiVd3sCFzpi7ZkuuA" +
+ "okzCH5e60sadzfeQCtFe9t3jHrFGwPRHJzHlWiIzEmgstR6IY+MDjh98XwynDQJ9" +
+ "BcV2odeecqlvFnFC/t9u3NHjnIqGa7bYikVnM+yf5vO/or7fvUJSIr379aG/2n64" +
+ "/p2BO0/o9sxrOt3vIpd9x5yvc+etFPveVHuePsUB3DIaidl4CxRx010k46whEN0I" +
+ "g9O0ug506JYDlFzQbuZEuMBAWvO6IBV8LQl756E4B76UHCsGLzEOHBSd+XvXk9WI" +
+ "YMbfg56ndwHELY0vRDPXRQ99d6bL5OdJIUUzbJDqWMfi11tQANmXKblIsgFamLRx" +
+ "GwxzOeJQdSQi75cWKugYgDTZ3sYwfDRyoBTFJzhNZdKia3kOBcotQFEQCbS2nCSC" +
+ "TtEiEuncq5ywL4jCuAjum3CYQzZnvAElVp2RRCOSGjCgOCgk5JdEY3YqtbGzSJKS" +
+ "UdKYzo16eoPENGLo0phETPJZ6OIkAK9m+kPCOQTXKwGmFeO3Qo9mYJjmt47wpZ4n" +
+ "OUCpkBXxs5+EADfPu0KwMIEgyIE6Rn15vJ9n2j32MTvEFNRG+O5FKG2lrAqyh+Tf" +
+ "Rzh4eWFJaDwsQTEaSEdaoYgZ1LlWfjUAeC8q2dWnJ0LQ8IrFg6vYcrdprGOfYLx4" +
+ "1uAB00NBrexzAOhxEV0hJgfdnNpAR2yetGXXTyUK7POeMFSwUcyK0k54TYZ3BFZc" +
+ "82vsHiaF0rspFEpTTqjrGMohOJwo131kTcrGNoxl7VJWqRTYNtAAJC7V+xyyGxzg" +
+ "D6IYN9WtIiQNBELyUK0RY7CBDsyDhV4eNdSOX7wMOkXgGQkRysCNmAEPpdYUaOma" +
+ "XGtvRVaKBTpnHMGXsHRzNvcHtrkV4qMS3LQYC7AFDRgeIQXw4+CQaigKJZLolFEe" +
+ "ynETG9VkDEWb3PCLQWZvtb1uyQ9OCb2ljqdYeYVQUVrlhSmZCCLoCzeq3qihdKlC" +
+ "FCVu9GdtanaDaeoee8Gh0XfV746AG0mFR3grOkNaEV4oAxcwugi+5mLavDgNyeab" +
+ "aPNUAdaRx6GueEE8UgBraaEPEBA90Hd0IoiYKzzLeyC+QP86S24oNGgPN7VEZLkc" +
+ "3KKB9yaO3suM7dsqIyXBAyaPJIVawzuyNy8Uis1TN6MwDW+Sc8Jp63uyww2NEo+W" +
+ "pXWbpGdzmc2qkqcY5CJNMqipmJnZ7lPXMBYk5A0CO8LEGgRCLCyFEGqDni6GFwh4" +
+ "ISrK96I0lzDiiuVYcpktYea5V0fSBQQ4HLSCYxVJEIpIEG1ivgPWGQ9zRCT5pzks" +
+ "lUdNyhMqyFLVbXZ+dbaAL5MolnGQ0f2Y0lbErTW9N9zvnf1PL7QhIQj5Qqg9+9Ze" +
+ "cP2k9FIfAnPPeCQEemCDu+PpovnNLGt2xn12fm+7k++eYUe5zI3I85qKYoJjmjnl" +
+ "nmGtQxhZ8OrjWLs29chu705lyXsj00pO0r01isVaNX6Hs8cRtAzPRBUpl8Xo2aUU" +
+ "RMFSH1bMAjgAzlpfCL5AHePjDzgQW5sEzApAHGDajlxaEJMRENKpBhNAm92ON0Jo" +
+ "cKOslyv1CmpWvaQTDp2e7sgwMWOxFETVedrRILOecthi4+kHbXO7UCGYShLGHMPL" +
+ "BFyJnklnbddyTMMgm68FBsVzHACN16/QBHAADr0hyZ57ivEsZjdscOB4MukOoq75" +
+ "3Sm6oznxvBWSoYDs0mM85hVF3AUJAQhIC+IAnAQ0nYeBojTtDDu9fb2ZgfOvvEtI" +
+ "Ir4U3SSAbviqYgJSp4BnTGwbatDG9A3mGF9hEO+hcZwvmsmKw4IUUYSm04b969eJ" +
+ "yhd9UFNe3iSa87znSZ8uMCA9unXVOthwgCtrI694ULz3RAeRPJ0dGGH4cQq8+E1k" +
+ "N2XKOIV8b7t0k3pInQ2SYhUaCSxLkRMIbumyj4sTVz8/OCjnFqV6iuYCrEQETZhg" +
+ "aTaO1M91eVU+0dN5lIKE0hY+6ZhdH8xPatSu9IGjiSBRxdlYhnVgx3DM3OmAAPUh" +
+ "oivOGZEA50UKDKlBGKmuKZHM7ZnaIrey9kZzbWmTBux5hLriaXv3sCjh3RSQN2Km" +
+ "seQirWUXffY2PUwR4ix73JkV2Xnrhe5wc7ATvBMNCGsQ9s1jt3XLtQAW0gIAsK7i" +
+ "GYMN4XZoBFGRARR6qCjNIi9RgC+TuutUGw5urUrW9IBs3WmZh5j0JAQtReBHKKCw" +
+ "Ao1BYPjdMlMyTuA3z3s5HrzxCD7DNUpI9NKK1QCbU3u6DYiKaA7sOUSYFvgSL2GV" +
+ "56raInCNge3z1vokDQ4oBA7DVZChDpWQ6HOcrY+5Qi5tmkDUUFPEQNwVKiIBqChg" +
+ "igm4JIiXEAJEBKiKBIihiUjIdguH3TxtEV8CLnCZZJXuZrns5yGzNcQqb5nRD8Kf" +
+ "Ejj1uLimHfFsXzlUZzvk7zxYPeGzkRdgYzYoe7Nc34mq1NfS0+Tpc572vBToIi+h" +
+ "NC8Ksk0wShGEgp3jOt0s2159erxfPx1eTb02DQXSuDB5AkTVTpTmMjNgcOdrKEzr" +
+ "tc4aYgDJqgdKhmhE3HZulPmAHB7632oFlcTlmCvKgosDR7ft7TOgZfTYJwR7AXuW" +
+ "/S8+gIFeKNjkv3u7oLzAyBFiIY4bJOh4OuYdqgOIWvESJAdRUwkRH0TBzeSHfdN6" +
+ "Bz4E9oSSCWPhUXvDkFmbZ2uSLokHIEKenMqeTFXgg3poKBEk9zF2SbQhJap4uGJJ" +
+ "FC6V1rXoCFhRw7YcnMjkezOEULe98ME6Ds0IYzERWbF33DHNcyL7qBnaeKKU8Wx9" +
+ "AYMaYwHMmO44OFPK1nebx24PdpQEPFOIOCGGRgnfbPFFecB7CSMybA7NNoCJdWkq" +
+ "A6uxgQHTSlzjN02jfYhsKEJKfK3grm8IX6/ZCr04RBTyJ2sbuCdybNeEICJ26MbJ" +
+ "jeDS6wgqPaR9ormfdmFDLWdBF0bbY2212EiKqJfXchQkdNNXrLktUifqXfCq84+8" +
+ "Z6VhYN5i5hktLGeDvDyUvWWAs27y4SHHMOtg0Rag4RHHJZJzJpVzqEypuBMu2xKI" +
+ "MQEgIgDMNB440aFxBiGgVIhdjaNkyK8RRKsepNlmwLGE3pI5dmBEqgxMdV0KaHO8" +
+ "HhyQ2xG2KGDGNoGzBt7biE+kQ6Bod7WXByC2xtI4zTaLsEoGd3XlmZdylWF1alnb" +
+ "M69mJMgnkxqru4Oogy+Ri7zgqVzMxct3GGZgXGSdkzJjhyAuE2PZ723DJwTyMnjh" +
+ "l3tHY5VDpUieCoJmSC8uhRWOsIvHrs3IcXRWXW5dAv7/778fUJpA9gUVtiDse9fX" +
+ "eLqjFjg9tC9YHmeTlFWicKAUpOimCqgEtGlSNGcpe3u66YHC5aNSJLww2kUhcBCo" +
+ "sQJBzkAYmK7l1EZTiK2JEzDnWILQWZzI5NHO5yHsQScKeLA3Y1UxANcWcBcAXTZC" +
+ "nG3WEshvETCEE/bPauJ2LcYYpkGUUtAj4AMoK/tv6dyS4In1VQtIbiS0kHqwagwE" +
+ "s2PM5itnuLiqWW680Rhkknpn2RxZA/NquFxL9qJ+MWTj/aqbZM1Eg28nmVVm5HKs" +
+ "lPLjlU2yZl+lLy2b+bKSNUYSElldBP7yb+gMMPeIR9GJowRgkgRoYVdqHQlwIDLQ" +
+ "aiI6H1XmnDYFAee304yulhRgMIl8rODvjPsYDh4FRB4lS0XTd85zYMBdO9uA1XQj" +
+ "EQiIrzFbmDjy+83gvNdxScSEU2bnSmgAjjhZ0eHKQtVyg3vI5fSCEKUQLGWCcN64" +
+ "SoBE1gka0aWw7IlYUoJeMdqQ5ytWEITjsqzKm8ZQESwE6E2CN4IIUSEnUYdM0vGl" +
+ "bHppfLXOIXBTSfWIgFSl6IChy+B0e4/JZIPYtHBc8xqqNyEaYZAWKNvfjpvJ6pXN" +
+ "iRCGxlbePrTJreU3HXYA2d8CBSRKa51BpHeF0vGi5yH3vMvA8hjcyHuijgTurUuj" +
+ "QcspGgZqbDJsCwLljxYqwh0UedgzggA1oQPI1qSzDKyyTLBusjazKdKbN8Mpiiht" +
+ "tahHCFFJFECD5lOaLBoYNnSA5Vo0uVRGun3s3jbMCD8MAOHpiyBtrvGjhr1I4Kam" +
+ "hC90hDDgrxsCgbMgmSDrjyPJSVi0W46roi+Blde3oaM85BCOMlkvxXOBKzLEV9tx" +
+ "jdKcCx5V102vHRvAEBovGic6QBeiErtETJWKgpIgxvYmMdZt+YQ8c1CsakICg2WZ" +
+ "YJ1wKg5NIYcsHI7TKYIG9UiK5Dh3nMiYQyjsFTApEA2cmsjhUIqrYHeoS28gi1UT" +
+ "O+eZXGRAHUG1Gwk33qXWInhbyo5dSTqBDuQtgRSK2UpGW9OB04oooTkj1I1XpEzE" +
+ "sEzSF8gCdoVyiYDkYCLfSn0SyX2hCQQsiaxSyGKpCEVn+T+7ACroi7X8aJopBWVZ" +
+ "ZWHIQaTx4SNUeLDFSxevebd+cHKoaR+Uldj4hZiyxAxiEJPs55pQEVzsqkE5E3EK" +
+ "C8Zrl12Z6ZyL3XJIIiYtC1Axc5KDSj612cHXeoDiFrcpuKKB6LCLGCsgEWAcjIYi" +
+ "7hqF7Haj4908uyiAKrcawQQ5bsgLte4FvgR3kPuHtlEgneUBi6RqG4DiDmJiBIgS" +
+ "VKzW6RQTsDZDRB7vFB/Npbn3thjxnOfz03l8o4iPr5vcTXayIrevu4elRUVaMYKB" +
+ "TVWh4hpU3OBfMUdpqaMvN5RfQRHEA5SRsCqgNvSaSWAjxg2Sce8tmpLwQTzaEJKY" +
+ "a7vw4DMq4BBwDCYqTySZ5Y4qUEBqrTyjRBdDSeJIR3x93G24dW0Fsfb52b53LqcB" +
+ "LxkrVu+jOgAOVeWKSAPYajZnWDo8DQrwVXMRLreCHM8HdKQ7MnILkIj3MoONh0TW" +
+ "CXGY8bOCBgAXDflHcvJbxkD4icpcbMiA0ObDPeZMm9qh4TsxeYSrNdsERNogpnNA" +
+ "iWcLBMk3AFNaaFs84CFDeDFXxodhl7a9MyVyMFFD0AIGiNGCvoSCLqpw0errcmtJ" +
+ "ZMaVMLAkEC6A0HNHB9bcXzSDliqUfebISAiIRkyhvuGM41wC0GZ9e14N0k1dvH2j" +
+ "IIzL0HDgOgo2Teq2QOrLViXLanCQRVQkcYimjkTcFagkgFwMQzjIhkESKoRYDARO" +
+ "OUM3MEMWezt6GgSuFhS2HQXOveJgcUGzsH1FZhnVaE8D1kRDjrF+riAwE0VbuVvu" +
+ "Wx0Vo0Ivo3snYbRflxgcfJwR3m0ICx85dsSDvT3cZ29Q4CWGBQLggyCKEiARitqr" +
+ "sNm0fTrW3Krxa102dakYpVhqwhVCrC2SGOlkRk1UlqBaSVYVJYN7ERi1FAbW+G3z" +
+ "51re5VjVbm5W5UlbmrUmM9t/6/T6vv9Po7vhq+xJDxqrZJCSN4A9ebXxyczXxmoN" +
+ "33VoVPS3BLDLLHbi5spPNZK0uCZvZgZzc23MBvtLdad1ruTZJGVJwaelJw113fR8" +
+ "rnExqR0PrSFjAyjjVUETBCGwkwwK3s287kNjE+yu0Hbm242i5VRLlk0STTSgxaFK" +
+ "RQ77zTcyWsiGy8yIrLiHHJjtG1A2Yw3W9UlzdFd2HcNCqkQgyani4Bu3NroVFnYL" +
+ "2HzDRFdvTmig2HcOnFxATrA0TnGma3YZz0ymbsQAYJGBFbqwZSEku3x21FBfCArF" +
+ "0wi6MyRrQQhzxXZCortLApgcocDruDxkuASSjkkCRHHVa1oVlDu7SymYTanF4+3W" +
+ "eROwxPvSBh9NNJ8ik1JAnwJivP2b/k6eXnnoQc+e3REtcmUhKCgg9oIgj3cO94cZ" +
+ "1/yZZPYXmLsEVzL9wyayYqdoLf7u7cMaiHlnOXVcjK1tFvlVLZVUn6CtS/Dc2MGy" +
+ "jQgfhC2Kdjr3P4oF82DpTA7dJI8fmoIQcC1skeRzKgLQfdKJKWsxDeDRAOkVD1Uj" +
+ "6REe5pkkFtcBVDyBmsYcJiDPKL4QYIAKg3pFBYsEheQysfqhKb7Z5Wjm10jpNiZp" +
+ "B5IyQBQMUV05k5WF025JblIlxOjYPTSQS14ht99a4g4RAIMEXBQ9VYdUOnAHboCb" +
+ "AM8xBqUidwUIqCaNuDndlLcheCQRzyDZsza6jpcC8J5t93uI52DOCUmxyBWG6xjU" +
+ "DfvcQN2R3loD2RQpUCyjb0Nnj8jM44gOI4HkYOhJNFBUaBwiiugHBtgmVWWcPJ2v" +
+ "AGlYg8pB1knDeEQyYzoFW+nZieSuAOXHdpQnYHIIvsnV62gW62oGOQSq0ZHQmkz6" +
+ "ve09eR6+As6PaDEAPBAjCRxHiizSKSWE3lI8fDOCDmGnmVpNbi8eUVoBcnjVYXJH" +
+ "Wy5Y+Ig8gsiDUDTA6xDbTXjDHGKyNg20+8AoKRpUzjVgeIneyymHNIhlOlRveBNb" +
+ "AyNu+YZy5q7JQKKSSPDgYkgOZ54N9vTDVhqc6UhuwvCADsV5z0KRpEITXj4+mgml" +
+ "oIZg4a71Zlm7m0gkdp4U3zAnK2iHrqjsxi8S8sDdGDo9ucdGhjq81Jfa1MiJSKcB" +
+ "A701FV6aw8Hp7V9EURNiZNADwG3dhrhp2xsMQdoNaPWpg17FE8O8dR1VHRzpUzs4" +
+ "oW8uITBTDYPLynlwZDIItG+CIpXe2AKuCI7Qs1rnC94AEyGbMuhIPF1HgmbONCmS" +
+ "5k7bSMjXhXQp1OCjmkAGTvLOmI0HOAt3YzBQRFgqFp2bepbOC2EIwJLOpBSCVEHI" +
+ "kdNxHOkAQs0VIpgJl4XMHMjEgid0t3FO8MJhYYXY8sERIghdxq3vQKeC72BkdCeG" +
+ "xRxAiGkDGK5LYsCK3AWW+AM5VQaWqrkJ3NiK8HR0Oyaird7M0013PrNY4oA67ZPe" +
+ "zuDTrV0oZMsRpR7ZipzQ1jzg4Ut53oN2DS2qHRF3Qms17VFoJ5zQGLHnTQ1WhcBQ" +
+ "uEUTQhQjEQUHI85hT5R2UYC3twsue/zOINAzYK9Mg24cwzR4rXfuB43f5g0wg+ma" +
+ "n54RRErdutOia0EPZPBoCriZ3WIjYiAiY9ycBy8PvV0fdNCtr1kSkUTFpWjZQ33A" +
+ "Gh0a7ep6g4nkWoASDIDjZq/BgHfve9jgEEhzWCeQR7Hli6A20uwCorkhnm7lK6hw" +
+ "1GyiXCVzPlIK80MpCjwRAoagLZOVxmZA+eBSGhCIL9tBXabrpw47c5zKNaAKO4sL" +
+ "7KvUaVGgeYA4XSjsTXG+b3fBFtoGLhoKvIHohI5zzHSwDMUyPCJ8Zjolsa6FJ1An" +
+ "5EizYQKcpor6HHhk6GdulzXbHMekayul6RlzuOIXQHGhtCOsOrdgh5yBUI4QD6cJ" +
+ "CNmU1QYJoXJADgxaZvbMMEEkHSPshs7OGaJOF613Nd0CBj2PIi+PXV5W90bvAECz" +
+ "SV7CKiJiGUeZErQbfUGQNmjhny5vomzEBFviHjwiiJ0o1E52tFzGaXbdCZ4hwwYE" +
+ "QPQQkQZFRB5oqVQlVfs5E1NSQq6LJmIhqJUJBkSTmKRwxxBG4hmGYgYhOlbgcIM3" +
+ "Qhnd3c1BbjEYvIhbZzEQRGBE2cgI5W4RhHpgCsRsjcdWFMN0olQDA5nd4AckRPbG" +
+ "2+i25y8WqkxW8Wupq+jB2ymQckBbjqGGJ2AtMuBuG4BrSNp5MsuWwgXbcCXcIAxo" +
+ "J5BTSW05do8jzcwVXNZNxgxuimapGRGRMeE3YqpoRFQVEB1gVMQgYxo7G7bmRDES" +
+ "u71hcZac1QBCRIHe0LZAbAbHxDwuLIhFlGQ311uRlODv9YkCQRH+Eh/r6Q/7bT83" +
+ "9x/Fr+4/N+xjJ/ef+if6dubx/+uT/af5yl/qO7x5v6rVWuWZlZjM5eZ/VustitjY" +
+ "3HC0dHExsx/qOenTOnMdJLi6X+gqTDD7MX/BpCpmFwf/C6fg79fommh7CkD5icKI" +
+ "rVSTX/Uh8fGFGKs+lPgrQH+bz8pu235HwdPyPCs0aP60bPSYwmirZ/oP34xfQ1wP" +
+ "pnDAX5KPS23/G6nZ/TKCJiCNS5oIRTN0GCKEmhG9kYgIrr/UH+fx/tEuBL+6UPJP" +
+ "b3bTrJphJ0Vu8PmOnIeyvm4J8dKtpVV7Nxk1Ldm7r2f9z6VbD/lVr/jIa0/ZP2/6" +
+ "fsPJ4euM7/l/w/Hbe2qPmk4Gye8+XFXSsxt8HE/hOObeMcPpNPb7slXdTm6OZ/v/" +
+ "5dVzU58rFtJ4e3yv9l6buQsjiD1R2Np9hTyeTt6+038W47SRy6PY06E+P3JOgWaQ" +
+ "hHAkkR/Xh/2ncXif2afyf4Svf5NvY3/UP3JXCqfaxkZRL/J3CPDzFxNGAzKcQTnd" +
+ "cHPayzzbvLxDd1UnVvMbTw9BywcPDfsc2zm/nyMfDmf932T7p87KrxgyeFftQ+tf" +
+ "Cfh7HZyeE2aj8Ld3bXw43xb83/u3I6WSftIeD/xbZE/8bwT5H1OjB9vDc2fr8Q+u" +
+ "397X9Gf+PSdnVOzpP8PP+c7z52c3SP5Gtkn9kn/w7H1cp+5o+HrPZPv7uTykTn4t" +
+ "qMW5ktlnN5X7r3/GJDMMmGVMJN7siu/yfnqffmvSXMu6ft6bOJlTaKqp/L3k/g2n" +
+ "c/7fv5SH4e7wSNdHTnGSe7brKd9m2+rfs+75c1sWpbaXqOkkpTo6LvZVDoKaaPJd" +
+ "rf6/wabfy//P+Ses/dNe1Wv4P05eaf0Xg/vluP7Okm/5eu4+LJMnvJ6vyfdiuNK0" +
+ "Wbn2ZOW7k/O5dVV1S0twqcn6SMKzp/2y3c5D8U7EssiWcxtqybtlfi2p2J1xcn7G" +
+ "nI/NwcrP+tfj8/scv7QZ8v3tjkfXsw7Hk28PhyNkcPY3e7To4dLZXs52SnOcp+0v" +
+ "BzIaa0rMZV/r4j+X7dHd5OqeK/l2Ng6ZCf3R4MsiMaozClqv621/Cfwfp/G2c4GO" +
+ "dLV9XSfLMq1YzWaxrDFXxLOJ3YfCa+Wpzeb8XWTm+JzP+IICf93/kNaqLaNrWSqi" +
+ "ttajRqjbapmqtpS2qxVk1bUlWpNqLRWpZqtJNKo1U0ttRsy20zVJqrG2wBY1sVoL" +
+ "FUWJs1ikLFTK0am2RVFYUrYNFpNtTCoNYjWpaFbG0TKLTDY1RrJSWwCVU1K0mkrG" +
+ "yUpUbZDVikMW0bZkYotZMmZGLRsY0KIViLGjRsUWxtRUzFiTQaisJEzIaWTNYIjU" +
+ "RhTZsyUWxsUUlY2oyRsm1G1k1MhLM2Q2gWRRMpDGE0zA0ktFBaZGyBETCCMgSEaj" +
+ "EWjaJKU2NqZFooxiokSIyMMUIWEaiMhQoIiiqQmIYEkRhFpEhYqSGCLFCKEMEEGT" +
+ "9mvzf2fuM6SFZC4Qd9fugRia8BBCIvlh/UPmUoYBieRgSMiPA/zM5kG80OwWXxVB" +
+ "kDKCgX+vVRm/7UQIDInnOZ/vuDq/4D8+p51Kq1Jw/kWTzvI4d9a7SyLfWstuvCsR" +
+ "8vO+Ve9WpNJv7s7+fuL8JV+dboUuDPzER7chJZ58smGb6bfHJ+/wytuIdr6d7a47" +
+ "bq+tvU9ubKTxSujpWpbkOGArKSYHFiSSfHgG2RPcG5lSlkRGbrdlTVFVeA1pC41W" +
+ "V8XE0QYWbMrorO7DWTBoBRpgyaqKdSFItuzQ+QpmRRpSUkgkAkgVhutQk5vCYVVC" +
+ "2pCBtTYcnZA1HRmQ5KEKUJCjE441UykKrp04rW12EaksMjEqCmiOKKAiIoVAjHHG" +
+ "4Oy2vMLFphr2skmltbAj2yHto+/C1qRSHQI0oYJy4xPAK0hBhkBkzKGIDKfqR5fu" +
+ "9Rb6jriPwFfrT57/BORRUS2uxaWe/23vw/VDRJUNDKbcoql9hR1STaoUKFJAhAE0" +
+ "AZZLjCTR5qxIgYLhyUQktqwQ0LakMUoDZaYvf1dL7/UTZGZSt/h0bF8bOrkShINm" +
+ "UC5JVQoULQdWFmExZOwxx6b/nrJEIzcATXe9RX4uAjQuZbT7+8dvCcTe970nE51j" +
+ "cmac2WktrRIBr8KKqmFiShChQWsTPnID4M0CSyZe7rltE0/bIvrM+YcPthAH85JJ" +
+ "219mY5mjPQZhiZDYZA1DzBlAjUcjXvLL8BABMGVQh/A/vPwUfqX/5kl6UGGJn8FC" +
+ "P2GG+QceVRTNvxzts75paBK7NzM7TzVVUzlIqqif8NJKRImR08cg2cHrQWxKYcNh" +
+ "OjnHzz+YPyaL9PWNrPR37fFaHr23fpcy+YYGWlsuQf4q7bXFjzjZ66t5DEnZsqLU" +
+ "ixYlKiy0ibZsjalZamaizKs1laSpmk2ratltZbWSta0bazUrFJs0ttalazaQUhKg" +
+ "lSUAqyQoWSKtotVYtSmoyW220arUsoo1tpLaNtMsmtaaYsVTbS2UtJgram22rCkS" +
+ "qQSxISyQS0FSSyM1KaS2laa0lhNFGhYWigRULZFiyykqoCxFBKRFSItCrIUWLKak" +
+ "ppY2WbY2tps1pm2ymqbabbLNiZojaZkrFMKZrKzaWVptZtppijZNM2SzKmmxsRab" +
+ "LZs2K1NVqWqEzMlJtmqVRjVNZWllSVLM0LNNZpalZokSlltLasJRUqopUpZIElIE" +
+ "lkqrYjVi0aSNqWmLKpslJtFRBbSbbMy1KoplRspaNlNUrNUaaak2mpVFTZVGxk2a" +
+ "GTSWmzaCpKbNJW2WqWqKMmNk1GkKUtk2ysrLNs2WwyrMqKpqZmmmKxtmqayKZlUk" +
+ "qNltKlRSm2StUtbLWxTNUqlspo1ZtltNKRIqGm0tlRtNmmalNGZYybMozNNKkxpI" +
+ "2i2ULJqUrGyyxJslNGpZmtNSsrNWZY222yttmrVNTbWZZMms2lllbKstpmrNMUmp" +
+ "KqUtptKyaplKbRSbJbLNplZtqM1KKbabU1ZSUAmUaxpZjUkhUmyZmxbRSltNsrMq" +
+ "qVbNtslSptEzVrMqaazNpmkqZsxExpJSk1itlWqay1KppYopMUkkkmbLNlMymsxS" +
+ "0TKlNjKbA1TLLLU0lTWalTNMilKmys2ZY2mqViUVKSyksmapVNqSJRqxZSyylMlS" +
+ "yLFSWRUliWKLJPR487tzxPbvpf6y887/zT6h9UmfSx2PLPXLE2t67TNb+d8616jt" +
+ "tPkeNmjOnd2bULjnN/5x19I3dES+7KaAHB8sg9OaIHogcFmowcPkd56v4UKiqJhg" +
+ "oAU9AHxYiJSboAuO2tYkauzYowUsXVGVlc0nYOpihEKtGCELstXcQR40ZwxcKms+" +
+ "7pFjCoGnlWDFSsNDI2M37zbDfLv3avdlnZZ+BC52UzTjZKLth+XpejoaOcVlvLIp" +
+ "Bt0bICZGx12W3MemDI+BEABpXP87P4rJiq/on3ucmKl3H2qkVoDOXeBVIHThRlRW" +
+ "oIeneSsFb5P81QBgJOLBARAX3nH8/r/f8w3ilqIGYIs2ETpWjUrVBz3ap+abPKWH" +
+ "pLM3ltPx/+N/Wbt1NbzHN6yn49NkVXLjHsi0YsxWYxt0mpP5liJ0D/BK861JPxVJ" +
+ "KrrKd1DEsjkf2fd+E1sqc+0G02nKaZP3/wWYV/JKhVSKU/9f2kP+Es6z7k/gUksW" +
+ "JYe1an/921pBsrUdXyfSH+6h3N4k/jE5ItS1VTkajSXnZgf5UtgpKk2jaxZibyd4" +
+ "83LeR6x6+RPw/T0lWWVLOy4k54wllqVWtTTUvHd5G6VXZwcLVpZCyOySqT/VUqI2" +
+ "a3OjB+BJ/c5vJ17xaYezrA2WTu8JipWJ34en5WSThOGGFkqslgxWw1Riyit2TjUk" +
+ "4m2SJs+3WFSYNQcR9lN+j4j1noP93VyHCfI7cNMSZzH2ZNRThulseIk/yU5KdXt9" +
+ "v7zmbk+gjtO690cSQSoFfmmeBxfI+vqGsirzNH5C+xTw2WGGHE0X+u176U0uLoPT" +
+ "OEn+qsbDvaA4s+lX8EqpJzPrH0sloeXR1c9OiqmXer0zgSe5ZrT6ScTDZPxHCbPN" +
+ "0R5uo6u07SaTyP+1LS2qfontI4sTqU/nOnq3gQE3PlZlmWZRJYUsqyJ2P6PJ+L5/" +
+ "D8Jssqnh8+u+2ca0nxwRAJ32knCcvhmYySY8DlHwPRZOyxVSqrmc5yn+vVN35FkO" +
+ "yvNZM/ORPMmjIkxNtLVRf1qQ3ksieqJL38h25PbeROj0cV6GFHWIPN2qxXorv7Oc" +
+ "ifauTZXzYwjFM+LPNWr/a58p5xuD9uXn6b8HdXj7TiR9vZIw7HVkmGI8569eqqvk" +
+ "P0vhi5cxU9euWvzV52lG6lLCSmYWK8coeiN0jxImMiT1bT9FffylTz7SRs5vwq1O" +
+ "E1BPxdk4PSI/RJu9WoSzsTH6v0nJ8nrzi+ITko3SqSvxOJ2nukqKkpNLHec/hfS3" +
+ "JEnzWJ39PoktklpWMyyPh/0Tc9E9Kdo5IemeY1NR+smI8T/dPNYrc5nXv9t9sHUa" +
+ "mQsqCq1PemmmTVTeR5UqqSopSlKWFOYaL87JVmxycMd8wy5fM2Yw/RXl8vbb5SVb" +
+ "u3zORyjjG3DhlMKM111l6sSk+BAMLpSjqdn8I5U+moXwXX5p0Z+Ev8Zh48/wLRnq" +
+ "sVOvKupu7tEKFfaNwYH8/Ci1xHTYAbREOEoEoBMbtSSnI7QnHvPpNvIrSaUlVwno" +
+ "cA2T6JPxOc9Hjj805OqKqKTKMtvz7PuSa/Ze7Y4TXj0keaMVJIBO6TUtNbu22/rK" +
+ "Ik20pV+zX62sR+LTYvA/nP8S/x/z/y/t/m/n/s/ozh/TTT0zNN8l832eeZrP1ft7" +
+ "l855ZP0+7P2fht+Mct5xlvGpyPw3YySSq45XU1bSyrab5ycrjjicbfT6o/FPun2h" +
+ "kqLVQZw1OrdGyq/AmFG8iUYmGjHDOy2YstLLBnKVZJvoZpv/dskjgWfX0jmmn+XT" +
+ "9EpEKhcAUlB/eYz+SbNu4qNSSEC7hItGyfhotsOAf9SwdHA8hOJqR/DyaGA0EVqI" +
+ "SKD6AWMbIK+iFwiWZNpCAwgFlSy1TRu/m2NnOmMXFK6UuExRVkRZMoar/6uXRP9P" +
+ "7ZP87LZwYx0FWaYU5vlVTqmnh1eev7szJOiq4leaII1cL9t51vM2+LzXlfVqKWyp" +
+ "WvCVPQwScjU2St+kOba054lwkpIqTJm2mrtWuoYNioqjXh9ZCcg4fauRyifOQnf6" +
+ "SGRSfxqdVrKlWU2qUzZplGsprUmLRsRajVG1FqI0mwhqNsVY0VqNYxgASIkzAhPb" +
+ "KKjCrJLVvcYYOJOH+vt9D6MOVhCbzFWO4yRsEfXvzBp0P+0m6q/l61TUNMPwDbP4" +
+ "A4ZborpXA29kUhELXpos8r3drnud3G50Si5VJtefj+9ZVvVRlXCz1Xg6KThMk4mm" +
+ "/BxViVUbKrUw0nSUxVm8OjGchs/DpN495AGe5+K5OvXzvbUNNMVStZlSc5ucwd3W" +
+ "l4u1dm3WlJobdG41bAbKyodIBU0lRgRgW0aw1kwVrIutSyFWNio1Fc3UKqqpRju5" +
+ "Aadp5fl5udRTjI1JPdwpAh5+pEn8lE/gwPC4SP7yQ/wfmhzK6WLcLLBfzaejXg5N" +
+ "ROtJbDGTLY1NWSMQ3kPP8tNlbsFLO0khJHEnOD8iIBLHY5E5Vaioqq6mHOzViRnO" +
+ "TJDV5noj3lYCpbB/UKCPiSPRFBjGEsHZXWOmMUqqoqjVmVmoGFKNXF5UqRqditja" +
+ "VqjRtTTJJCSNK2SIBLIlcoL93JoaGmSYppju7taVJZUVshVKnwaD0EH7hMmp/h+o" +
+ "Pbiejj/LCXLxi+sY57t+Gq/cILqWSklksgVasVYdKi3aLGlcq4fh/b/0JI17/hz9" +
+ "I5p2kpb6oqMezcw1GWkqUylkKqYsxkpUqrKj6ahmlf3ytR/QMwpaUHB8iNiv9K/z" +
+ "0K6HAP93CkfDPEO0tLILS0pZtCxDEo+smm6SnpFqPN8mB8k84m6eFkLPr2/b9vvq" +
+ "30sMxTJbKbV41vETNRjrYhAm0Kmypb2ozMJGlqo0oyt7s1+ZqRGE5GDhx9HdIoQm" +
+ "hH5pdOT8GMwPVn9cd2LOKocJYqpE2fJibmxMRhVjdipjJLKxv8lUwhE3F+9vM/Z+" +
+ "96zDku8juRY8ZkygVpQhCSGE5vWjeiSSO8ZFx43qYwI0q4xeFMojCEBoYwhDwpBe" +
+ "iHCkNkSihsIJhUNuES4aChQwWFNLDYrSqqVumBhK0xiN2qw02aBvWoQRkbNJJAkj" +
+ "HBk/f0jBi0Qj3trasZSWJAABGGhpyETY2mx2GGObpTObWrb351Vt6QURN7vvOMuZ" +
+ "MryvV8esvd69S9JGxrTRiEw0k5hoCqjCFy3INRaqNJwakaGEikSrNSYRWTRj019T" +
+ "4CORqY4ubfHfS36+r2c6tibQpT7uqxK5TMRXftJ83l0OEKb1aVXy8jZKtwphii1E" +
+ "32XPN122+997zbb3qg2rFWEspycmx5fi63iHJ04NMLBsItv9IBqEOmT9g+SGvcbp" +
+ "+/hdEfGRojRGhaIFKIYxkBlxKkgcNtjbaQ3UpIqYgYoKWc8GtGtpwV4rXQ74tWyW" +
+ "WrSqxFk4NRFSeaScu5yP8VExZEm6XE4chWxqNGXXVJkYnR2cdHk8WdGYy2vCmNjq" +
+ "ybrMN1FOOcToskqqI6hQJYpkEaNCNn6FTLldFQjIRVoB+utwbXmdbmWEDBprGCfA" +
+ "JCZRpKqRYfq2e+7Cq5cNSfueE8nT0BAAmYe3/Q5/hbbwssFCXp+OE9EkGFrg00fG" +
+ "yXabHiy3EqpTo/Z9bfo+ZtPrQAuNWcI9+eSwSa/nYd7oXFadmUYi1ukq/ac5AAQE" +
+ "7du1t6q7K4YbOHkbtuq8NNGMZw/VibN2MKnJyZJzVzbk8nnizzY8nI5Pu2KrwXrL" +
+ "dm6nQ57aXMY8TsVyIDC5bX0WfDw+jTpp6QuEj7W1TMvq8Zyu9vdXFD+nVQXfaj5R" +
+ "BRz2fkfnvWnhDIyYKVitWiZZUs64DB3WmYY2xUAXs0Cakm2Wq5otBR1e9IE4xR6I" +
+ "UQ1xETvEmN8IlSLEh0Um6u2FSoE1m8LDpW1Hm4TFaGovlKmdEOVumVxam7bCipxu" +
+ "T6y5i4+SRHYrzydyzSvjm0vMKixJqmXoTSKKjLRTRkxS7yrSDPFa3nQXLkJi0PGz" +
+ "Ue3b6kGdih7KjMMNAjQzQTDB/OKQ8KFuO0yGQmIsJJJLKKGQAQmMosKAsZY1R0kL" +
+ "PhQaaKZWN45u7TtPs7uvVu7uqsd2mxpMjs4adWm7k2YxhWGOTRjkw3YppSco2dSD" +
+ "nDT6F8LNCzhHRwSHThhZCw/JCkWC0Z4GlllmHQk0JGWItJaemBYmSUfC/CzGtdOZ" +
+ "glpafCCzTTeNljGYrTsbK77srM0abuHRsdXENonRVgs/PvuqzvZPJURUwfRVTFTL" +
+ "HP5c+u4dT7LGDtNFEMwhcRariKthqTD1vPM95zBVA62rlBLfaioIouD1obsxmY4/" +
+ "SLbB1fe/WE5wvNs4XW/dM+pCuTReSLHk06DGF0WkGUHXGlrLY4aDxn3fHt8HuzrJ" +
+ "2+aMDPlI78q6bHxj5uF2TCFwbZMGRZ9YDJhIWy5Kgdxy7a9+tDiflePrabvyHDj9" +
+ "YiBjKMXYZIRdTNJHAOT6taIRRhwL6k4WH8MdqdOHDZ5XET0kKmF2Bk/gCivPTwLD" +
+ "D6OnV3Btj6vA6NAoRYdIDZ/GwT5X5/HRth0F6JgMp8aAo/b8aP0dVD3bWzoGD9jA" +
+ "IdGjWJpqFEIwOEjh+nBfY8Pv9ThAfIA+v1W1zDh98+IKpRNs2Kmxah79W223bEUj" +
+ "8FgfYebzbUyGl4S8AJvIixBOhDSmA2GYKhWeUS6ADRDvpmoClc1nZxo2BcF8lMAq" +
+ "GbIksqALJKpZprIel0G/UM0/NROWO2EHdl8baxjfvVc1Dz9VKlRqHhPwoX/hRooL" +
+ "hYtcLETvFJPN1IgE2b15FDZI8kftKHm25vocSMiWe502fv/5wLI7POSTnpHiVNkn" +
+ "KN0f5ylSllDaC8/EnNMn8bMOXdHDBEkioNT/Kpjl5T/FSNstpVTGKjCyZJilljk0" +
+ "WCJtTbKttU1vQ16RREbZJVRVnrJY8VbpfQ4jCfGExUvOtzOch1jTc+c6fhbzdJ+T" +
+ "ZjocHhp7tOTg0hqFHEdpzHf3mFU3tGUGnq9aOgRXwlMPc4oqofnnzkevPke8ocXV" +
+ "cWn5KA/wBIoOBRh4tKPhq0owg6MZB0JF0/BAeEjICzw6dNpJCSLZwqAGV7MVmZlz" +
+ "FW3GuSbWrY1tbz6cEBX5/031t5Xq26tD0eeTKPanZz5maen48Hmfm+rh8R/tsevt" +
+ "95vOVW8muQ0/dwn6qkVSPxsTydUx6UtRVtlfoqMjse8kMZUj0SSye7/KVZXR81mz" +
+ "STUJXk04fITUm7Y+EeH1SIBLCfsshViYpJybG/429HOeflhiyJoizZZJqnHAaUfl" +
+ "IkvOJH3SKlVJFWbJPqT6ux9pskzdwrJy6NBxBPGkSiqK9nE/6yaHtOaOIlPR5ned" +
+ "BwjqrLOVGfdvOzy8zy6OTpB8JJ5O35aTvUnmpOHOTST7q5Tt4SqsKqrKU8ZMLO59" +
+ "VefKuttZmLKmGsVuzxJ4xtmOsbzj7jrHOnDaObg2tvZVLY2bG06W4xJ2PRXowWn6" +
+ "Q2qskgjIGgwGL/Z/7+qho/gPTXh36jmR1w9demMo4Y8k1PnrL5bLq5qtlHMrhcTx" +
+ "qkjHMqVQDGMFtMg0tkKYtmljaZTJIMj9NFIipt2BtNmmpK5MDFVUUwrJvjElbUrM" +
+ "i23kbNn7H7hCiP4ZebpITlFV4hhqmRLE7Z94lSPPmM6+HR5PY6k0ntVq21Nlhixw" +
+ "sJ52ZHpNNQajs6c9vfpv6ZntOE9LGPhh91dhtbjq2MjZvtil0zo6r+jL2H8eLj18" +
+ "yGzWRNcm9I5GokcOjGnDG7SaaFYxVOitW1Wmzf9NOstsnBXsVhrLaczNWymFZQmR" +
+ "BAR4hXFLIMn8tE0KNiGlQnWdm5TOjQdS2GXGiCBhAiR3+IuNtczrWRxLegSYOFQ8" +
+ "aNwQ5pS1bOmZvMuM2Titbss3zVUdd41y8iQI3cC+BYszD3iyYZAxufkk+P8nXHL9" +
+ "uAF6kyiw54eRvOBZOAlO2Jkks3WNzvOHZTF8wXjOnz157FNv8IdeqWn4QqxyMzjd" +
+ "ovNzuHBnGNqB8UypLJspmo/PZrnERR2PqVzauvfqDryP7Z+vQD7IISU+56T4JDTE" +
+ "q+pP9KlpI+PV4dT1ixJrec504hI0p0ainusxoch3Rf1aTnA9yf8ixfufD/nGTaR+" +
+ "r9Yxn56qBqi9vX5hPpZKpLI37GNPZmMfbbfbh2nCcj2D8Z5XfTA5tD/UrkhsSybh" +
+ "P3xy2n8vXr3+fHF+jbhrfffrgpMdwyKsEIABftZxWHn6eRPx3H4XyvkzMnSq9ves" +
+ "52gWBe8WN0R5UW63ukJQWFQ4oKhAJyCJnQEqDppQlchLgECaszI1WAe5g4MUFyh0" +
+ "anCQg4mSNdSo2xtqgYJ+eC6eYyu+bd9QOSufIb1aqsFPuqFWSpbKUpWlKojFKpSj" +
+ "ujZZcdbOTOI0xFWRNkIpGoH4pGFJpP3gr/zxFkAWoqElVYP4Gt/X38U271ZrEysV" +
+ "o23KuyJZatOZ0Kp4TXVYhqbvrZeRB/cPmRH1kRtuErUZW4UhQwwgBj0NR/V3kMY7" +
+ "EobIBcOQukBiqbEGpMmJiq+WZWm2LXZ6qn6+3RY7yG3Jww0zZ0a0T9xZo9U2SMjs" +
+ "PDENqfk7N482T5PLSV+d2a1f1eexrCMfZXsuIkyj/nLJDF6pYr8eHJ6TBVV87tmm" +
+ "a7bz+ky6PN897u1CATUrOcfrYT7WLUnZUkfzoytVKsFSxI3TkSuWTSN9Jpp5QZrw" +
+ "J9vP1+nTbT6eldk/oc3RMOhp4yJZ4IUQxBgmiHJjtlz2GvOHReN9+iGp4Jktksd2" +
+ "Fk4SV2/JatrxIFOH9wap6FtHEfVGhB1sDwiGOwtcvTAgVkF6fh/XVVVUQaOqOQog" +
+ "5PKIzrA2mJiXdzzLWRbIZCyUxgbN2zVNiK1HWZJuqUsH34W6Tk5MbyVmv9jI2aSL" +
+ "I2VKRQpzmQyE8pC1C1EUiox5RWwS9UwZLy63VpJNJfEm63WubJNNHJJO5+RurZhi" +
+ "qlWMUlah+7hqpN26aksmYnEl+2jDzy2sWVaxhxo0sy3GKzqg4dVFnqiH/Afo6ZOB" +
+ "w6/25A/kKKi+ipEIiyL9rIz61tdfOz5b9tOLlSqe0SxNVPNTFk/XTHSxksktjnfv" +
+ "TFaebEYVxUzjImU3vFMtuuFx2WDCnNvkJhZJpZDkrlXW3eZtcuKZcvAedJhwsO8s" +
+ "JvKWfGcuMmSVOdMuPtO5iTO25qE9ntOJ7c8nKZfwxh1UZJbaturhTFgc4VklKumu" +
+ "lWXlu5AcQCTBIkaKGFUrEV2UU/n8/HpxHWKqpiLFVxDTtu0ZLFI6kEKTsGEUPGDF" +
+ "OyKFmi9fCJPgqu54sCIJ6uD6eDlOsdVOSppKzATwfi2t4CPHgfLsRZAITsgfqQ3S" +
+ "VryjsJs6HWRGyuXSEjvQFceInojgi66B/Jn9YGev5OSROQPgpDM311czh5pv7QH1" +
+ "mjYdG88T0Y6lKoky/ahYfzsf2FLP37iw0iHVc4G1T+qGtRbbYqpbLVXmWjUYsWtd" +
+ "3blc3NcosbFotRq1lJaLZLMX+yeAaVGqxZhXrnN4O7p233eKV527HTl3dF67ngUT" +
+ "DIWkYklBhCDIYMo0DsbYvZpkT5KZKN0lGEqTdkzEsUySxKGyAtr23/mYGEIYA2ic" +
+ "NDzgWF6BTisD+sxSj0YjKCGUBhaU0dbAuSAVMAWdJKS0UVTIyJw03tpPFQtSP5Zb" +
+ "pmLpJw4T+ko4c5H5d37d2YZYsw/VekqVFiu6LIkAnOUupHbpVuhXVTePKxVB0bps" +
+ "xhwtW3SVTpJP4oliflH2jl+CLI6HIdidSOtEWxPwTYaOFsTDdMOO9lshLUSxbIu5" +
+ "uldYJIE/CVEfQGnw3KR8rEXXfhMiZYN1TKw6ox209eLH1yz6Qd55slpUwKmJGhpV" +
+ "YEWZi/Z/B+/mfovmdoZ+b+KH47xRdEr1MjJ+9ZGEk8zDzXfoia3VNrVu2HqivcwY" +
+ "3Cn7tM3ujFGxSqYs/dy22jfJLV3mNSTmx6I9vwKifsrmelJXD6zmOk4e/y1x5u6N" +
+ "kaNqieX17yTTwyGtH46H4Fak1c3Kk5z/ZZaK7PU4mLKJZX6ySfl593p1JU4nVzP4" +
+ "uonn80Sf8PxBATaSfrZLZLbUFOifY8b/OQOkPKRJYuHzE80n8kWiVZVKKsiPyj7f" +
+ "1czhH4I6GHur5ngfJsPHxaVDwbH4JEAnRdt8Mbc25sbc26WpK369rsq2Jk7ybJJ7" +
+ "nc7O76eHpxPLzn7OkGqH8mmR+h6xJVRVTckP3rP/RST+xYn6JzHM8ErZP8IJf7oK" +
+ "am6yrFq3COr+Gv1fkE1ZskzBUlfkrr8b8hzk8yxE2fNMfNrmi187J8z+Bmx2Wzuo" +
+ "upumHT834f0K/hL3SkSzQ2U85TkrZYbKMVKVsprfbMMsmUWyWP1W3DVjWss1MNMa" +
+ "H1WP6OTaGllrnZoiAS6ssfNp5sy3o6d+z1Phfsunc9WPbpmXPm3eqbeJ3nCllcoS" +
+ "R9y0sQeiKPWxdMHSL5yAm6DOmnZx9/de80IwLgMAwP8AgoIErJWSGzBhMaRbyCyG" +
+ "/KI3YnIr+zatN5zJm9iJx5FlEPllZszjniMMODP1NDhIdNGSUoDpyr2MFiNFAp7m" +
+ "dhmsM3rn7xcKDPsQKdNOmEcqRWE10Vn0f5jdKeQdD+sX9BD/gPSY95PtG5r5T0HY" +
+ "ruV86045uEMRVSihTsyZa8MesmkTJVlLKqkjBRhG+JG9NNZ4h9alqTnNfxllQNGA" +
+ "0GINwKMDY0ZDqh5V+GFsqw2G6lfuxMZjyPPPVzVO+/y341ul3m+NvxltY2IqNsRY" +
+ "1tTEiANRtZmKiypqJVJKtpSltTk/sPm7/O/dRNKm7YOQYxq6uWOcR7KE3fYnBOUc" +
+ "rZ8tbxGpQnw+T1h+E9UnrJ+6E4e77/fdEqziI7b4QxqWvgPVY2JuUihvCTzqWzax" +
+ "J8k0/ueZNn2cHv/723l7vkvl321HbIYegUM+f6eVz7iFR6+P17uMwF+AHuHwfOrG" +
+ "7J7tnlJLoqxiJZp7OkanzOMm8/JPR9k3N9px0iV2kiN/2MZWOp+Dmehw93hD9FiR" +
+ "9EvPnH5sfKX5VzOWREnZyUU+va6YuauVpl1jSzGGKqpqKIOVA2BEIIMpS3xoVbiJ" +
+ "DZ+4+ep9reEaqbrqJ9X9jOrrvJSr+/C3LCqZIomMTTGl5droWwvUnqT7fVasJ7Q3" +
+ "Vdshbp9jH8pBJ6bD2U+Cd/hZbX9ay6kU8KxTu8ttbZlm1Zpptjy1hjMVabYxkKUR" +
+ "gyjKMrbFpVVpilVWFxd4lsXb8MOW7fVipDJxhwVyRmzTVLLxkzco2dz5NnmsjnxG" +
+ "SQ0xLOUGItVGqYkjaPOd1ixXJ8pvAbHrxPhNAgJ168Kvepi5THZi1Orm5ld4ad8r" +
+ "162e8Lnx2rLKuWUXYSACKn+0Q+UPkiWkUT/jy4+mbc//nw1tlzru26a16nw/ipmj" +
+ "oukAwgMmggdSKdGbGU/Iprgvjn77Ct2WhTTOcy5KZMORZMZRWwQ6QquGZW1JTVlg" +
+ "QmM8osKKGDGMJIGMIBsiwhShSkqxMPy+3NPLDrbgVBbDqzyCBgWZKJrEQiRzR54q" +
+ "wia4gUepCJo2SzrcVXl3bH+sTOvr0qFHlmMYpGEQaiFZjEgQmdarIu7T2kdmRlAF" +
+ "SkKsnConJTZVYwmzOAdnDjWUlQbpLqEmzOttyWq429ehDBlMRRpyaUji5o2uW/LZ" +
+ "8wQgAFSMYB0Wdnuk9X8nH0naSH9JI+g9o2Gzu5nUVw9VrujeRN048OjNoP8LOjhS" +
+ "uG/rTtFPk8g307qhpyc48W4wop6dLpbpG62VarE1XE8iOyVK9ztXvOYw0JoSwJZJ" +
+ "Ftfft+V8JibSreNomUqaifeYC3fJ5fCnZQIMR8DDQUIxtbZGzGjKKNDyRspoqZqZ" +
+ "ossZ6UUDMFZKUgwYwsMaaYqaYrCr66wtypjY2abpVSX/mXeSNkaJPqgQhw2mmMjH" +
+ "EHymdzJLzYsvmuuvVbsqy6m7aYqyZnGoerqj3UePiyIVZIoqKthYOZ6vGFsYpWJz" +
+ "5ns4SY/yi4BSSyktv0dXbf1b1fl9fp9+36YjGvdRRMDFkx6Pp9wzFt1H2f0Y5CMb" +
+ "VjGyUszErxN3k9ks0S1Zk8IeitT1VrI3R37ye53Th502X+9254a+co8o7nMnWdCi" +
+ "wosHYmvktSVSyC6P4FSTb4evj8e+aNQ/gr3by2tmlU3bI5CjjaesCuuOTInFMxR6" +
+ "BGGiWW1NjQqsYxKUlU0qtak2QF9FdGkKOPTjiqoqd6H0PuA+KaOAwX65yfbt0Uu2" +
+ "t+9+OvxwswtdK+Z6T46z9ur6JavYqrVySsYUxinbay2mTZRVK1bWMy8Hm/TRaetZ" +
+ "W+L6HJ1GI7KbTEnokj3nzVNViyloqqryY4aU20msYtW5mTfBtWDH/fMFA6MUxGMR" +
+ "NFAuSNrZk1GrtLMg2RpFCqVUaUsYRZMiN2Nim9bnyPI1L5d7amo7nk142ZMm73SJ" +
+ "/eoPU902bpY5T5yQ6ffJkrLbKvs844reynK6fNsroOIGSOqTdhDZO0IlkpYiq6Oz" +
+ "Fkc0U/fPTYvU9bxWXZeLi5F902sZZU2ysGSmlVu0qcXTGyX5KS21VKrYw87pVnOc" +
+ "iN204sTwOM8R5cJLXpE8sT3gdCaTqejSJPFnanubqkqvQ5+EkEjrFki/syRPSKqx" +
+ "ixHNf1x69+Xp6t6l5LGF8d0xI7umlRgxkIYgsKQGahBGMdwkbbIclCjg2oW00iZA" +
+ "hDSVAoDGhqhIDTC4UGjDNVSwINaWT7/c+6B936RGV91beaH+tFpClUqVar6a57xS" +
+ "1YsdOxwxj98iTq3teHw5yT2NnV6Ms+s+NR8b24bKw/NWKKqqZhiqnM8QftpfQb+C" +
+ "Vs3lZLSSASqcfM7yVxGYledbnrN50XJBATYaCsBtFYJlZR2SKwb21+jqRiNFI0Sa" +
+ "rSjgiATZnWelW7O0mbziCfju7ylzo7WSqylsYp0JpjJU0qaMlJUUVhGilWTZudCx" +
+ "M+kc+l5uTSG84qLYv2ZJMli2qrILI2Tqln4cMqNhAj4gogAncslWOiwaV+BwnPnE" +
+ "jdp7E6UlqPtYJYV9Tg3WI95FkO6beZO8nlbeyYVc7od2tLylZPKLTp1I35t2iLsk" +
+ "ipSBQqtbUX19H2kWD8z2PyVPmh9rLUcrDSKQsTJIfukqY7Hl5DzdPLdUqq1+LJp5" +
+ "emzvHWPLN9YtWeh+2WzylkbFNlTCyVWKZpKyQ4YwqnWq3kKzCwje4lWdzTuDbTZx" +
+ "x4bJ8tzHGu7m3prWSakaVZncMwY02dcu7kznctvM5MknBXCmwVtKfU0xWphkowpi" +
+ "VsxiVW7I2rWqtRhwpcXDoaZN1MN6tYlKrh3GpWUlJLvXd43OuslSWQ0fVcxqeL+B" +
+ "Xv1rpQyBqdm7e1Ra8loulyubVzbXOGoNVpN1/mjcbxaAiUP6xnhT7z2IJaTCQVgt" +
+ "DpQcGFJgWSBTA5batqKV5l3ruu7XC3NyZRFeT486vWm68lRqMyRNpSzSpsi1KyzL" +
+ "GmTS2azSVMZqtq2bay1a0raVmmyq2yqikIVCwBSIqSpJJKsVBYgSKsBLSopRkS2t" +
+ "tKmrVKmA1rSpZU2JTWWSGtUtmsrMWKVLLVRCkSkEqQS0GpKlKZllNtK0WFGTNpZY" +
+ "2lmmZKZLbWbabW0ttZTSTFMklmzbbTaajUNZaVNKzWaipYqKmU2mMk2lilaVplhZ" +
+ "MykpmlSwamzZsrUtUJCNs2xE2zWbLJpmmmlSyzaYzNqWpssspZTaqtm1VbJlmm01" +
+ "kzUtDKks1LIK020pKUpNRlKTSlmUprKzRSmk1NTZZJrNhJIZMlSpNJDMktbNVDEs" +
+ "mpKFKVJtllm0ps2WzabGsbM2aQtmsJaMkNaVJmssNbZtbMprNYqWVKlaTUapJmGz" +
+ "RClCZhpmEmZpEympqWZmWbRs0SaY0lNTU2lqbLNtts1tsrNtKqSWmGWWW0tZrNiG" +
+ "Uy2ylLU2jJWUySmlNmpspWFKJrTVkE1lJmakWTZmUtpS0rKyqpVsilmsNrWWbLMq" +
+ "aVLFlNmazabZtNppoZJEkxlJIlplYbNUMaaVKhIUylmxaWkEslm2WoAZmYGmm02k" +
+ "mZ9vNcym/zYZ1m/E+UySfg39LUVVWb+0CAnu+IVnzkTYexs7ufDm0VjDZ7mmLPDC" +
+ "jvRkCK4NH4KYIPfTEsxAJVJTCY4MNNqKqTgrJkmjRkVkyN9MMuNskxW0mmjTSlSs" +
+ "RiUzxDKZmvWVXm9Y8a6VLqbbWXtSMLsZGTNoSqYkyYjI2VEskoLRRUbRRsbWkqSt" +
+ "Sau0WgopMsq6V0SZehQ82kyxbJsqq2k6xbaqqpy8chxElkKVybMPBqa1jIGLJqNa" +
+ "WSNnw5w5rJRVJ8pXQahwWUzyp0wnz/U0hIEiEYfzEVFZGtr8GqLFqNUUa0pVZVFV" +
+ "lLVsEy7VF1qILVeGEk2aS+WJki7F2pqD7InRyG/WjNbxTzY7E029eTdr/1ZJlhzx" +
+ "xZEk7TYxZI2Vk4yI8WLZEUcfOpyzjm2I50sicpFjzHRZKelYLMxipnrpolbK2wP3" +
+ "Gj5QrZ3mE7dW70dJN3aTWPvGzFnLOYscQkecNk/KdSbVattW/g8tatRJ9BbaVmTU" +
+ "cNkbE5NiRgCjqJjBFYYMQEpXT39BIxlLWwvLhFGpGWUqKViqxkcZkznhqQLSNrGQ" +
+ "hBUdGYxN2kbWNpAzdTVXSs46S3TNK5yd26mxXO7tXNdm0m6bRbSTJvK6rpKW2TFt" +
+ "vPLvJbNaSixoxKyEmNk0kWK0SdjZs2NohYnAsejhFowruXCQlUVFqVGpE0UGZIZE" +
+ "c3lktTo03a6N+EiflSdFScJJ0xKRxN5+ZDlCLZB9FWySZUtkhL9OWNS5Kx7HmGk3" +
+ "Zm+vn/kuSquatyCwYtGGhIxpQKVBh9sws7qnJ2thu+NtlbJbljpdXFmFp6I0cN3V" +
+ "hW7RqTNacWNJ80k/pbIVr82CR/iVzKp1fJPyjz7u0PGnOl53LbDvYakR0ZJD8qm5" +
+ "9mWLpEWRzhu+1n9OUKT1kn8VOh3p4lv5ZjCqf3P82pWjKmxUzVvxpOH8eDZPhDwf" +
+ "ii4JZZPcJ67Ts94+JJ8JN6n2RXJ/iPpDEN5uehqR3Yxju2bXbGDrRv6T0R5vdxJO" +
+ "R2mD+4dUjVjZFQf6RFZJ8rFskqu7VMy3EjDuzE2K5wH1nnG971lZjE1GMMpMLzVo" +
+ "tmMJoN2gv8yApnCpgihcVoiUFH+c9nnbz+momOTD2WTT5sRko0skZYttki1bLSVY" +
+ "mmMY0wqhWnGhdSllSSW9z4amEW8VfPq+6qyaeu2jZNvXtEl6ptryvUoxwqtXN1Fm" +
+ "Yqyc7Jqlsb2TXkulki/galjcAwqxIxJEkIZjxWvohjDLbjDg3VHCdKtlCUmTvHq1" +
+ "g1bKsb1nufaqpD0uQWNon9Cdrrb3LTMlSbUTSbK0ohajIvgjH+99Bt8p3n6qleSV" +
+ "ZE6o9h2eHZRzpwc3OYmK009E9R328jxMbJvFH6StQnM1NNmLDBWdD/DwdQc+bD7v" +
+ "Uoz8D4pQaY3jgmo4UpCiqrGzZpNbC5h/TXGpNqn1Vaok4ZPk4KphiwyWJy5ZHRwf" +
+ "oiZC34h6SrVlWif7FRHs1+Nuh+L5Hs6k7WWyNKyald2mpMaNp8+jr5z3H5HpDpU/" +
+ "yqPXPAk91O6UFo2PK2u5jy7lWy35Kw+iPIqfOySOpNDJ1k4nqsilXhkeZbW8c56z" +
+ "Rx1kbkR1nBpJ1VUPWotkR0rdsQsexSuL+5pk+Mk2l/i7Oi6XGwkvE5JyD6Ifc0l8" +
+ "iIBO6c0DixXt8Wk0H6+6WxFliWWWhO5P1UUsfx/o/JZJ9iprtPkmjEsfWdqnbtat" +
+ "q24OckqqqnQw+6k7EfBZHMentbUafUcOiqVVVYFUlFKKqejEY6Y+lfo+ubdLJdCu" +
+ "RFXLgVQwrGW3GIYJWGCYwwtWWlUskYxZ+emKaZHyQfWMWTUkP9FV7wTx+WRVUrZI" +
+ "0/KPlYWlUqaINRpIxmMlMfoeftr+7+JP2H69M/jD8xaKRKgSrdibLHI0VxjbdHGN" +
+ "jQd0aMDA0QIQWEpTRDGZrq3R00OH8GFjuAD9iwhU2MP6wiGD+jp0Ymd06Ksv5piO" +
+ "Uq1rMkwZkiw2SmZIUHD5pP5P1qcNmkgD9vum0hi+X4S/PJ3/mfi9rbspyye2Fk1Y" +
+ "tSqo+5O33q0nAeTHbg7lc2zBxS2K2xjL/dLmkWZGHQNxp9NkyrGxuvp9akHp3+A3" +
+ "ROSdXUb1air5yyvdI8km6PrIgEskaR1ceOmv5q4dpNp4dofKup3NzUTxsvxlZbZ/" +
+ "V7KshwsVcSqwxapT6487uYnOE9IdPT5DshyR8GTg8yZIxO7D2Xoe8wbPD2vkrki1" +
+ "J6oe6xXDYppjTbDezUkdjZXVjE75bVWXRUdldu05D4OvVbD8SxVZLZ009nJEkSTN" +
+ "7Y8kpPWH5pUvT49iIMA9AfIDJEZQpYI0oY5HlZOHxMMSe9WuihVMpamSnEH4RE9Z" +
+ "aWlkKsWrVSPdFT2zJGJOHBVlVUrpTJRywuMlV0T9myzARkClqiJX70kgpcYzsakR" +
+ "kiRXw/k/H9sfrouz/j/oVDN7/u1hxCRIRZULOfq+KvHsxm1M2jkhY7WeUc1j/ARD" +
+ "X9g55b0y0OAkCC5cP+IWkuBkJyInN3reK6uz5oJ3cmh5kk5SOROSWbV3cz6GtQbZ" +
+ "KFKWuNFtiyrDpfLMzGSYWFVpVVZYebEEsBqBXBsjMbarG2x/fZQ+jLYbHHqNwzdK" +
+ "EarMZjYxuuOPbI9sySN6HDIRKMbSRBlKUoJjSMbaV15eryvBqvJXDYi8l107GrKu" +
+ "rrePql/G999PfuvQQNubc1orFGJnz9/3e/n38NvhXHdrlX0hVyULe2vF4tSELMby" +
+ "nXaVdIyzVzptzbpG0kYyrYmUstRUilMV6qhiUaXUqU2t22sqVUgIrrtLQ1QdExSK" +
+ "lSKNIKNDYBCEhONtcvec081daISsVrnNwhsmVFh9UnkeSpU/Ucu0cHJG1Tws6MbG" +
+ "5/FVq2qhSlIpMbqkdPrfnJsRP5LJP3kl8j+YotqNDkj+2rYWxbJPER5OzzamSJYm" +
+ "ofxdXtOqPt84dU9J+/4gPBe8BUHiJMP6uXrNpwqwttVSaxGF+jEifCpFfxSkr9mc" +
+ "32c3S3Szbd2ZoiFIb5ZGYtnEkdJ+Try/CPL9Mi5mMdh+Ug/lZFsslk+ZJ6Es33Tm" +
+ "ZHKzR+qo+jHqk0bPR7vVXJrn+XaeaslpRZLB6fWTy0fm4NJO9fzVkjpKW2+cmMea" +
+ "KKivw3yNm0nsxo0qY/JPx9o926TeJg2Itr4mV3UibG6zyzGVVRZRZzUmJYrYjeJP" +
+ "tG57vdmClZ7rv1y8228aKmVl6+qvZfKRcLOG6ldOqd/Vu6vnzdTvHSaWdJCUkjhk" +
+ "kn7Gk+eiZHzRJjshqSwqyDyZ80X6SPqx722PQanWebyOhb9n7djstjZ4dY2OQxL8" +
+ "hdS7hgfQ+5CDkj7o7K4g5yNpyOpPqRywlpQRSDKSubGQjFYyaHIAwiqRam0sMSLC" +
+ "sJviL0yJ2OkeKEslhZYLLIdXuqTrJIqKaZP1acJCcH4eh1+kfB93b1WTnIpa+SDt" +
+ "JnSUSfEhNliaKTnK6bk2NUtOpwxwxVUbNmx5x8lIqppySP7fkeJPkfA/GZNlaB85" +
+ "U/xOGz7nG7VxLbFvOJRc267dY5TS32y82q967Sok5Aw3FStphVLMYoq5nJ05S7XG" +
+ "3bTWXLtislaIjwcKpUlVZ5bNl3MjhW/1ibOUVX6bGO9ltr3qNM4ZOuTmdlJHaTrd" +
+ "opbJmZI0WRqsr4Q/tfrZ3oi2RVBaIqi1MzEkmVJ0pnG2r43k6qGCL9Kkpczv4SeP" +
+ "sFeTIEBc3DtAZcH6XxGW7Yaw+DznoSqyrouIMcMHbjD/FBny/X179rvtjikQCcgQ" +
+ "E4HS222zVI+KD/aP1IS0pJSBYzn2USdPSTTu868arlGQodZ/tyxVyU5RrlBdEqjR" +
+ "+4KCHQDi6aQjlScf+T5kjee1Xoxo/SOOyTCd1xDlX+YN/MVvtOj2tXZXckMqqZHZ" +
+ "EKEQlkdnL7Jdydlgmev89uU78j5cSJ/l8dkmE7rhzD8qadHMH4jZj3nDGPdwajh7" +
+ "sMdnVu5ujXXl+T1/u4LOHgw0+z8FGBY2M89iIokYQvh0gpDsMgXC5N6MMVWqIDKF" +
+ "k7Bhi7LCa12ZnoYVi5gcGP9X5TyVn5jjpmK38e0H0yNy9sy6krJx2NyXEkufYjPY" +
+ "35HJdzHaIWeWpGch1C2GpaeIIyAyJiVK/Gotmvs6vH4XixysdNfO67ZuafPse3Xt" +
+ "czmeH1mHV6i2qvNHrsuyeFJj1OGjd4Zq4YLjGTExlUsVV/xcbG0nNuxlxTLllUUB" +
+ "hE0vYrX0AxuvoyLWYktLUDBX8H5cYsLkOfeXyz9A4QbZ7J00FTnG94VNve5NkYen" +
+ "LptnR61av5SHOPZVdEI2fk5/k3VxOX5PckzZv1ec8TchyRzOOqs5zOUkm0wWPJVW" +
+ "TC1sxMVVTWOfpWxnsx/JmyBRsFWNsiIqoVUFReZrK80s5jqpOqvOS43zEuyOx1cp" +
+ "0Y8OhOW7ME8lk6LCeFLjEsFSqpSyelXJhXAcdpsp0Y6/OqpWhUMVm2xjyTgU6nrw" +
+ "6yszFUttktLZVtnXi3kuDRtDz/sJ5OxXV22LVZKMYxihA2Q/Dq/NjZ+535t7PF0a" +
+ "3E6sM0t90PBzJHT5SRrz+MtSHquWXGSMc07ChTvJ7sjSm49U8JK0NlKrXIMbnnPC" +
+ "0qUqjU5Jxyt7ynN5e/kM7y2YxjGrVeTE5xqbVT8LiY6bpo+ZdRG82/fr1m22xZSB" +
+ "38PxIyNMShQiH6G9hXLOZK6w3N5+X72HFAxu5NSfRpW6afRXqo8VJGH9x5ObPuVJ" +
+ "QLAiFlH6/u/FbMJ3EnnDq7T0En449m8JHNPxcyzXSV7BCP9JENSIjTahAiKfMpQX" +
+ "fhvwg6xjTyfA09UakjGjZSMkcm0k69uDQkz5aTWCW2iz7hlcSciTjD3IoFZBYmNt" +
+ "odoFMMIkDWQjASGk0NA76DcIySAGLYwAZPQkVbS9raOCXx0N4NPJAcpTE24YEIYy" +
+ "g7CfLWmi2E1TDcjdkTMXE0qKsqvYI1Rc1zUWKjBt3dZMYLSc1V8teNrSwW867u67" +
+ "u3XWz3uiTDJ7uup6aktGEa9d1hTNubvV2q883d3IoqVnZHRyRZT547K2nlbs57pm" +
+ "7cLQoYwF2iZPBBH+5LQ7dYkkhI6u5sNK9nPxux2bnayrYrkTq+u7erJbBUNziMaP" +
+ "rppVcY3SxyySyySfFXkjZSuA61FVMKi5jFHB+UxNKWOqcRzfOSQki42nkQs97JyK" +
+ "5amm58SFk3LVSU0uj7SQfqwEfho1r92H6uG22K2lVz+Uf5sqP0dLN/GejmK0sxrP" +
+ "xz1m2/05yx4ONjCbJH9A+8QkhIqoJKiRIQWkkRKAK20HGfR9lFGh2vmzMyyCig/w" +
+ "mlAinByNccszHu826vNs08OjdXU3GzSpwG2/sZ6SHoyTSVw0slcGjSBnq4UMw08I" +
+ "tvw4uHqDA/w6OSCRnyIh/MH46rxmTFxdHacVc+uD3HvflqHvL7RI7e5edJqb4ZU4" +
+ "09uYztwe+W/IpAaOoyLcwQVPk3k69Fffn6zXZ3kION0cYOXDuS+3vzTOm/K7Mq6H" +
+ "OlZUd7Pxxdl9t69NorsK6eU6442+am88vu73UsgRoV5Z211tTDr33RPyM6/XfL5U" +
+ "EDhtlOMGIOhqVFDMLDExeDQGHON0fZdtpnTpZ6cD6JBkGJpUx0Y0WuppUjCvDGzH" +
+ "Jsmjd0VyNNnRZ1Y1MNHaMbOGzcp3VttssZwsk0gsTGWj6gLXG8FJpoGGjp6NmZZI" +
+ "mQYvcYoaIEFW2vkM2ui4SWaSMLtv6RnW2Q1A4FIHgMRpRK4eNjfwZ5oqGaaSMo5b" +
+ "dknhw4SbOELPGyXLyqGoGSSqSomY1HBBVkQqys9MCWL1YjTEvrT/lW/HvnSpG2HG" +
+ "W0YwPtoufZQEsPWkFdi4q6Bs3tkoppX5Eiaqo5JX1UtH2/gzrxnmXNzE5gfF8iGh" +
+ "wMagId9OeGfjPxGKTtKHVVJ7vT6eMIaVB+wH3n3+jxV4Svh6l0hS2vo/Hxp46W8T" +
+ "mStcsHMrio8lNypolKYqrT5AyFDChtZGHuINKBspBGKg7kJt6Bo8fNBswFHISJJt" +
+ "PcLdHk1+NWshZCgqnMZITrDX2VnDFGhCe+9um2kaWy3BLFDrBte5ISqMa3whRNX2" +
+ "hdsSnCgdmnJiwaaFmqxgEhoSkmS4W5nnc2pOkjMCi0Pn4WGjUumeTCfLJJ1jYrHx" +
+ "jaFRrCj5qXWxkTinm7fk9Hu2JvELPk8MMVKpWKtKq1iVVKKUxXlx31G9Tw/vO6Mb" +
+ "E80lYmSJp0FRrDJyLJ51U9ZI6GiLTUsTlnZqBqxHcOldSSip2iosJI2Ehx0kHxDZ" +
+ "/AZNzYUGDTXrMplachkVuS1tsiYIYyt2mzZDErJJWTTEalrQplZC7YM+li2SUoxV" +
+ "VZY0yZkycNIiDcCJMaGNe5kXBpN+8HIUgoKqYnY1JISR6tshCE6JhknVjg6cMhWn" +
+ "JNlbSdppsotV9zG202HYjiEnmTz+E7xXhSrLv5ZtdazVbW2hjEYNKDGEBkJ9/vy+" +
+ "vnrFURs1YvpvLuyE245w0VLL1kr7cOg/Ba/Qf0QM8JPxZLLOStL5KZ+faXr7LE9j" +
+ "17oH4+OiR8orIu4h/RAagtxGICYpOWtBCN8eXMu7rl485VKQmKi+aU6rwbyfLXpr" +
+ "161+qbettfqWN0pL88tJbgpKWur4a8ki2arIszGhZJVK03h6o84nieE+RSDA2EJn" +
+ "ygppzrRHjjDHHjQ3oAGNIa0QIJjBiGd8s3glSnsMZSEY1I4BqCBOrFtgXZ7YoGff" +
+ "5SOeYkWToVOR6a7/Dmyl7pPebOTUlLEYebR5Ikzr5O+azEJXRy731dGOXtcW5mTx" +
+ "HG7GnHVxIbSbnuyUslYdMltVhpO7tytjo3Cx2IyGZDKmmWOxCaYRisSq0VhSVpit" +
+ "JWkrS3VY0DcaigxKkRFVBNRkkg1UhOMurldw8knJjznZobpJOCnNMtmM9JI/gses" +
+ "Dl0es/T0c4b+aSO5yy8it57PtER7yQ49svq6K2KoqVhjFUqmm02P9rP+enbyTaJy" +
+ "k7zyB5VdEyRHyqE2jlT/N+4jPJHNVfOPajFtvo+bRIhxDIiAREIBEBHmAseJvCKp" +
+ "aWSr3OREAnaST8LJp9TClbcGN022eOxs0mObY5x+f0+u0ck5RKKUopJrgB87bebv" +
+ "yv5u7W3q/fvzQ+JGypskPUreRLIrmybatMsX0a/RksaxtIKIX8sn739qsebzOZiG" +
+ "by7s3vdaJR6Dj2macG0WSRT7SDN9KC4xmGSRgRYwaf7MbwGIOPrP6Rb8N/DY1I1H" +
+ "JIkrMaQbxJHdIbifDkh15l2d27BHRHVPKch+6RBzeUnBMtctc4pKUyuu2upJrlrq" +
+ "667pW6+1t+6Vk20JkkpYV59A5unxbofu3vn21Ey/s+HYx9zasPu1JNm5an1x85Hp" +
+ "GG1LFk0RAJ1kfSK+E9UPntJMsjrKWnc/YuFg5pe8Oyx5qIpZEbwKh7e7yTBhymws" +
+ "JtGzb8PDzkfvPfLZJ5yR/o9pH2H9KqdtVVX7VbbWI2Nmr22lllliKehVTXVI09Cd" +
+ "Z/Ou/e1aKs8lfvPiSD3/Bks8PeYcuVmGgTKW2WyVY/isZRxJN2T4vyfP0vRyfZZK" +
+ "rbaZNZsTidKX8ofEcnunxzNEJWu9xbuQ3w1er3T4Y3g7/gteJ4WVbTtmn85O7lJ/" +
+ "VEnkTJ9atqsYYYeujDUxIwoxR56sknNj7SbuGneRs8nq4fJO2cpuiWKioslVKlRS" +
+ "pJZ/ULtdlKi0b+Z81+yixKtJIPDdvJ+LvDu0SyY/h7/w/FiNs+mias1cSpOznIPK" +
+ "yrHt1CY942YTzH+yrZIoqhOEiZIT845d3T6Pps/6Ofl4bEm9vIZB/UJBbEtgRgyB" +
+ "QrgTP96/o80lj8FrpZ3WuiX6brraSSqxRuxjTFUbWarrGGKMDbBcSioFSqf3ZLaC" +
+ "XBlKqfB9CZLWcmutdlVXXxEzqHZVo2a5uZjrbE5X5CvSKi2WpbDaOR0OqaV2Vjxq" +
+ "myEND13YGGgTBqRBqAkgipVktsk1bJm28lu2ll5dkUpklpVLKkqjThs7SaJqeWRG" +
+ "VasWSxZLZu4aIgE5GtmzUkyWRexTG+WO1qi40I7X+GXLi6g1d5IU5Kydn5ZoeE4k" +
+ "iNK7HJJHZ32hk/RzVTRzKwrOelrcXxZCb6V8ambb6i+3z7g8vV7o2qRK3bNfx+d9" +
+ "az5ZypWyvNOJkq2zTDGW3I2kxsrRVg0qaU6NmxvJVssZPf5Ch3jJZiNskkJC5thW" +
+ "jziKca5yYTlK0RAJy2l5f1mHrY2Dc6OkI2TTTy2TGVsRATPxGssjZRlnpIg3iSRi" +
+ "xI5OR2SOZJPl5/ncvR8vln1Y/uaaeTGFSl5VO11Z1vnvja5W9Kw09ahkgtDDYyAY" +
+ "Qw/WRKMp5aFVusKrZpjSKdZ3v58tazxmJb6NXQlD2AabBtG1MLD6P6xKQChW0XsB" +
+ "77Y5z/JBkkMXpKgXiWquYcP3Pv6+I4oBI7HediIrxI/Ei95EsFOQPxkk78pP8rbI" +
+ "tJ+v+lu6eiHk6+Kqz+L5PSR4npITj7fgsgl+q1VWGLPweJJjUnC/Grtc/J2G01ZT" +
+ "LW5ObQ+bnkr8xJ/5P/vSSP+C1jG1YK0Y1sao1qoiqxtFbG1bFRtUa1sVo1trGrG1" +
+ "RZKNo0UFSilTNtRtGjYIEClGbbBQhUJBpCDY1o0bFbGCxY1MoNG2zTaLUEKzFBMN" +
+ "tUbFY2iqKIjEUlZKixqNsW0UY22i2g0agirFbYrFtJiNJbSao1sWMUUUUbWNslpL" +
+ "WNjajFopFMhJGxRRttjbBtYNtoo0YrRqAKKLUkmqi2sSVY2oNFaNotsVoyQVaNGo" +
+ "o2ooqxaNUUbFQoYQ1o1WLUG2xVgybYtGtFRgmVk1iqZFQlJrG1sbWTajRaLFaTUU" +
+ "VRtSW0bVFWxasFWIsVosatiqii1GLaNaNGpINqg2jVoihmxFti2DGqiqNFrFslti" +
+ "qMZJm2sYTbGLaiKiNYrRRGsbWLbQWoi0WNGo21irG2RMpRo1GK2Koo1ii1i22C1i" +
+ "1RqA2o2jbRRjWi1jatG0lUBWzNUWo2xpRTRVG1G1Ftii2pLWTahQqKi1otitJqNU" +
+ "lGjJNKqI0Rq2i2yaxjbRqMUVYjQaKwVRtFjWiCyFiKsRbUWiosmsaiqjY22iqLQb" +
+ "X5/99f4p/uUf0tf5/9K/qseg/3/8O3Ejr31kY1gc5A1pvXCxCkNiwvOQZYLITeUx" +
+ "5CNobGwqJ5o3bWtQ2oqajkZRrRj1prYW5TG2RkzhxibIud1zezbDrRBn8s2xsbHZ" +
+ "Ilaaujw873Rttris4cJCx42DgiHZM67LEm5mczQU0zdbGxtvENm4RY8axrs0rvvB" +
+ "2Lmhu9ZH1rnXlfnhQMwstTWMgZ24VXZJdzdKmphdlKOvHF5Ypc1co3WpPG5UchDH" +
+ "HthGXu6jHcIFa8oQrWt53ErY2jQyDFGQGaaj15BbvaLTDPKU2xY9Mj2zrW2Hba2J" +
+ "jEwZb1mshmPWcZdXPGGDOQ4hqWsZbxqyLQ6ysx+Pu9UmOHJEyavWvHjbPPnsX1XI" +
+ "iq+W3w8Tu+Ry16Js2+QVNGKUjZLWwXGBxtiE2hFTSXGBGkBjMu6xtIYNFQM1yBbp" +
+ "9u0ksTStorHkolJ3E5XN5tOFjhjhwmVcOxEtLHxyyr7N9lk1DJaN0qwpiCBpBAPG" +
+ "3V0ccPvd0Avs82rSKmAnj7RQAdYSdYbzJjI4URnJfO3TT4xQ26ahpseRDUtS+MKb" +
+ "aVjQ9wg3lnedmecmuQV2y44ptKaHyuZcF1u1JXKJlu6pRPSTudsbp5qixXfWcnpx" +
+ "PboouIu6q3vjI6ci2PuVosvF0bH3kaaLyFWNsiaLGxxWqGnvHH4d8MyQpjfcyGZA" +
+ "6+PHVbTd22SxshNhjBvMiBiocsG2M5zFRj1yyQh5C7vZX53zDy85X19hw6XAhSc4" +
+ "4HRB2w2Jzqalk90qqeRM9JrLjIlc2+tvhMyT2eUuq4MdumMqyCenJRHTk1OZudfS" +
+ "+VfKOcyA5HHezeQrJxq2piOM5vIJjY0fYvMt9eOLt3WsvDtG97S85zOs8DAjs7dX" +
+ "vmFFxB5l4hvFFWKjG6TIUmyWmMme3cQzNyatha2CUx7UUluGUDYW7GzYGPvUZVUN" +
+ "2QruGNDbQ2NtNsoEDGs5S4Sw7tuXObFDTJmQpdzuUSm7gDGi7IElwyNbNWUW5apw" +
+ "r1xMC2oS5tUYZA2cHGiAzve7XardJ2IuYysvZR0Ku5Ck+2RL65bzSHlFlxDxNMK5" +
+ "TWUzcfeFomjrOXGkuCogWNpZb5Tmyes2YdxqRBmU6GoIV0TPJNojDDaqLiTC92lI" +
+ "44VORRdd7f/n2zez072fHsVc0lJBrBTJO0dTCCHBnnJ7l4TDb0xvuQrWjqhowcNm" +
+ "KETZaeWn2MKO9JNMjipkZF31GWlSxcYpJydb5hSnINMGPuEOnRLL4UV1hvIPGKBl" +
+ "ZvS4ydl0W3uRzvMAxgqY2gIYc5EjKevtHG5vkRZfTi704pm64VOlm9mnddnhX1d8" +
+ "i11nlLfO43hvIUvkhnaDTed1UYzb4SQy8iOZJY0OXGtwdkbrl6UMLqQoOxj6wqcm" +
+ "67PRzUcwOOdgLJgvlpWuyLe1MNGlSR9cdZItEm9xaWRy5l21raQcOMenbGPjUtId" +
+ "5L5rfXWQr2NbGd5BXI6+tVcA2rcJgTsa6HJhyR9JZrTaSuTN7tG94c7fN54bJ5gK" +
+ "AteSmybgHEB3lSGHTGcmecrPGjWNw+WA2uNR0erioM73usN6veTkgxmQtzC+7W1C" +
+ "52SQlmXcODt80oUQQutphmedzHoa0Pb5uGiUik1kXE7ZGybH16ydOZNOpe5Sgesh" +
+ "jsIhgWSTnObvd7JYyX1O5WwQQTtFWii2tYujUsWbw0ezmrTNw5aVPbIMBpLsctzL" +
+ "3e82boiMG5yOnOmm8fMsldyWw025uHyFFYaQ8uhZTsWKiNp8JA35OM6ztkc5IRzb" +
+ "yi5eshOO7RfQUENxDrF3qvnKutTq2OI2Axlgzi73va5to5kVtHbQ7Y32Dd1k3HCj" +
+ "LIPSN73VuOclVLYXpmseBJzbNvLSDWByI7kReScm2jiac6ztXZGkbaiCAyO2QzIX" +
+ "Td7J06xss3ieAXL4jMoKMHsszhnY2tu+PYncmERURzYjb7rVmXU5FSXuzzzvke8r" +
+ "flq8UMwGzmKayKZkWIVa8gdUzJzlgqDkEC5XJt6MpysuebzMk5crS96OkqQR3Dkz" +
+ "ElgmcLoCwfLTbkIR3GXy81m+S4PlrND69sIGpuN6O4g2ktmwgkuHKu9wyznIiYqH" +
+ "xh287t87BEPFkERt85JvWK2OrjtJEX2u3Obs84debd0rw7zdeXMFzOZDJ3NvLmvO" +
+ "W98l52eec8Ovx3URCkNEx+BY1uglDVhy3y0UPJcKyiDZjGbewQ+bM3Edm6FJOvzz" +
+ "azuclkGaGMcYNlfJEmxcZb4M0d5vObBOO3PN5hD0onSZ5O7GGzFbRbOZzlE2Rhka" +
+ "wphx0zrlixjRccimW65Ok1uZQ8tkA7rSLGbUGzJIZew32hAFkPnNVhE9MqWiOw47" +
+ "zozjty6kNk1N83UI0ZAZmzwzHu5NUqQyQow0vktdqtUDtNuQOWVDBrlBzZMzs4tf" +
+ "bbgLjvOVlw1POknTok9nX1y1i108eGb3lqIbyXdFm5ZQ1N1rdRtQsbwYcJmHBeXW" +
+ "2qMDeacg55NcqOxlx5mVneeFYjRYeJ0ckbFCkO9HPGh6Uz0YirAec3cAaT2SN9TI" +
+ "dhI4eu6xRjeuwlnHtcd9I6I7mnNQujxohaKtvuAQd6d17CIoMjnTcYTJ0gzDnLog" +
+ "y87zLa4RIWrjb3QJV4OaRG3hmhxMjBaozkkzdTcUbRtJzGncsju30dDubirvs7xZ" +
+ "JuXdqYd7zsWQFdt5eUcWbvOEb3hdO1zObnI7UeWd7m7t8zw5eWdMmpq9lvkl1O2s" +
+ "33XNPfK3sTSyZwcbL7OVx6ZFd7y47nYjGcfOl5WUbFK6jGO85fdlu+Oj//MUFZJl" +
+ "NZf1tARwa8BV+AQDgQB3/wP+ffir////pgsXwAAAAAAAAAAAADkAFvAB9CgCqKvh" +
+ "wIIRClJBQGt931KcB7ue29fOM4xl8OCCgCOsAD4gAMCCqAgigO4wANPNs0ABQWrw" +
+ "W94D7vhh57CBAWsPbK21bY1p2NSlc29vnvroj5VJCRUilcbPtq+nc7762bq+rYxo" +
+ "GIRFFTW+199fPB8oqqVSlUqJfA6522q9YIUQr2e0dTolBEUApKpKdxdyiq9PcxXp" +
+ "pT7XA1zw2DoUqJQtbhzOqiUFUEnrTwsJplFOzKlPLNubxmlvLabHh70vPbs9VSlU" +
+ "C2aInZnWUtKa6kV06iV7xWDfctwDvZfbVSHSMzex1T1Xu3dbtgdcgV00eRqTtivM" +
+ "xlkDWp3c5VXc0tLhitmrNiVChF12zldtJ3W27okKoCs8t8djvZ9jdAPWi0r3HoNJ" +
+ "bs1XKl3dVs7jAPbHmZ03gFeUl02d2aYcR6bmqg6173G4GXhqegQBAgTQSUPUEGEP" +
+ "UZGTAA1PCCSJVT9owqPVMeqfiQAIxGJkYAEmkSIQjRRphCT1GTygAPU9TTTEACT1" +
+ "SkiFPIj1MSaNAAAAAAAApSICIoiTMqepgUaeyoaaAaMgBiBUSIIIgRoEJkmqaek2" +
+ "po0BkZAPU+d9mfOtn2399/UaZITRTREBAJMILEUSZiSKkYAEmGm0IokQKAYlDGAS" +
+ "ykCCmWJBQBpkaKQLBIiZhJpSzJEhDTRCEkUETEKMxQRSIxiaGQREwxpZEg0KYgAa" +
+ "EkAGJGE0ilIIhQZFLKTCMSQMkBYoRIUkFIkmkQMZhGYyJkQwIUUkTQwJslEQk0IA" +
+ "pAEEkJCIRQLAGUhJM0NCzNDKbFlk0QYEaSCihZRNABJhCZRFKJFkxIKRmDJEZZSi" +
+ "mhJRNkEjGUIIIGFMpgaQMaSRjJEYTCYoGlEQpmzGZLISlRlCGEIIyYMaZKkpiCNI" +
+ "jIURTTTGkmkaGUWKRNiEM1ERkZEjIyMxIQJRjBkKTBJiUyzM0BhkLMYkJEwQBQGh" +
+ "pGWTRjKIE0SYCUjDSIhmGkyEZlMZjCAYYkpimEBMZlEghCUskyWQyUZiGYJlEmSz" +
+ "MmKRiQMLMxTTBlJoiJphJImIigzIpSYzFIo2MUASSpKIRJiaBiFAGGmgIUlEgSMm" +
+ "BGIZqYzQIwIpIljMJIKSZE0FmAxg2IjIaNLAaEhIsCyTEgyGYokNMEzTMUiNiMNg" +
+ "jRMMYSSQQhMghBgAGCEoEY0SkZlCiRhRQSiZEQgKMGQFIkkGIySy0CZQEqIshpMx" +
+ "jGSUUKGSQogUJJAMg0YhCooUJTKEgJoUopZCiYLEUsIkGESLIajJokJjEQJgDSli" +
+ "QhGIaADEBsWJJAYmkoDQjIJNCNGUEwGZIEkqYjAsbMbGjBAZkgkBKRjQGUQQTKZg" +
+ "ymhiQIhECNhhmMyEMgjBMYCJTZBEhSMpk0zGlEyZSjGFFRQpIykkjFCoJoxhpIQS" +
+ "JoRZIZMRmiLJEMwSJgibCaJghRAEyggkQySTISQBSIJJMyjWKAQSQKQYKLDSDRFg" +
+ "gaYDJhkRBqJiSBkSyBmQJhFNBESMWJkmpEwkjEQxQomI0wJiRijNKCQQNNhaYhlk" +
+ "whhLKEYJKExEESAzLCSURhIAQIJEpiQklAmZ/txdd3XdcOzl3Oc4ca53bsdc53c7" +
+ "k7runOugoiVLVlto221GpSpUtitttttEqtCirbVttrWLW0VsraQEkhMxSAMkmAyS" +
+ "CjDSRDJCCJBly6RMJSkkEJIMhCAo0wEkgYIkQzrd2YCBRMZSmJTCjKhmJIEiTDJM" +
+ "0SUsIxIEkkRTRMyEhJCSBIBsKBMmAohgwmJIkkCQaYkkCGSJkxCMCTruhzdNjaVq" +
+ "NGI1qqn/H/D+f92/9N7/nf+x/T/BM7+j/3Df5s4H91tC/+oosD+/gYNHpnVNy5J2" +
+ "alEaZU/66SB3/PXf/7//et/nu+/f9KKr9VSKdhIptIjKzARQZZiqimGUFLMlVWMj" +
+ "MSUU2oif8IKKYIhlVIpkBgFFMIYCimSU/8VUimSiVoFFMUof/mCin/KqkU/1/2/7" +
+ "ipn+uSn/P/jZ/qZLjiqHKWmltwNK6udN0mKLpTbnFbHSxf6h/6WePKShwUl1VbdK" +
+ "GyqU5ooa/vt32BeA5cSpdlPaWguWZVUxZht422i4WJpNsWzjjnNrttYxBLESWBXA" +
+ "to5UMFuThmsrEMqjbDpYOmG3M9440VM3kpxzZ0ZLjiqHSXODDEyJisUWWKaaZVEW" +
+ "drHTWsbg1ZFVRmRGCMFFhITKNXhUhsLAnAXFVTa2xYZviazvp7z20VOkudsVqq3j" +
+ "OeGtvWOVhDnvvuoOynI6VhVKbaPHLclddm+VRwsd9tpyhwG6KG0tNMuNM0w1YZC1" +
+ "SUMAuLhnLQOupddA65UOXPDKoZRXMpLJUsrlyDY2utozHDrg6uimKZS0WgtDKos4" +
+ "KnPMppbMLnNIaySc5TMHGbaxTuqd6qpHacO527Xh33/xUTIdWeKTmjbsg0PYKnmC" +
+ "1lVSd88uqKGOW10E52BMkmKtkyldBFsScY1nFJZktZQvRzSd5S0O9PG43nhMOVRs" +
+ "OXHDbwU5iQ1kkWZEeZGOqNqS6xHOJZZIhTExGkq6rcObBbGrBOaqc8OmmJTzI751" +
+ "Vi7Tx0LbY0JUgoOEmzhjjnptxIKus546uBtXLO4JkyYP+eAcAAHOD6fr9j9V+RH2" +
+ "S/L/QXTV3dz8SL/T8qH5noZQLPqGwlvR6dhx2TVtfs9W4cn6VF1Rfst5hq6EbM2q" +
+ "dokF7YlT+AevC278qkbLKawmh4pJzRaPv9leNe26uHhSuwBuLK+a3xCu7uCt8ICc" +
+ "hqAubTDuymwW6zBsaun77TDCZizuwBP7lwSttmpSykZaG/3IVw50MThjdLpDuH0k" +
+ "DTDN0e2mvqqKkAmVy9EDwysGysaREKB2NormNHUwj0vgO6IiGsJpEuyQETJyWsUL" +
+ "zZWvlFrieCawpUQgzlKTRwiZJXKyzbD3ulpxiGZ3uqqknBCteytK6wxraGufXo4j" +
+ "6Ql84X68MHo9PTm7GxF43W97OVuPemu2nSInel9rnXmRB4ZmN2FaIWPHWBY1gskI" +
+ "XduCgbTFmxaE5YSihkBIUBZk43EhJxOAqFTkTEgZg/58BOXSVo8zbqfJfApfLFzo" +
+ "w/f/d25jXyxD+I/OeU0dcx/x/aRkaa7TXU9oVlOfGYMm7+LW4ifNnrp1XifHFxMu" +
+ "5IbmiCprTZzImVSR0Qa8znKbkRuKQuyr1cokqPHOIDMit4yc4kkbdortTU60qgIp" +
+ "BnSrVsKMeuZ4NPFFXo3ratpwLFLGtrbRUbc6dxjlHMt30iALUHtqu5g6R2+W8fwX" +
+ "w/9tjnDISkwpFIFITGooZI4IpEG2wm2m2Gk22+NttNFNpstJJJJL4r7Fo9BaHfpy" +
+ "dVdT9v6/JXtG67C17waENSlYvNK2F2WomFGFDQgRHIUKMGMIWE4Qp1LPYVOJ3ajX" +
+ "ij0R2SiUikUutMpXscLDown53VRa5NdNBc3ojNNaETWjiHFD0SSCCSSSCDKT2PSI" +
+ "aiwTiy0mbTO6iKbZNVIZ/GZuWsmDvZ2jyAcoTPVEi8HyYNj0fsH+BpVN61a8JAiY" +
+ "SJvPsFnwgTI1HXbhbNF1FnpCTeho7rSi2EUjT83q/Cmc4nETmio0AIuw3CbLSbKx" +
+ "plU6HxSnZ2X76jMxwG6zEfg/GT47sv4GvUeZiImjSpzqWhp1koVUQmYgZfQYMrIw" +
+ "zgqXzPClmVSyPgXckhxZXzdVcKyu4Qi0aa7hpB4IJs6THDITGdymCiiMCFZjbbD1" +
+ "Zs2RDWNrUlQ/P8x6SH7v7Pz/8fq/1tn9U3lWuTf1JnUUMBZ0zXwlfGtzjVdDGdNw" +
+ "/Wb/TcYvZhOV0yvddt9942XK1inv3hKPY1yG22ftVJYGIHecMa1WHrVRdWNFu82a" +
+ "cxAgPKsqap3SvCX1k9lfXPem9N6bX0uaUbPfM+K4StqpjulMkJsnYV74vTdMY1Ed" +
+ "oFSIZ4/h6sOvXBROO5iA46Ydg4cPQkTnMmYnMTmTOZL0JQOVaKsWLsGxYqhdCCQM" +
+ "UGxBBBEJ7+U3578j0euaooSZ6QPtSOwWKBXnFoZlecqTfq1/RtQ4OItiMpbHqNXS" +
+ "LBpu9xQ9UiKIOt8lmoPPrrV81xoI5KWxvXhM3vY8pR7qqK4YLstYwxOVYstg0KRO" +
+ "i1fLX6rgTrxlmqlbrkE9LEGeIed9k26rGnWed6Nh06p11O87aBEwmLoD3HcEEAkE" +
+ "GRBBBBBEkFZVQUUkTHdrccRvm2/fthj1pS2KWAbKGFox0dOmXvOlr51nWKGJum43" +
+ "BBBIJBq/KsYn0ippp9W01W5ZRjbTSfDNkM7isVOp5Wk82WrJNLTsbRZZzsMYDiQS" +
+ "QQGRB573Pe988yZmZmaB0HgHcz7ZHJKFgkEgyIkiSS9eHnk2SvPDryK1aqqqmtW4" +
+ "PSycD/w8sflE+v8v83/dyIplqpb1llszKa0Kl8tWXbMGzMy8XWnF0X937o/wO4fq" +
+ "0+r7tk9qe2FJ6z3CkozLYqzEKiqUFDKGP7kqsHaWq1aDYcCQokp/eU+vt7uZp4fD" +
+ "vw29FcKUSuratW2rX7I00/UcnqCIfPyP4ftqCVUyNaqZi2P7Lo2/nvtw1Ntxu2Ov" +
+ "M1cLOMOjTdl/Jw/jqwjhrHX7ljvTS0Ng9YWklWliFUpZUiCjOKclNiKmjWdFMjuo" +
+ "dSAo96JmslmGgyCeUmmjEtITqi4DqWXTg4318osVuX2Vfa63aYJNvvZpHIUVXXbr" +
+ "pPMYqxKrXRvoXCGuFnXhSb4SVZtAm6ojtvuIBkdOcqdgEZ6lcZZFN1kPKhJJhRBr" +
+ "WEQyIWkl1hnFU3uys63k4eJJlSIMlKqoErDI6G4EEUnpZfaOrlixLp9DvOUpB4Ta" +
+ "n2/ZW/q+fvPhH07t9H4MT16XESiARMKUE/rVVU3KNwDooJ7dlAzgnD7EhScMIYxZ" +
+ "/mOidHDestpVUIAEgC0t7/m9fLzzvPVb1fK+s+Y+f0Pon6xzJ9vzOD8R9GeLf1T5" +
+ "3aq222kVRIqwftW1VyfHRO+89MPe5zaktbKQr49+/jZmajwxNu3Zk7fVWkSWG+K2" +
+ "a1xZlKFOw5BlJpDTgyzEORiGVhmzt4tctufPV1DsnIxdsV3SbUdlXBrTgwnt41HJ" +
+ "0263X9faPss1y+iNSMUfp/X6ff7/6/TW98cccp1bYjhzq/3uXPJj5bT8/7W+nhNo" +
+ "/69v1+jGyfY/aaf9UV6T6SQPl1Bq30rH6H4yV69J/bdqqKoSHon4AEpmUtPAez+t" +
+ "92Y5lOj2CJ7CYdkZxf0D3R/XfsuFMS/C43Nv5T9sfMZV4L/G9pvd03/3mq9yzlm2" +
+ "xVJVkOV0LvETLzsJRx4cqu6dXdXXuPQcCHb7ePRk7He904sDcwdra7Nt9q7VFY9l" +
+ "7jUQJW14xnuJPn7/TMw/3fPn4+Pj6o/Cx3cXKtqlrD9PRbmYZme3mP9E/y7G36I/" +
+ "LH+Z9Pht8Afun7v7tJGbXiaeU0eH+Gn5fst6/K+NqmUrWijbu3DZSH3hD6nZ+o9S" +
+ "qiIxVVjIQnk5/AzMrhcclKH4STg5bfDDGO33aTpJ0rlQeHwTE4GVRAlhOxMpdgNv" +
+ "3ajAlCIVM6Qe6uKg9yOwUV9eRvl2dAWQKng+meXZoWhDqzCyCFDwHzqlW653rPFy" +
+ "aXH00S9/SI7ZIaPaDOu/U2err6Wt0/RGxFCJ/FfXywJ+Z0NuUscckrzN2LlS+4To" +
+ "ymv403aBj+06Tl0T6Xne5mhKZXrsbvOuKiXR7e6HiOm9CknWsik7Lmvsvrn08oTa" +
+ "aD3VS6R5uebW2codGHht9KN5dWRYyrvSKCuOIvhyuzboi48y0eX0b1ZEk7XR2mzQ" +
+ "lIxgob6yp54pmGTlmwZ30l56vdry8vuvXD4hdHdkDKTAhgiUo5KUmzxNmilIqOOR" +
+ "j4IT356J9N4UeHHbOSSOyBPJ7lSGRJEjG2PX7P+mxdE4E9kZhSbrNHt+LR6oxuXC" +
+ "xtS3UxPlEzA5XpdlqQj4iqskZZ3pmdTpI2hJsTma3b8RF/EoYxU2m5oFB5TT0rss" +
+ "2w8zlr3Bw9jYwgtNtPCzmmpqJwmZzfsew9o+/u+NCiXjuaEvhdu9cDRPzPZbreMo" +
+ "pkxCrlWTi29L4pZEMIlfLbK+xSL0Zqy7IjaLss0ZGYsGcMGrgagM+zilXFMbIldU" +
+ "QarxUPisyxhSqeew68PlX96+Vn81ovsttNN7r2tOwJnj1OGZ6GmypFEL/OURjEXj" +
+ "xamLJXj4pVTillprNqvk5OqCY8vVrvLm3qoKGDgxzLgEkqry6tOg257kmNzyTdlj" +
+ "Q8tAmWAyU3697unetmwupGywUXVcTN9MqL1479u2I2tsRZbvyj68/LNRM01plhvS" +
+ "bN5NcjrrccL8Htyj+BCrHefe9PVPN5zrUH+1Pb6rXdo22uWWd/EfwZZbUr34gOaZ" +
+ "1MdLqLC9RP7u6RSO3a3RxXP8X0wBLkn9FRxLMv9CJEbYsiOpgpUSoa5GSlIQU0ym" +
+ "1JJSRLorCY+OqjQVlihaqBciZcOS7lgmERMS0iZQTN2xVFERDdrxbKJtzCzbbXC5" +
+ "bTm3j1zMs1uqI3AHShpYzQRbTYKYrZRILVpDLWCCHKKFK04Pz6l9+B8QwVBx3HZ3" +
+ "pHj9L3wPqk8LV2RT9q1kZcelVkMztswvhMxRjp826SggOKFASfzLUZH+Trbl452C" +
+ "rv71T9Wht51YV3hXG4QPJdqV3uZz13mwrzVZnjVLbVn+YVe62EzchMqtzShLkKPE" +
+ "dMnTiMTvOqRJbzVhxDI1dd1rQhiTqmcLOhwiEgTPFVyLB/BYxVVJ0qTbe0X+E2NJ" +
+ "5FQil9Im2yK4hAhROqTbaIFD7Kzyqk3ny25Hm6dGXKvdrsl+j9LTNJyMbczUREDG" +
+ "XgVzlti/gxxcK9lmrQmuXy00nPZ1ZnYMCOztzV44ehTr4++n1Tt21RvA1/+natOd" +
+ "+etlwD45o3FOGbqiF43Vsp2VA9kWCP6ERX78Jds3aZdJHuSiVaYad/n73gTnNOq8" +
+ "bUvQV1ck9/tFEv8o/X7P+1ZhaugDmvV+7UkaQ/vHB7fX5WVgRokFFMNzV0S7rpL5" +
+ "fPt5HpdvXdsa8XNCJ3dO64RjAXp5PJc5siQE7p10k7q5MlxQkHbwYYb37js+uXMr" +
+ "XQD53nebkY+JEQ3Kr6j5LcbHtxRKez7rjvN74ZI/binYF32Tatmu8Be6TXLsrqtU" +
+ "SyjpPtDkefbc/yap8EMZR59eNbE1KJt1yzjkr8IrBj8d5+WZHW1FCToyAsXOUEXr" +
+ "Wtq1r5tZb+GoluBz2+U8FT3va2RkKc6WR3ZeNn4iq1okKrUThD2MqptNGqiTJ4M2" +
+ "f9u45+/nwFAQyTz4I8lDKWkdQxJJEruEVFU6mHlMh/SyVffytduOEYY+qcVewuWR" +
+ "7sCx2jKWaQSEq05Vh2otTsmLP8nxVuGAJlL6CQ0fXzP22Mn0O/dc+RzxqdnXq/N3" +
+ "KIZUKGEwHCFgyKwJcqXSyY9+KkWLMIVwWZW84+AK/Bz5wnaLI44LmU90x/EkyBYo" +
+ "YS1EJA9jWfE+/5tRUV1ipCoof2zsjgKQ8vpHUIwQU4hNNSOW4tYulfaqfz6P4wYH" +
+ "GDM4DID3+NqN1ONUA/PfuPMRXS88tk7zKq/wt5RmaVy9WAxsjPw3pHVUomq01Y27" +
+ "q1V1m7Yd2KfWl+O5Zq7729d9zZ0l0p3fEcrJ5YgfbvWje7O3f3xZrowIWRkq4O+T" +
+ "FRyxJpiWo4lFPH3WrGdl4cvrRgQWOs7e+Rm7Fg5SGPs7K8wII3++tGhUMYuglST7" +
+ "5KtdoyntNOHVVlYkvFyJtG6k2rcPNYnRazDvM0jtv9e0GxHtPw9lbsVHo999iMnW" +
+ "ySQyREBBJkSLp6BsnvG/p9faVUKlPzdQ/ZVIRVFqLwVZA3bCzzChJo/VG3vBX5SF" +
+ "rWK1RZmzbONI5WDQJSoSvFrWQPYWLVWpk4wJi851alamk1f8QZvBepyqUITCUW1M" +
+ "PO3E+bYpbGJWorqrG+spHFPy6ovW+piPxPDpvMK9cLBMXT02D897907tO7q6Tqpw" +
+ "mu19VLVj5w68m9aLxrh5pRd60Z1Y7OPlnWyT67h8VWsGO4nUUKiC8Pu5yxhCT898" +
+ "xuvPfY+fhoRK5T5qvf5+ore9q8fDLTyk2u/mia2vXGhbTXwjpwro94vOKUYpdrNK" +
+ "/ilIKJN59XedxQPPGvYqUmlTpq88kgneW7DHmiG23HMo7Zsh04+H7xMdo7xOJJtY" +
+ "eizcYZdt7XbKVK6OL4vQLe/M+3jq86SgU5889oFKfPVuxF3wlFrkIun9efjz79d+" +
+ "wYeN/C+u3m1rd0jFGq9X89KmLLXN2C5Po/veZd64ndf3MKIxsceKwWTeL7MD3i1L" +
+ "FVj6xz2pzr8QKCFNCFKpIp+xTH6JnyBsNsPitQloYgqd1l5g4jhq6cPDUvHlmwrI" +
+ "oOhRQkOJcJfIaDs0KhNWaJJhi4g5WXdYcDKbkpiy7o20IRRpRFyOFooQ42GI3+Su" +
+ "oMuUwozR5RSK47UcIoQsIwhhRiAXHRoVM/c+S9/l9R47JC+j+m/Feaff6jz8TUQc" +
+ "fBu36cbfXyrsgqiUIyVfLNwCKvgnlBRwKKm+brfbFcOClV8LfTPJElZDw+Yw7n3R" +
+ "/39I96pWacn74akmCfZk9N7Hnbmfnm+G9N9IIVf233Vjv2K+dmOqXTgm/cpSxjx5" +
+ "NoTM+aO9xtTisCE1pRXSdT2doOxqKdUb7MQGth/hkgx+xCAlvCV3TRG0Ce6IyQW7" +
+ "O5ROkRaOiwj2YN2coi/fFuizw675bLOfJnWg2VO7rRIEXexnFH3XUPPfxRcRGzXs" +
+ "xpAtbS7eu63smcY2W+6RTU1psvDNdHE51pxd+N1FlWJbYbvu4qRoHx0s6pEIRV8N" +
+ "xbCsclUVRe1t0Tr9/qt689+zMRbOMBXqvBVD8KyFEO9HimPzqLzwaL5e+3ZBPN5Y" +
+ "7c/Kfp4kQCKdTjmOa/v154+n3TBe7/D3+v6r+/voinkqWoitVotACCo664ufF4Po" +
+ "3J6cfruz8fcQTLL13Kd1yNXLle7zzhNiNjuuwY3dvT6en4e/3/ffT7fX3eKmQXX0" +
+ "/wDQj59+yNfHDLb2ngE11HTs1D00z1Rmnx+dfhwbhbzuLp0qd0QHMBspKuzzC3ON" +
+ "dfyL9+3rQfBoYPjz4zsDVN+WG7vLnXx9Tr2sSvtE8MUa1li7Bpqrgl9mbKWWkUrS" +
+ "xt51NbR1yPPlQlNbX2vpMO6OipAZVCnOzMdCcdMd8ANNA3fU9nxFkfotXt+qp9oP" +
+ "k+AQUQa8iUvJUoSVIGwuzKjMpmM+3+Z0JJ9oAjV234RfrNBxtZMos3vCkrhlcmZX" +
+ "JZqK1aqYUg1pqK4fwfD1WX0eSASEKQ/xP5j5X1rQTbnv3OI8ip3bm/IdSENUwIVV" +
+ "CBlkpUlnZ2REw9p9/blysnsiOzjy+3xKhFfg6Y9VKDt267q3dT8u8J9NhYJotAkH" +
+ "UBPU1WdVV2dPq97X2saP9b/I78+d+hJa9dsO8Dq7uuiXBGuVPDdiDl5sgMgCCkTR" +
+ "ucudbu90qcSryhxzaniH091sPgD3KHqWgJEDwpMCgIuFF5DDtnI77sGMf+eGrB8U" +
+ "CUkTW1qLEWR7RSwstGmUIlsNwAQgEqgykQQLO1knr6u1ttq21Hb6I+XSd9/RPL0/" +
+ "pE9I8J/gr8OkY248frxb8ffHG2a4zitLxY9lPyn2k/bD85+59xlp+/KfS6jzTDGV" +
+ "KlCSXUKDuGBA2GxzjS7K6hA7uoAgSlLYS2qL/6jhPn+y2y2u3o2Tt0/s8v7+lrl/" +
+ "tPT9O/Fvbfdk0V+HtoX6P4/h5fh/Zzr65P+z5dyH9HPb4K1fuqT5PuQMhcP2210T" +
+ "TD6Tx8InpqHwj333mVmPK+Lfw/Zy/VOHTmPh/Y4e230Y6cunLw2flSdvb90NP4n7" +
+ "P7x+yfRP3enyjwH7P7Pb7p+s+0w6WTLFVJtJ7fRw+3jh93hw0r/PVq20NKhwUT+m" +
+ "nppNp/lXTSUy24lK/p9p+x+7bhT5Y/39es1H9J9h/LTt/Ha6djhODEY0qtFflRyn" +
+ "0FY5fsE/Dp0+HL/Lb9lnh6YcP0Ym32Y/Rwp+H3k/Kf3z7vTy8I+K+yj22wqny+Ps" +
+ "dv3/tbwj0m1dOmO2g8Kfo4emjSqXi3tw+KtNzhy7Y8PwY/U/sn9o/l8PSD+utZcW" +
+ "37Ph7krkPur4qw0fu31nGszW2itKPy7n5Y+v8W+vzZf2Onp4K8qjB+bb8v8tOH1H" +
+ "B8o/l+O9+G0tG1pa21taN/eU7knnyMCjBUlf4T4Nvg4a8W9DpG34af0dOXz/L8Bt" +
+ "/Lo8d/GXPh9HDFcPhj+ngr92if2dHMPk+xw0x+XptPtbdPTbXxbFcOvGltuZktu3" +
+ "B29JpHD9/l+75T24fcjp/93tG58fLFy/Nc1mOE2PTw+O7a/KsP1dPKz1Ielp65m3" +
+ "Lly5mZmOW2qiqrJOg0SUOpO/Ym4AUdn91ovgujOz4FB0MBZWJO4mPoNtb+7266rf" +
+ "z9zM1txqittGlEv4/jbbCTioBO/q3CKi49u7fnvTo05uxVVX8Y0CiogUNx5JLet3" +
+ "YPFu7NOEC+62c7AwsFCz2reusG9vMFWax1VlAwU1dUyIEhit6aC7Du7M7VdNstC1" +
+ "lXlm7XRkSLM0jajTZqNBA9IW4mqEa7U3XwsODHDZVYjuyTqypLVdoZbqcyjdlRjo" +
+ "dkyjWpGBmkajVWlJ1DzMPPfJIIJJJJPAQDIGiiFDI221bW79r+Dx4685zOUWtrbb" +
+ "fyOzogfCvL38Olr2TVKbaW0vvu6QF5fnnbMxw4f2Y/dynRyqptyw2Smnj++v21rW" +
+ "uHL/Sh6afEfd+rg7tq21/aO38mnw4SfDyY9KYm/9rcSPu/X7Jy8DtpVNp/s39X6P" +
+ "xVjyn28Mf2culqrID0/Z9WNK9+LbXseXB+yp9IezTttsnsw0m2J9HPXrTWa1mZcr" +
+ "Y5Fj9fX8f16/rtx/W/7ccT29K9P8fS2fRp+r4CerERJEebBr/HVX8Y2yv6ZK4N87" +
+ "Oc3/UFSf54kQJDPt4hEQISiNsJ19vv6d5ePOXnLnKlVRMqnKJRN8HOc4eHnBzoIH" +
+ "MpAZ5mOq2Kzf1XTznObSPHfYLFdt2e53f+MGA8zED54z4hfEg7rRJfbXkeq33bpR" +
+ "ebgJAwUvLQPVZKKFSSDRYI4wwgQCBcqqHmqrcrro/+ISKcn/1pVyxUc+791ve+Gi" +
+ "7f91U5/UtURLrEFwxif/K7mLJLLBmTJklllMbAuMlEryqfWitYksSyFR0c9WGSW2" +
+ "NMjKZLbGmSTzVb7Jbba9lttvnPje29ykZaxopllRLYrTpUlc4iY8qqyI5d705MZv" +
+ "u1ZllGstGZYT7z6Z6plQwqduumGQywMcHwrK86pav3RTHhW18XfjLFYyWbjorjna" +
+ "TttpVOBUpg27Ou7MrMMyszLdHBzymitUJ4Tz0dVMpiyXRJDbskep0BN7JGO8mdHV" +
+ "Pd1TStUzfsg4eXuWE9PVt2juEFWDZr24eiXW5DE7KjZzEOuNZG7I2ocWRlLYLVvF" +
+ "GIucZOLIbpOKjLLUtRat4sjIGnHJoJtX59aGaxoZtSn3kjr/BfvvEueqYoavHjKx" +
+ "lfTkQc9PwqlPyjh+1Tjaztea0tZo/XVFD512U2EDj9tVTpSLeu7zGstZacdMaS3H" +
+ "LvcS+9fHUcNsArlVO3L8To+YZW3QdvX46+4ZlyqnDs2vzrkqcOL7lnnrnu8/OY54" +
+ "O1Vp+VBoMO5sxa7ODUmwnEJvqyTdRq22yZN7KutPTVelXigrJvTW7bYeEeJUxwNk" +
+ "NlWq21IcSHn3w6MTx68cHTacUEfeN4zPFzT3uFY7X3XTNafe0tNeKqbVU8s+c5mt" +
+ "7E7erU+HTx2Su+OmvhpwPmcIeHwW7qx29oNMLvh0fHz44pNODegO6ZMEIgYczrCT" +
+ "WdKk8MDFGSiuOOdBzS1zZzVoqio5kOTtbKzi7aNMZgoHKdbV9Dlq7N0h523x9+6i" +
+ "49cdHhy5L3Kdee8uTrlo5JI8MkRs0xx3Jy2Vtbxbho8Fzs+RYy555fVjxRvjk17q" +
+ "u+TeMhUNSCJxOGSaXOJIampROLhmaO2zc6CyY2kbd7PgiY9Mkmm76s3Tx7yp8fnf" +
+ "E1+NlrW6nhoz1fPXb3ymeTtuRGa89uIgybYSRnch0uU2n5K6nymfCrxsnUc7yc9N" +
+ "gY+UCpqeMhw3YTjNExOOB6OpwmBt07D27E2yOkgo92SedsjGFb5T4cKHWuV2M8cF" +
+ "8zMy4FsuJXHLaRIdimuHBprXH3TZTtjDi8eLZ0dKHf427eFdKGF72HenvID6MMOn" +
+ "bCLWNsgpUEoZZG/vyoPxPnHd+D3Y+H3rpjqclZUisODjFbL69xIOG+QclTpogxxw" +
+ "qNO9m2ni+V9vD2uz1tpoxtt5t1PjrlVPhy7WwKnZHuC3ruTKRLY2yUlqGlKqWkiW" +
+ "y9iHnhPZO0rN94N2brW8hut0yR51BrPKXs7JGxb5AnRiZTl2Xq1hpiXy8iczq1p0" +
+ "4OUvW9g8WPrtcenxbXL58ic8LgbnL1I0m4MeNSM4zVJrWW9uI3DW3tqHzluUwxR9" +
+ "+s0Vc0hpweORY4VOtNXbALUCyXLqNFcCR7xxw8jTkStO873DPfY017vHfEhE5xAu" +
+ "lh+U9Pt+W9++O/u05zeb4c7pzjRaWurtlU91y/Pj38bnSo+8PfvF8I5SNJ62aL20" +
+ "QZtJUXrrTO3rYPXw+NeuFWmevi1C41Gt1m2DMqHmySGsXd4XEMFkBpCUlZSTWAUm" +
+ "a5gWmZLEQcLCwtjR0rZplkWrZuMqsNpWrMyvBJ5/Gff5lT3FTnKql0x9H4PU/DTX" +
+ "OxAXime7qULq7DqoaFW7tVaVWymOAghDdEltpIwwyIooHivfPjSHoqKy0NCBIRpB" +
+ "IGQK8fXhPBpMTMhc4OCJWMuxlIYammJ2sgEEXEs8oDopthFpLOUlVTJVAqKGFoiu" +
+ "fFmCKtsq1oM33uOW59vV16cDSvt7p7+u80IySXnVy5lF3Mz5ZLDu9ZrDzoUPrekc" +
+ "9Ie3XnPlekWLviZo7sWzm9WT4r4vmvd4+Mn1zI9eadvv8/FYv0fllb9OdHfmF98c" +
+ "xiihhSVRBRSemqq32pgz4bzMD6OjNYamHHHp0WsLbYyKxZ3mLD52kY91zW6fPB9d" +
+ "GObcd2fPPjX0d4du7bA4tvfmSzb6t9NouC2GU+LHHGJNXK4s3xiY6MfbxT4Z83cZ" +
+ "UuZDLGk0mY/Z/iHrRxSY3S1SG9mvzS+bvxc44Th6JqNHLLC4ZR+p+NfpU+sMTeHg" +
+ "a67ZI7LO0gsjRa278NqHpyOH+PRsdMcqF5x65vjp0KeJjqR4dknzo+Zsle+oZmSN" +
+ "f8ttztuTWnh+4V2fpXP02u7ttibExiUsNhbdfPzh1+rQ09U+enFtXS5qQkjjxMd8" +
+ "MkkY56cYwqZcb6vi222vU9cyYersXMh7cOOI2Y7Viz6BNspac/J9fjp3RQw/gqpU" +
+ "1kIPpx1mbn6DEJI5wLjKElOj3z3XAvFr+HD+fSn8rhs166dJp1CBw82PeVw26dIv" +
+ "7MUi/KQbLXXHt4nPh0fSOYs35zI1WtZGrbfqaOvlNp6VywnitCl7G/RjngwTGOXw" +
+ "v3ThnnFFDb8PHJ2lL1vMzxiXS7Hci9P169PULTtp8MorSZB25VNA4Pw6X609+3Vz" +
+ "WTVcyRy2dbt8H177mEWSRvh8M+vSerjnx/SZfuZ0beIXSUuzna/Om+czLbbbVfTz" +
+ "54naAdd+pE26qa+jh4iOkG3g+U1FmjxmGX6Gj40+jLEntyrIn7/D+T8fy1+Pjjup" +
+ "Bc3CtbNuXO2tRdulIu21ItGsL9ccDt6aEtrxfwXjqcDx58HqqhesQkkFR5Hw5s+Y" +
+ "95rjxZ49Zxzzzs55zny5Y/Trf42ninShp2tC5MykPXPDq/HSuOcy/Hrg+uXOZjhw" +
+ "qpi7evQ+G3aueLbIW2pPLBOXPB2k0qeWcvH8dPX3537NGVVjFVhhjKxliVkqkjay" +
+ "ptqZq2S1WktJVZNtVJa0VtCm2mzbZsiNNZVVSy2ti1tS2Sq3md9hy4638z5PHNMz" +
+ "Ix3IfMkD8jgU/hevg0z6O9vrhfx2u0pdXi4ooddn1WwLTt3u0dtfx13/DwegMQYQ" +
+ "wdp85zgwAfA3hJq69eh7Lu7zLGHl5V6eivCu1elHunTwnjRy61p714uThUcOOcz8" +
+ "O1cqxabWOunLt5Rw9iSJHt3F3y3WWZdtujHhx50iRPHtKachw2vnz8eK369x98Ov" +
+ "hw2vztQt4JRlnK9QFCycOHEpchMB0Ym5SeIlIUMnPFcafA3klDSwWSTX9VVFP3k/" +
+ "KQ0+nzF4rj5wtvArh604+dqCN3Qjz0VcqypVmrlXVlSVcqyiSeckRld1JlJlRlJB" +
+ "zmlk1LS0RqoTfWN3vzzprfXjY+ZUWT9c+ednqsvvSSJCkAXphQSFpCgXIwRJFQeP" +
+ "HfxpU2Op7pg4ZhX80D8P0HcE+tvtafe0PslS2h6bEUphB+Trt9zcMySlFfrXx8s6" +
+ "aKGUneDdfjQ99/yYfX7l9meCDI/bvJDJAQgdu6SzNW3eZlBQykZoKrwo37d0TaW2" +
+ "0DnfHOPJfg278PvnXg+re/l0U+vfj83QmJIyIhDN53JH5Px9XhPr2/DXcY+NzGJO" +
+ "6t1p8J77+GH2+xfbwXyN7S7ySU8e36ZcY2cmX9ZqJVTbyyJ9LNd2Hy9pFJjOJx48" +
+ "YJh9fxDDVU7nuPtjdzVxq4025elJxy5kTGLIXu3JDla90qnLmi/u/hOXSqnQu+mf" +
+ "lpHZt8sRqH7saHSSEQXU251XwY4dOFRt18lS6cUnTgWreu+m18JO/RkmYWb9Oofm" +
+ "aH1PPXk244ZeFEhws+fI7cknaR6D4fDdfBuITwr5+BweumnDtjA5GjvZpuOHS0si" +
+ "Djw9vK9vVXw3M4takTts7RicqcARg31RQ03CvXwCPOWh+DxPrrPL04oI3S1HWXPL" +
+ "V28NsefHEu5KGKEqe8NJPYLCCHQMJCQ7PR5y21rbPLh6zyKm7rpxn60/GG3l6l0b" +
+ "Mqm2VCL8CsOWG2Qe5VVUemVS2xUlz8FNVTjEzB3gTsxNJ2NL8fkcfOEhUaCuYPW1" +
+ "wuNRLHrVBHPnUBbfGqqnLbx2unVlEqcfFU674T6+c8eHON8cbcPxnVY79dPSQXrj" +
+ "j02ctOXInljHDTacJEg5ZB5GNDvHrWNOquSOU5GHgGIrXB8Q3PTh49XFuZnMke3D" +
+ "Pi349tnTc2x78ZbabfvzMff1Q00qpoqlPdKqaqUObw73hT5rm2u3Djb92qrt3QRw" +
+ "acoV3xS8qpNypaaM8CBy9599F75+N8/OM7xre29w+OXpOnjtyeGSEgrypPNCAvLz" +
+ "gjvv0nE4N8L06x27SNPjUeRJEjXk3zlzOGsVtiMq9O5Hkcp2VPh8K+XJ7XZx9Zvt" +
+ "531nPHGb550jpsrvKpnZ7X182tPp4nB2m23Dj50a+PuHwWvHvJzCvWfD1elNOsfN" +
+ "SEgw75bTbwkkc52410eGuLbzmZkZvvVmtPrz195lSMXTdO+GvWa25VN0UMpetNG+" +
+ "NwU07IY+Tmk5PCX1drtxw6VwlEnsyq9FxYhCRtIhPTOT09a7ZutZpiLA6pDtYY3V" +
+ "5igfFU4zU4brTy7ejat64Qejh0SJHTSTZ3u3h212EB3mgeekTleTDmSOOVnfrh6P" +
+ "Y8ntJJ7Pr2KTqnMOYbga2JznETGW1bGqmrY4zLwt8niQD18xElWURb94FyqjnAZ3" +
+ "z6YJ1iOcC2nMPuqLNVQhSiLLqoyCroXV+YwVxq9cddcOZJtS0iqScZGJbLQOBQXO" +
+ "HE9q+9mbo5znrM8crxzyCVKhGIK9qoKpR4L0FF29epznKxmhKoosQGVDU2h3Ay47" +
+ "SFIJE+nw88FX5l03vzu+JfbrzePF0kBSZvDVsr5KaIWZmJzqUoIpQrMhASe/z86c" +
+ "6HyL3ZqezLvn2w0+aVZ7vTMRFUZPLRe7Rk+Uox4XrFfp8/Xz18+/jybiRw7VvURT" +
+ "5MeVT3Td4+Ma5xHFTVt3xxqcror7cx5cZbWPo78+Fcp3j1jCSRIxTy4+XByxM192" +
+ "To8aO6enDlp8Tpwnp5LwvE56l2zffqYlRPPQ4gQywiSLYYacvPXtw/DHocyrt2j0" +
+ "e/enNm57m0qsB8YrRH1Lrhwgi85HTIViqnpHjX5odbWnqdJNpywNzy5F55CTpz3b" +
+ "Offvji3GWujD788zPCvnTt/r5SH4mbMvVznmrtcufVxUd3tFD8H+XCVA9+aArHR5" +
+ "t2MPNpfFspyylwe0mEjs5oJOvfjxfnnNXNbdJPJ5YcaYgXzEbNNe/DNpS95PXWbX" +
+ "Lj5me++lriwkeI4ck6bca2nHauuzfPTyrxRXIm23TPacNjajfNUa97T754q3c0rP" +
+ "IE5Nere/DaZzyBPTHL667M6YMUiwUw84c4W+5rlfVR6zxCzaeKly9x9x6DhaooPI" +
+ "1CNpPHVtq129Z3bpzpOM14nhw8c8mvgVGdYiu3n1jtni6FPTxEt8uOLVAnqxzGvU" +
+ "4XXlc09EDkrS68VHEuLovfh0kKjn16nx2624KnuSnHXYVkIprh8uKrXkxp5Z3aqc" +
+ "aeE59GkSJ0a8drt6aX+06Y9W1WYqdPi+di9Pw6evm8zGnrTzvvv+GSuG79/XDiov" +
+ "H0qepaxPYPTbhXBj1xR4w6Tg6NcOybV4+Om+3X41ItLvfGlU341TWO2R7tSuZO+O" +
+ "3asyajzIENvnh5J4Xw8OuDlfBN8GUCx4420ZVU52z250coXTppy6fELl7Rjpy+nP" +
+ "x28cG3ng7sNCRkisEe3Ltzt62dtbszTgXpLw27ePvRw+vlFcKR0ekbTaMSHDJB5e" +
+ "nZ8vLbTt78dG25fCwkJ//etW1scxPdFsVVsi0tFqS177RsuXJMklSkhrEjSwORa5" +
+ "3WlxTnZfjFJJ8qqYtJkGIYaQX+CRXd/3dKH8uAJ8Y9cu+OcSSPAL6Gs336Z468Zz" +
+ "vNxQRIyXt3dm7s0SAwKIJ5wEk8AwcCHFznBwg8o1kzNO72t3vAPY+sfngZ9dFb0o" +
+ "+X4H6XmWneYezTTiKIZ4CUUD4QEQCdPGmwTwkyTaXmJ2d+i8PAPAvDjERepd2Z2U" +
+ "tFeZqfopOh7VAjAeQ8BPpenxxACAkEQhEExObQ9XlR+e37Iw1mN+ICD34z4TEzKK" +
+ "dyQ5oUQnsRgHH1l1ker09IZ4KIqyrFUOLmqZbKLYUGaGAgOcGgdbwVvRho1lbYNU" +
+ "cdPj1zU4ogY7l1TxfNNPT+zP92ta1Xu6TpY6QeISM9/hrny59kjOErh+Ht2BPj57" +
+ "6L5BzgoCDQAx6HNqd9+Dyvbt27Lq3osAuFDt/Zv5zu78vxMXPz5rDDqp1z+Pi2nh" +
+ "zxuQkFAnqvWm2HD09db9dvJvpZ775mY/Nd5n5du34vVU6F+N+jTb5SesToqJfaen" +
+ "DXwdO+bu81I8knny2dLk+lPtFD493Hx70x8+ZnD/LrkygIFr4AcZGrTDQcMwVWSB" +
+ "UIKC4cStoBZZEzt+9tptwYhbUixKXVLSo3XvhOmipnoTQ+XBJCdfHJ8r47yZmPlN" +
+ "tp88W+HnzreZnj2dX2cPfT3zCQm3ifI8tvCeDfBNnl0nnzDynndrPNObjUhIM70k" +
+ "+Phvzu5niebfbE8NY1HHuJBzqbt41px6TjT2wnuOfnskTlZwenlVTqj+HnLFtEu3" +
+ "oQOnRi96VHqH1D1c+g/IZ9nQp1cZlfv1606UPjEUVw/C6dh+Pz4Dro+bIdOl2OTP" +
+ "vLTZ5+7/XSX29Bv0PSCdHY28GJ5eY3ddXvTet3d8H187Yn31vrt8fNKu1D4+cOuX" +
+ "InT13p65ql8fJv74217Pm/vXbqk3NtnkqrqnTkK7wpfdhA+r975xmcNIp7Twznji" +
+ "evTlp74w9peduGxXiNdczaymNYnPSSSSFdH57db5cA+GzcQeEkOBjPVentzlrtHQ" +
+ "fBtWJ18UIb3yjguww+BUcg8J5eHbljZU09Ja1euOjrmjp59ooZ2hzKN2Qay4mLA1" +
+ "pTOLMipVkiB0k7w4rISoDm5vGxYTTI8ymFxmtm+OGuNY5ZPbcqyxJP8qLkqcrsuN" +
+ "XvVCjgr1Q3zy6o5T0ZznGJlVeY1Td52qu2m5V2aq1GXbu10ddY3rOrpy0u3G0gaI" +
+ "oCqoGaZwMADnKp1up7vrdzvSOe91CCUrW9pWJcngyfSVtIngw8zxCUFzpAJs+tb5" +
+ "Zsn1j4Dp7628zYe6Rgm2wa9FYc1vkPNMB5NQ8Ic3l160dXv1c6zek8W9yRs1O1TS" +
+ "z1rN1EhwklOMD2NGX6ryTXTqgq+B6Y+TGD0AgzsO3XvudNp0bcBy7fASeOUcunRo" +
+ "167Ew2GNnFZG/O7eEsenI5SHrvvWZ2addPjD+TtfXdODuwvq5huPLaODCtE0ntOn" +
+ "L4e8t7dJ5M07bNC1FSRtpsdzzppPfI7dxw1640x8bjJekxsa5Y8VNtjEcBtCWwcl" +
+ "ZTbCJcD8HrfbHN5KHTo4Fp819fe92ONY4erddMSl2w76PG6tcHtZwrlPXKVGjFac" +
+ "1j+rOTbp5jOXJwuP10ofsoU9Td33dv3n1t2cqdfj9Pvyqk2efPmZ48XTl0KlODvM" +
+ "5h0nx+MfdEOnxtt86WaVU/eucz4+eu3ZVKY+v3r850xVTdadrjormihyN/evHXTl" +
+ "OFR1cY65NTCcRp8FenYLLIlUW8sJOnpScPWt7tZIJtsSOmHB33atvt8eF2+HHiQg" +
+ "NCRxrt5ejjpt8Lh0U4HvntHLtejv64WuYovx4cvjudsIfUUV5bOXl6xXKF8KXjpP" +
+ "vQ+fOmXao1fF8OImWnu/i1atr4deV54zS60z0kRUkUeKm8HijJ0r4pFq7Fh+ZW0p" +
+ "aNBfXr10NlfrR0278/Td06Kxn1/HSm+H8Kqdssebvr9V00fgPx9owrAzk/h42KL1" +
+ "67fvfB4VPiUIfGBcH0P4etPoVyKa5fXxT68OOsAuVItPWj1w165dPPO3Prp1euH7" +
+ "9fds6coXoqU5gR9Lj1cVXDfOfUFnHKJcn73553ve94fphI76boE5x5eZtBy+Ht3z" +
+ "2NsO2PGCnbwrDt+Pq4KodNhA28Ozw9e3Tlac0vVRrljGXXjK74Z2eHlKbXHRrpJ2" +
+ "M2gxJI5S8WzbWJB5fOzzK0ngIDK6THQVqb+66e221x72x9UW+rxDexdJ8d+/O9Zr" +
+ "M1mXw8jyxjie+j29RJENvabZofCnhWL1wD3ljj4BcQ54OO0GkHSQe/IN7t4HfjuD" +
+ "tPHLp3KlkOazq8sUy9Y3tjOLJlCzMmaWi4d78Kd+VQ0sVjFFisKSwqlNNSpaCyMY" +
+ "JhUqbN41WLJEmRFsshFLI70wpzxVDVJQOGVDMCz+Yz50FeeCnxee+p0OKhjnr5nP" +
+ "et8cb4wgYO5ud9c665eXro2ZltpaqQ2VAWc7xIg8F9WbmVmuss1wH46NPSq6o+75" +
+ "r6ndGvN2auHmEkDx6GEenCEQjUVKH6S7o7nqeTy/VH1TrvmVfi24LBBw8xYwSNpE" +
+ "8sJnV1c5fbaj7DwBMORMfPLNZvLOcobrd4s2vvkgcp4VXw0SckHZ8PbX4yw2pF80" +
+ "01SGzT3e1kxTTTd04UOGN4uYNHi8W+3ItR+t5UkOHvho7WGOo9fXnnm5jU28kkcn" +
+ "h8ar34DKQz8PS+0UNLpvX12vxVVT4FixZRLGVTCKg7d6NpMKY20fHFHbPHAd9cW8" +
+ "W3B6uvHn1lut71682+3b0eekCcIhIfPBfemlNvtyBHAV/OuTYkcsZ7vxb3PCthAc" +
+ "J5Tp8ErwsxlI0n3rzjvR4rr5meB17QHbhSBLIyHa1ZzsIKrDw6gTDhlwJiwFxV7C" +
+ "TiTvjH4uOQLhBYpFs7g9iZz1eObpyecFTp09Ydve/h67KmyAMb5631VNtmzEgiaH" +
+ "voEEA9jOcHBB6Y5jttTflN4ntsbyJB2kkiqnekzu324+Oz6u+mggPLyZ359BJ5B0" +
+ "H75vv+O98cccbcv12976z0kU9dPnSF745HyYQ33cpPXoOXLOhUp0DfHblUbbed8u" +
+ "lr64ejy5Ydw69Z2I9N+ed8a3ve9zh58tTm3kTpI2VpN8Mb84XPTbiYlSnHxsVKd7" +
+ "5NOQ9jvhPHro9jznCFWeydPNaNzME08nR6LWss1Ouel7em2Jvht075zNukuFDuk1" +
+ "adIWgfePGTgVKdrr4ziPTO8PPDtjuAh51atsnp486Ws04OcX3GrzMsVSx9Po989d" +
+ "4u9uULJywb+G3r10Y9F054GPrm4+L04ZJJkqxvxw8zVtr078cZmaVPNF8eWOnzjt" +
+ "m+Dzp6MOXKqbXT5aKmzzblVTg1w8Fy8+g7bfFrpVSnXPW1fHbb1XDGGpmJERNfAa" +
+ "YbUdLIY1MzGDJvWaVJua1NSM8i0YiLdVbblrW5bVtO8YJSMqFKEhgmDmWUhjLJDM" +
+ "DKMoiZY0CluHGm7ksuQolpmExItaAGFEt1JhFAmUBNrbKCiJTAyJZtArEMXRREHC" +
+ "ZTHBRGRExxlmSkstEbmFe7IABXoWWFGHTOoGks2lkVQKlwsertIkulaYxU1YkYar" +
+ "IugRakIpIA20qUYZmFcabhmNazfPjwNMIdbaUG3czeq/mv+/sp9452V9fRjeX3nA" +
+ "+uetKRd6dGlzfHRVjgAwXV1frY5IFJFDJHyc4IKXOHll1l7lpW8epW5ML2nMCWfF" +
+ "zdoNoJaHyyw0D1bEtW98yTVcnh6l4fNM870OjJT1pY+N9aOlHSOoPVAjvfOy6XY2" +
+ "YjllLzgBwOAG54zy9JMd5d5Q8hgek7RpQ8GnkrxxqqbKdNcHfWnS55Ncmdbrjhq8" +
+ "o7ZUGlvWBfCumh2vHI1+9s962fXxMfAcquYF86TrDOPl1vW8b/pXKecTuBeH0U+L" +
+ "2fGp45XJw718Z9c+sP5PnLvB4ymlt2KlHLXaTto+Lz741xvN7za4jqJInjts1qe5" +
+ "S8qL8mlDH49Q5+dZrXjzpsqcd5m9LldKpvtv4EDZ8DPrN/Putb32490+paWvg7pO" +
+ "vrlKWmnnI72+pedYn31Y0duGm3a9uBOGOHp0h1SV29OedcZxres3mbt32npptw7E" +
+ "xetpdUUOnblLt5m2eaqlyh4KfAeqHL66aztyzHfh69Zol/TfR5kRkieuPNq2+3lo" +
+ "JODHljhPalUp+OsY+bVGsXp3+KNK9OtuXLOAJqZoZPU24tuyRwnGurXKohrzvvvN" +
+ "a1ts2nXKnipqQDwxOu8bJI6ZfCCZCNw6XfbiBozK29Oz5zmLqvm1x9cipT7Klty8" +
+ "pOF329uON9fPvbr1pzeMpPe+Hr3sIHq4+uc3mZ3PLvZO09OHTzESDs426htwdn3f" +
+ "VRW3ZttTnnnM+rHbw7G+GlU7XPMqrzx1qcbOsdvGePMYn1vf33e97bkXTF7M1573" +
+ "x3nTpy0frx3VKHxzqqHTh4ED3htxzp0rR7w7XpnFbjBaMsMAti2WdMGWWphmA3IG" +
+ "ILJKMBLTKBQMAVWSsjIorJMWW8bZqzbphIxqPLNyrUqhpj+j5VOekvjvVUYBwAAa" +
+ "KM8rSbnby5mMvMGZKspWru7uiVau7t3V3cu7uqaSIWAE8B4eAc8bruXXY8ta9Ryl" +
+ "s10jpy+y++675d2EUSCjzzqZO093qYXV3T5vii7tdBPVdZIj3ygmbS4u+tw9U5gd" +
+ "efWVrXZ6tawSHPWTXMsxnk4iq+i56tphw8+ToZ4O5ATgW0MkEcLw296lNsfrDk50" +
+ "J1jPLRV90fWN0hz8XrpcPBenvXi8edeZs4mllq+utW458+TOnpnKJE+E9OPI7Lq6" +
+ "OG1pjRt3w5fVc9jp+Ncu5Uh7FTth7vi3HHbwktHIvTl5d+3CHhU0LhwySh1NMXTX" +
+ "faqcvPWZmV6OkmSyxFrWcJrWi1kksrvvgqr6xW9zj1ymeq4dcNajmbSDkR2mTlry" +
+ "5AnE7fgk9Tk978Fs2pXhPvjltkl3AXoF93yfjrr84+98655556eaKe/TcvX8+tDp" +
+ "+Pi1RQ8fdUu2pvFdMbdPAQGNN8ivU7S9Ryc166k8yJc5IdVFdb88+uu+/zeZveuG" +
+ "j1wuL35UllCnrTCt7IYcNxThFFbQtqjNZgXr60baY2hffWp4+ubvM/NIWzW5Uj1D" +
+ "p8eU+ZTg3naukLoZzl+a1n3vGta8samSFp7nvlKVuVxKevXTjTg2duJ3SfNK066b" +
+ "lwcPF5xw2+0cZJzrx68c3veNZrGOHXbTSSRwPSDE242fCWz4vTsVKYqOF4bx775p" +
+ "0xeOddrOpVXqcPaqqOW22WtV88c4xmZY7dL6ei956V67bbVtWu+nzM5fLQ6pS9sJ" +
+ "RXrzSp0cNSpHqF1oswXg7xoeipTO2OO3gSMFkwqyWwWmzzmd5mSrkIb9W0R4V052" +
+ "4SQ8m/L07yCFN+NEinDh32PHfHDzfDTYp2pF9vXXneZ84x6vcPRzRtDb1rS9KNoj" +
+ "G3tt8trVSm4nKzy3R6xxhOMVR5krVhMyjGXOrVEkqjaow3ghlCSpZNWBcVaxL3Fc" +
+ "Y9ZJpkrnJzlzh3m8wze+XP8uV2KlNuHovYPm99afPmu8VUqUJ47l3jmZl5eHCqbb" +
+ "HO7xlEBFcBA5Jb3t32Zl9tPvd2smGycKE9uyfDQQPDS8Ltb4qBF9a8qnudmpDwX4" +
+ "+wdtdWPrzp5ZJ51IafAcnZAsPkypcqpRFBAcxIYWs3vTR50fEtvnqdcUo/dUXwei" +
+ "bTydGiJ4PFIOWjex8NM77ddunuIT3rfm5Wc23BHly1Kmmj152czh1j2qUpWYqJEq" +
+ "vL10rcCedpLOreZEjlnPpzu3bt2Pe9pIbbhG5VdskX49R4c9PrbZr3tVMdOn17de" +
+ "nw+aNedrTuVI+Pjo67O359n1jijiSSJ9jstJAwAWh6D6ObOekTEOeh3nAr2g7ynr" +
+ "8xXTOMYFcwj5xiIpx8cwczh8LfyjzhSPBt74x6zvdzHlySLo8nCSRsk0eS6TRbxm" +
+ "Z3wnmxmnHMkNhygxjtJKwkU83mOviqqNjty5d4e44KmUaw855t7i6cPI8nbp5Sqj" +
+ "jbpFk2djdy3yk88pG+mJSHbOXfhw58IK24kkSC+DzcXXnNW612O4HXcPOwd+O0Fl" +
+ "8PvuZjsCx5376uzwIG+WIPHLtDGueXTEg7dMzfR0JnnGHYm9idAqLLCyKsqxZVXx" +
+ "lbdLKpppSUky2SmfGld42pFyh9d+861rCugePr6r6xOggdtdPr4hx457uTlQ/lju" +
+ "vcrnltjnbtqu9rUk6cL7e+9cX1mt71d5mJrs2PD2zySR16d72kTx67dPB2rKOy76" +
+ "78XpyWhUp8dXq0t/AX04768zWa18ejz5cuUnls27TZy4O2rxRtxcg11S6cfNoYO+" +
+ "+madlcs6drb67VY8K3zSk4YqtLvupO/Da6JNXUsg3mJLapKtWFixTMIxiMYqYxW1" +
+ "DMkpmVKMqXrbSzMt9/sqIqP+t/93+I/0n5Sn7T+QT8zf0X7f+TD+B4CttqUP4hlE" +
+ "RRRTARIfupD+YUw/Q0KfxO/YVFVv5cOFw/8J24f+hMf6Mf+DF/3MXL//P7Nv+9/D" +
+ "R8PD7NE/L5Y0/73/Q5TalV9v/fbLbfTY6Wd/hbKsn7vhvhcttfh9p/Rx9F7ThpoO" +
+ "zo/of+imn7jnrLbavsef4r/UcA+RPuf3Q+f9UqkU/8ap/+MFIjMqlZkqslsVZsrV" +
+ "JUlRZLa2yy2qaRaWWqRTKzaZooGCAwg+x/nV+FYg+fi2+gz8s/Z89W73ufUfZfMZ" +
+ "rG5jSeX2+tXiLy5tM25ZFqjVUHVXHVO7t3Rjfk7WWV5Xd3zfCC7d74/Bsvzb8BBp" +
+ "uu3U3zvXOnzxjyszB3F1Lpzy88Auvjt8OJfX88hg8tvPa23zrze8IBCEkACBACSe" +
+ "svoy46IiKqqiKiKrmbpczNUAkJJCTVerLbqur773rXpy1c6c7tea+Z7XygAnXQEQ" +
+ "RJmCo+i1VHsgGMnt6oTG4h52C6u8SvLrMP/waB4Bwc2A8sBaDwhBB/o7aeobMefe" +
+ "uPi73vZt7rVet2rb0T0fQ/9rykNCbO/hd3LcnNv0nxbJpOOM9dbX3aauDKzP4RVk" +
+ "8gGChiP3tin+2Ko0zGvv8rm997r3xV1pt67QJwiEFqEG2tbkdFH93DBwDjIPBfPi" +
+ "1V5aFeIAHWiKoxX7fYcN7XsJzs2YByCqCB9JkFUVQVTA6PRvzz5effmf8/OC9PMp" +
+ "C+ZtzACFV1K3GMDvG5p00Ri2rRwdRGfGJGZluZmRrhVWSvlPXhbVm0jUeerZfHWX" +
+ "OyPb4dvG7fq7d2YuV64ePXrvx6mb41zvjnrfDiqrwFcQ9VbJCMKmIWYsyFKsKZAp" +
+ "mGYZYsykKYZSrJYGZBVZVDChZKsAxJMKFRiFQZVKxBZKLJJhJTbbapSlmzRec3cV" +
+ "XShD4BDzmq1wkRIYPpUFVy20DjqcYA1wAOHwq+O9r3vWre0sCbAG9xdKyeSrfivb" +
+ "QO34ZArRrbCmGhJ6LPbla+t+POc5nw7qzbdSzdq7p0eJSUbVXZtq6NOrQouWy7TR" +
+ "Es2HZNRu1Stu7Ysi26gMq7VS751zzvXPF5506HQJCRi6HLltz9uN8Xm7zDLmXMwz" +
+ "p7a33LluY0zKuVZCe1T/O/Vl8LrrrqrrpOIUG2dJip/z1f+mv/K98HqwOlWunXPV" +
+ "64nVSTpZbdoyVil8PHTcq/c4iSP+Kkth+WA/sxSm2JD/tMfEf8rSNT+n1kfxMmZY" +
+ "y5UmMVMVJ8ZbwcyYSf/ThUxkMMoOz+R2qaP6HTarlv9RaiqxhI8PDkHT+8nW3ZOm" +
+ "t1jbpR/acHDtXbA6Tww1EzKi2KTySO7N2ZTCkq7jYh702RpxAodJwef/IaXmsXK/" +
+ "lMbLbeD/FpyuGQfEv6LSrGVZhmSxSSgoikttRbLU9uW0NrwxmKrwfsj9zZ07ekki" +
+ "Ej2irVcqtMxjTEjVXdf6P9p/KOcsyr/syrMkfUEhI+3yT4fG7atVVren4qxU6V/T" +
+ "taOFf5Mj/xYPqwPYq8bLlYHT7x9X86t2frOsP+5UnmbJUjANvKTCvZwkj4T2/Xbt" +
+ "J9f3uJLlxpGGJJwQ+9LUNxUfu/pLKj7vl9RwfBGH822fqJ8ukk8mkR2V7eCdNCih" +
+ "4rqR/FLZ4nb6xyNCn1IfeRyyRO0OnsT1CDQ+jZX2q4iaXcThcJadGG5K+NMY2w4X" +
+ "V16pdJLb4bb6ykpDJjVVSiyDx2/Ppatf7fHfqTzbxrUmrdbU+rGg1FD5mI/V8tSf" +
+ "V8o1D9E2nlH/Sfrsr/yHD/OP4SeoUU/V+sYwlSp/5mPQ/3D64aVkKRGlSewWP9VC" +
+ "GFgUGZCQwsROn6CqH9BPpvLYlK20kmjUqRVZgh9aaGzdo/4oxbVDFP9/xGOTxP+x" +
+ "g6H8uhV0ykMME8OXjcocLSqeqxYyhl2P6/5Hp5nNLf8IonRUqUNjY/DbO5llxWJF" +
+ "SKUSsy3EiYhPJ+cGHd98MzE64M+DAkD4YiKRisRkTDMpmR+sxk9icopWw4WnC1/0" +
+ "5aVMf79WMpaf9tje5Pm9MTeot7xUVJUoSR1ibG8TG+mE9pDBpFKsllWe3HKtI8x6" +
+ "SfEmFttpJpEsCWDSlS/NdtwJ44ls8MVRi1bmLU08xzI4bQf8lyf3o/X58cfuZXke" +
+ "jA9K/Wkv/oCpOX8AoptO3imxpWsWZVKaPlFYOn5ekY1bMWGWYopWjCWGKaLTIGkP" +
+ "wFSZp1BRTc+o1ds/D/mY0uThaKlVSilOHlj2XFcG5JxLZUjayIhAAACEhJTX703r" +
+ "bKxG0kYoRihhijZMYwxZWGEbWSBqVDlZMpZTZStskllbfWleql5taVJKGgnkxRrC" +
+ "VSqptInylG2SrIwx+wwoppFCiU2sGh/NQbbQhTFWSmMltqpy9NIxK+lX6Y+UYTIb" +
+ "ZDzMDN6G/c8HjdYsVEVWSZxbtU0dN3q1u3bFRfC4kqOpVSPLo0pZSIiQOFnZ0d4q" +
+ "sQkz4Qqa1DlekfEJApicdLA4a9OMxhyvFegkCmuM2yHU5NScI25iY4U24jHLltts" +
+ "7StNCk4frJzwu0Y6VjDDFk5RppNKqlRASOcpVq3MyVYiVt25mTCT+oTRDRPR2CKq" +
+ "KWrVqlUrlqaNSrjDopxKbp6upXldb1PU9s4hJGJA1VbLTiRJ7eok2sM+UHLbthMQ" +
+ "UFfLLbZVqqyVK+p1Equ3tpthzYl7KWLEMTEq4Ll3YoV5stLbid+m7alklmvcxMyY" +
+ "aGFGVGL1wYwx7R6xjFy7cn0pouDotHyZkzo/hptTZOkPyO1emWMxhjZLl04IdDYK" +
+ "mkh1kK4y2TMxcjHDmvtbZMWE+zDHXCnuD8yQLIjg4UlcKxjHr9gopzYxfuda1rEs" +
+ "eHCK6OCQ6xT4Pju3n5/X9kkiEj6cN+/vl+uaZ5gYN/g5JlAUHSDiUhoOAhwMFMVB" +
+ "c3DDHMN3DFulS0xrgWmW4W5cMuZhWta1rW21tbbRzrJVtBe+ulvYM/s8dPjcuY66" +
+ "qqqisgnSPat2gVwbVEysKVgXdk1QJsk8RJCBD2v8tenlrnM3edFeqa8Zu7mq1raU" +
+ "mEZP6xTGt6zMkdvq9uZwdp7PTR2nSvKidMcnTDZCbRQfLpsjVtrN222z1LI9jbbS" +
+ "Yde7dtk6DgycBMmW9OTcaTFMfB8NtuYiTvVscobNGKRo6Wb4zDniY3e2mSmsjJQJ" +
+ "4EQ2vqQkRVGM8qYh3v0q2rPteqmFz2k1KQNMUOrLk2hBsGYs7NRoFGZ5rKHrKVFW" +
+ "Up3oJ4GS+bM2pvedTh2+z59qcemFaIM+lnMKY/XLM2leOJtTiZEVfbeon1+vwZOB" +
+ "hQgviaCMyAjYhRqyLmywXa6sJtAjY0ekbBVdHErI5ucHJgQ4jsRIimS+VhHvLz2P" +
+ "o9PoKp4fLy9uDHljDyKyG7cVtjlTlwPJ2wD56Xk02ttipijbGTs6TRK6R26babRK" +
+ "3K25I5U6OTolR0fLt24J9HaeVeHM4svhpuNNlYp5eDRNLKaWrGQiqmZbs0Tlo8Bp" +
+ "tppto4ThGn0cT6OnAeX+R8K25e3KOzaUpVttKUnlUhZWFTasOmERzfpmb6O47lt3" +
+ "Whna6EmiB7nAKT0eA/sERTa2uhyCini85zJ/DpU/B/+m3fJ/wH9Y9AkiPcclOX2Y" +
+ "n/g2elK/4y2ikYKwUzMZcuJVFe362bbaGluwykCmE8ysyzLFrmryuvj1Xz/S9/AA" +
+ "AF15cn4TbNPgsRs7cOFV/dG3g0p+7T5dL60/tdkgpyzk/3v8imkP80cFiv6KUxX9" +
+ "LGz9Vfy9n0NI+HBMGjFPGRfU20/oK/wT+7+V6CiR4ktktkvJP6O5j9KtpUGP1T4k" +
+ "kf+7GZWMJ/d/NKP8Ksq/q7hRyh+q/vOT/iN1f/NGJt/f9yWf5H9z+wKWITjGZjP2" +
+ "GmInSyTkRo2qVStSThT8HxX8MximI2dIqo04dIbQvxbWO2MVGkVTxHSI0R/h0eev" +
+ "LpWSyT2p9GP8P1y2m2c1q8325VIvE485eDI9AlOHKGBw4JhDiv5HUmnSO00Q40Je" +
+ "rcSSy5GXLGVUp2n0eDpFE6T4Y/r+er5YqJai+n4MphhmLSwD8QKQoGSRJ/o+6YvW" +
+ "aSVmfLS2qpnMM9WmHTRzMJxy0qHVaVETOYZ1ScEwOJ9g0NPAmjGk0rStNtsbQ5MG" +
+ "2BivKYNI9Fvbiqv8b+qqdv6PL9GI+O0lco7fpI4cEi8XLlw2kn5YnpWFTwgTabky" +
+ "liH7Ax+fy+323r5BIEhez17ddXMxVVQFUOdlCkEiQJigNAR9MV9a+Xx16vk7dzgH" +
+ "lDoGcCQ74xnfnz3rzzvXO4dlaYNK5NOUkh4fqSweoaJidvSK2eXFtkPPEfCh9Gkm" +
+ "XRyk9PzmZVzMqjDGleXlHlJE5ZMZSrZt/Vu5MHK/2HZNP2ivmSPQ/6qw/Hu3mR+n" +
+ "CmQgJH8fUlH/NlVMZjKHCWNsfyX3+p/53h/1MZA1UFrEx/2ManCu/BiYs5NIwfyV" +
+ "9hsjSn/V9nhY5PhjI7Ullm1JVllLfJtZNrGVSVH0hBWtW0eniUKWCpQplb1tteSG" +
+ "W0qTK02llaKdJIwk+rhGI29xHeDU7WszdtKrDKsoRP1Geg1MyhiYmBApJgHZ+sFf" +
+ "yDkcXDK/ydg+VJSP5sSdLVsKtSHjkwmzZhbIuvbvTXnHN1BiMYylZk7k/LKCYDYH" +
+ "X13JBDq8YZURZWoixpkaIyJuN7+dTwztXv57+nThHDDHBkYhVKpPSK0UGMMYTbsK" +
+ "VqDzx4I8qh0+G90AAla9VKVWaW0s7IZmGGCsGJhhSnC6DSPacu07EkRI5jWcLUjw" +
+ "/d2+p5LbfLw/ft4tspaVjDMYWjCpQqLBUhDSjgT+k9T8hNA7KVTkkn2GnDBRs4gq" +
+ "HgJXCnB8vaJ5e0/l/WLbZbFLFUpVRJECIT7iSv69sHJkTAi1mJkzExpMsxUqaYaU" +
+ "miWTRpNtI5UcttEXFPVdQaiwV/wNOFTaFSaL45y+41lrMYcvR0CijhslcNI/0x5X" +
+ "Yo0kXy7cq/RMSNtOU8qn+U1IPp+mXMmZbhJ0PZ5BISOpVSySG3jR/pLeKmXKxwbv" +
+ "w08D+N6WzGTJkSeyhTax4Km0mkp+2qVI0rFU2n8SvhDnkx7T+ba3mQuaiT5PhZj/" +
+ "BPIPTKvh1If7V05H+Z/nVSKcn+SK/2dX9F/Uvj+tYktW6Y9SJs9U8H2+uGZNORKn" +
+ "w6+2/Cqtq2vpfTblsuXEmsGzllqypVLFYDCVIQ9J3NuEfwGnxGlfyMeYjQf6WRG+" +
+ "x+JPz9kl/QyP6sMY0xZf5xV/I/U5f+p6o7h0sRjp934eHA9K9T3ZcSNLGkno0CQk" +
+ "YVp8JT0vFuFfq7kInwp9TyTE+k95/GX6qj9zhqP1y390T8OTsAJxZv0pBjS09ndu" +
+ "/queeVeI9GunPNTJtIrybqni5552x0a9g4GMHRBAAhHYgg4OGOTGIx0md24x2cp1" +
+ "ws56tnBhyqW7W22GlI2+w+z4NJHpLENNvsSMmLVcLMVj9GSBNLTXNtfwxi4U4bKw" +
+ "MhtuWyY+2mWYp5ttKqpA6paj8vKRxEawvhY0NIfgfiH9z+yajt60n97P+eZ9rS0x" +
+ "W0+VV/0sP8sevxzxZkupTbH8sPl/D6tcrSqnhp05PlHCOok2cFqHB+kTvuQ+xWMY" +
+ "xjkg4SNqTWUt19K/fat9iuFW5XN8JyNMVvGVP7r82PqvjL7jtfwP8yYr+QqSfsJ/" +
+ "jvt2zClUVYzM/e1n9tRN7Zd5buwMVVKqRKoVR2YxVWrU0/hHBU0sekk5eWPDSfeZ" +
+ "dQOaqRT0r4rFtLHeZaEkiKs8vN+vcjw/CGRlxRVkq1SPDFexPt0FOvhPFuY6Tbab" +
+ "lve6MycQ4l0tzYO2m5eZhoWcZUOk7NTTLtwdLblt25Jy6YaTDpixoPYKKYtMSx4V" +
+ "/I+Nn+ZdTDBNJM+LfQOkttkfVOk7faSBw+y2ei5ZhaxgYP9nmnNi2FstI8cfri5j" +
+ "4bHPFumZbbbybHMpMg5WROgw+Q29S8lhiiGULhSjSdtjNpsyIlsyhYqxbcJrYw+o" +
+ "k8CH6HRjSvDSMVFQqqko0xiIclqrGrAw0hpi/ouV/i2foVy/oK1INsn/LKzEnZt0" +
+ "0/TfY/WWsZMkwqJFKpVKpSGE5kJD5cnT5T6BPRj2k+rIH3fSdvy2kEdD9W0T4tsh" +
+ "+40PbR+xRPpJN8azaR9OJJrfGcJHGHBw2OTGMmHPduPz+ryTH3/TGTMY0bTThPa/" +
+ "xbhjyxUTFkr8JJwYmivf1xmZJq2ySlSoJPBIfK/rASBSF+cM/nZk213bMmBX5laT" +
+ "Tg0VqrbakxFiRzCeLg1rQx4xf2Vq/pUjo01d0k/Vy7frMy3JIUqSKj8lG44ZP1xk" +
+ "y5bcTEsHL9YMZLGF+0n1bjZ+MHj6OXau8pg6GVof9Cv/Y9BbWvn632UMYJoMElJr" +
+ "W1JQhbfu5MliIQxxyxlFWYJJSo/lsdkj/9Utg244/f72xHsUqlRVMGPuJWipOBhj" +
+ "qEkxqGNgop68j+4/mhRTtlWMEwwuUKKdDCxGGldP8X8NFUz85NW01rD7NpifMq2W" +
+ "o7dpQsUxivU9S0/zYuHDin8gytmwSEj4WYqVwrKqFn2kfvYWyx06X1X93T+Vj5iv" +
+ "X+C0fH6nAMNqMKFVXg8nuEYKKk2Rtat7V7zXsSJCUSSRT1tPuvGtNOFnGGB1Pnt/" +
+ "MW1VDT4EQ56UUWLFFBZqjHB69cXANNLJbE0k2zdlNHR0OU056txtowmLOO1WSsa6" +
+ "mpA1B7TlxdF+0uvItZVay3b0whrGdccXinUpEidgaTHSdubVUqqtqqabViKw14Em" +
+ "JmDeVXXLyvKySljtLGMq1t/wTEMgWhujLDJRJgxkJlQy5UMlB40srBFeLlq7bpq9" +
+ "ptq0rbSxohSrCmSRMyzLLLMSFMMqVksswFVkqTKplkqwklGCsCyqplQsWLGMZZmT" +
+ "JwN3COMLWLVtt2fFUij5Hs/SR03sfZ5nglZWZjJSqn822RTBpyxvWHlVKjTbGVtS" +
+ "KqskrbRpKaRWKlUqSk4VwY4cYMNTGkW1bk5Mk2jbg0RUmojT0wxxKQVYhbbLZbFB" +
+ "oqok2slvxSlrqul/g7aXHwxix/68Toof7qkpOaD4wC2yq1EwXZiapV6/hsyJvBiy" +
+ "EnDHppUrseSqqll+rGDc5R6WrvWH+G9by3kboLdJKq9H7sVW0OfMc6vWl01qZLMZ" +
+ "GXXa6QEItcit7KxXTeedbF5N5WV5LJkt1ZLKLEMplYlj+iTA1EdNMJwtIUTETRhJ" +
+ "/Shi7iTFIxhiMSWYFgxhilFclagZLPw+zk+h+o0bMSmKxOFfTOrm2TbWXbWV6uG2" +
+ "zX+jEamLH9lX+6Yr/YLxH1w5c28qRqX++P6v9czJ/Bpq0wP7uyQ7eB+Vf7n/N/A4" +
+ "I+n6Oyqaf8ybStl8Wgvg5aMWKcsqRmLCpH+JHY7+o/ZUcf8bQ0syoa0yWdpVOGka" +
+ "ZNpjvIUVJ+ZH6qhX3fZFanSyHdkYpGWGxtjGKcNMNKwlSpDgp8KdD2cj9bMv9zY2" +
+ "4SHDkmkf2xkDCf6LKQfCpoFaOJ9BoH5TDi2/9rCRhPqSKlR9EcmpFLro0rH4U5fo" +
+ "dOMs3lzLMZaKYNommiU6RuIh0nD/kT7lH58Cz8XLMuKhGo2V06T/Rhf9p9apP5P0" +
+ "/xq2rWqv1erT/PLMqx/K0O2Dg/csyqf8VH92myX+Z8BRTxbZHaYmgsP/J9QmCR+7" +
+ "y/0+qv0fCnyiPJSHCaH4SEiYfT7Hsxa06QsXGmMqTClIxIpRFUn8jGqv7oxG3iH0" +
+ "WUiCZpN8b6/n1+1fkq7ffeV5XQXGJARn3MyZKRCosJhcTJSYUEP9MYaSlQxKRSo4" +
+ "T/usWhVI0Ps/HwzGMyRhR1q2WLastVljMZmYxjw3K6VX+qMduROGGFymqf4nekcJ" +
+ "jClisYLIPl8mk0rZwHtB+viyyk+VPL1HuRApl/cZMDw+MZfZt7Tx7LCpLZS/LK6S" +
+ "W2SkqS0scvTSTnLcGk28PRKVpMSUr4PizlmNNE8YGrZq/51JSfi7Ts2T+5Tuf5cL" +
+ "UaX6LUnQaR5PlE+ZyTiUqVaOZTHx9XDIqqOjpwldJmO7TbfS5VtUwninQ/6Jhf1N" +
+ "p/3sSnS7Y/q9Btj4/60tF5xmT9MwRXPy8PM4fiKUOh/FVVREYiiQhAhEa3qu3nv2" +
+ "d7+q9S8O8rb0Bs06WlE0arExG4ZViJk4YG2Gl1NmRsyoMpaZV7PclFEkhkSN7T1+" +
+ "jx5uV62pGsk5ajBRIogIzWpucxals3vLLZmGWmKYUqcpZRpGE2OC4rasjHDE4E3a" +
+ "VkxkzLZJSckySoFD8JNDSmOGxNtM2uJgwFUYSjFFUqlFGExq2zQorAowoxy2rlV/" +
+ "wdJPWk8RjHBV2lsFjhYX+gysyZkxh0f3RhVg/4UcJ6TuScH1VPy29yH5DloLCqpU" +
+ "qInySSwxRKrl+50K0qqo24TykjydiqiUngn5KlPjr2zMmZmZlXDMt/QmnwPDD7q8" +
+ "JHcLH4WjVHYxiwsKx8JjVH90Yz02rRwptHkY4fT6Ksmn8HZHweLk7kPRGKpyh/eq" +
+ "bPRt8Jw9H0f9riJN29Ik05PjeYzM7a+qenD4QbH4OfJwfZMB9ytJtyhXEiMJiVNH" +
+ "cUPwV4H6o7H3fBXSflFn+Sn3kdp9U/HhSqjtSP/YlJJT9D1KWFG1D7Gn2HR9iD60" +
+ "4ZhiiTUjaPujNmxMUhRQMUxVYpiKFSJkVJXJrRuOpD+nmZJ/LmR07HlWk3VZMyK/" +
+ "m/D6vP7Ztqy2BISPUCQkdu9bzXnqeuj9E79X9hjUSttuMzBuJcLcpmDmXFzLmW0a" +
+ "Nra22stGjRo3xd71/j7CrbuqNuCV+Pn7RiTiM9JJIEgAeHxJdEfM80MFtPnBMxsr" +
+ "AgcxJUHBQgNneHDhd46b0pvHTJccMlKYUIk+5RcOXp7Ryfl0Nnc0n5iTGzpiTkxo" +
+ "FCf/H09mHBodkFJS2Z2cs427TqZEjg2XKgms0uWP9EwnyRTKCH4BWvY2oHETm/gw" +
+ "zIiIJE4SQGl2Ck88xdoqynSIaAsnIZAHItqcqEkc5usa5371h9/ghm6wvaD++Ev8" +
+ "O9O1aUzFPwkL4FbXvIfOvp571rp7GmKUGlYdK/70n+m237Stjy2V0w2w6YfZFPh9" +
+ "Hg06PAx0ppwTTGGySp/LydK8/p8z7d2Zmabu+zmXHZJtVDh9axBEEQczHKc39VaV" +
+ "T4x8bLS/TE/iYRwjwdM0rY+rUH8HTgw/pHI4Jporpt5nzbKmLJH82WyJNK5mnJ4D" +
+ "eABtlKSyi0srSV+jHaGkaf0oL5Xqr49f2cO3KPHdVlOlxT2Lbotv5H7Pq5pfnuZz" +
+ "/dmMfvq7Hqnxosaf5U5j9bbH6/WKPbcO7bK+EPh5IfmR4cj2lOqW0RIh+qOFlpQ4" +
+ "QPJP14ba1ay0a5WMszhMV5f9J609T6PlI9nB/Z+ltJpZfELlyFYfUpiTUrTJy1Ra" +
+ "mlkyy1arGFKjH1SmRptiNFKlHlOxTypVNuJAVJ4ErlpVbYWdnGukOx25SUDvhmkJ" +
+ "SKvuGWZYZZExglQqFSfb9gSRHe26lLJVfZjBJ/oiPHr3rq/pJEQkegQkCw6m6pxf" +
+ "vmXePsQvn9xLQI6KSRQIAG3bEGfh7NUKcK53UPq8OHUkcacJyvTMdOk6aVZtbeXD" +
+ "JrDQwQRBjBWHXQ31cy5mBlRZ6IYlcEmEU04Y4cGEw43ZacPubU5VthDlicPuw5tq" +
+ "27YxgrGOOrbLbUDHk2YqK5Y+iuHLp5DT4+JNH2/Z8HtbEa9pifS5hRZbRbRJLmJk" +
+ "tJK4MBO+IfGu7xq/hYNWnTpGnT2zPJAB7pIdsgDnjwae+mHsZcy3KXSR8U8MMHx3" +
+ "67L6cwtaVLbW0oONWeD2UwAhlkYAd9PyGVl2b951gXi5PVcb8QkPLMTq0gBWTz4K" +
+ "b75X2bmGXKOkz4+PNebXzvhX0lvnW92FLBBb7Y5NtIVito4Viq+U3q3G5KxpPY05" +
+ "fL8uNtqqVHwkaYHg7TTw5Y28GPVWo6bO3c2dGOmk5G3CG38p48S6HjlsNF2N5UG3" +
+ "rhMMNpgtTb7iCOst5UUraeXaRgqdGFNmIlmjFNDbT2JT0+HDbb6fWUsvKq43XF85" +
+ "mSaaDRzytq8wj6ofRCj5SpbawpLGJ941qyZFjLKFSaYxiaJLLaQhJJAkhvLrtqoC" +
+ "ttttq21FiQaI9vwrDxA5e0qy21HycDgaRwSPs8Q8LbbbaEEqJAA+29r5V87e9va2" +
+ "19Eb4CSiIivrXz3xYwYxlsMdqma+mXMuMrKWCsMVUFYvUsRaVppRgxw1JXOMb3mL" +
+ "yozTBtdtNjDDApBMAoSHCRowphkwjDBucNtDaRKMMYKomhyNY0ck0nxv7WzTGIgK" +
+ "aWfqbVi/VMlGxYTH9BkkfLWrfruDbbbdSUqaY2JUcG9pYR+O0/p+5jB/JZUMKxWI" +
+ "qpUVIKVEVQxZMcum5tZISSZskAD4W+H59LNJklKlfGlrqabJQptdXKqVKsqlUqOA" +
+ "aRSiVP6PeBAlSQJCTLBC22236NPq6ejHcSd2rZE7YfVPKyfUT4b7fr8WyefXfb6N" +
+ "MyWzwG2mEp4bur6pan33d8BXGubpOl5ed4jcsltUaNEoRiM8GkA0MS2li5l+V2vw" +
+ "4XIm74fHps8HR/jS/q+HQ8pSv0K84J8+flIn1SJ6+UsU+C0c9Aop1HStKsYGMDKx" +
+ "VVbVX8PI4Q6YTdhxS2Nirbpbf9Rt6er8OQx00quK/pxvKLQgCMAPno3LmmAsuG5c" +
+ "3ARCCJ9nkfLTE07UWQ+xE4dfZtP3VPs7YjtMjphyP+UhGz0R9z8FYVLWVdq/Htqr" +
+ "8qLbe2t9wr6vumCB9f/1f4sdo/2GBgKKf9A+qrofyy5yaOmGMYh/zf7gpXixGz8L" +
+ "+5/xfK/0YL8tv7GR+gqTsvxJ9Ht9VkkLIxYsKqMPDNH2Sv8q0SrVcBPlIf3fwNJ/" +
+ "tUtJJygp7lJ+qPdeOJP8PnGm0/cbR/Cu1iq/DodIqyKlElfh9ROO50qsVPQ/KWck" +
+ "mmleZE/KwjD935YnpOIH6pJJkrJ2Ojg/KkmBVi22RUNKkxWowxU7iMnlaqlgNpJ8" +
+ "pj7iYnkVUWTvh03PCvJ5UwWAO+/U+8rwtQ/m/pYcu7dSLkkqlUIKb4AdxPxWQX6d" +
+ "K8cR/srlNn5QkJHSlU6YlWNKsqyjRa1ZMrLLMYBj6NRJ0TlhNqV6ntwbHC0tcGIM" +
+ "SikWx6q/J86IAjICaXDPuClJRcO8kmItQriaGCUlFzXDGSLiFQTqmfrNOzl03Ole" +
+ "IMWrYKKbCrtOGYDoM00bf+1W6hV/xyoRH9H1kIxEKqEqwhOh0fbf3XzNt1ZIaQ/Z" +
+ "Tcp8CVPCpx/rV4xb9LJRO2FfAhRPU75RFAhEnDwrLCvgVkHFpWj6sNJo0rweXtOp" +
+ "yT+x5Tl0wTwqLD3pVXSJ+5+RtPl5TqEhVD+w7piTk2lwGKf1bfq5W39Vr75V8q/9" +
+ "/wWTBGo2g0WqS2itFWqKtY1WosWrRVYrUaxWiqxasa220FtqxFVbQaNUaotGxFsb" +
+ "axtbSaLbG2tYrRrVGoitRVEa2iitFFbRqi2xWxVtitrFaqNrRbGrVFWsVtrFqoBZ" +
+ "kqzAMyJmCrMpSsxarGraooi2o1WxaqxYkirFkFgSQP+X9/8v5ZP6G0/tc4bk13k3" +
+ "JrvDkTm8Quc3Qw/xo2mMqVokQel047gDu6KK9vXSItvS8kwSVIXbC5SCkWVJiFZg" +
+ "hUtoVKxalLbdMKjlWErKlStSeOmTUeNgu7o2dzriub3bxvGBNRCbu64Y4kT37cPB" +
+ "IVhFJFkUhs5l65OBc/xyiJn9pvMTp04GA55Yats2p3krH/20yE1IIqJ4GE72HU7u" +
+ "YYM8Ubq87w0emUBOg4KzHejc5vnlBVjwWj2JDp78uxUmIZjGSSXv2+C+Vk2buCu5" +
+ "waLzxxtCqTeYuYkzGRiwWkxWMbuiWxbDiVZW3Hey4sc9aW7DLDfXXvBO8UcMOrE6" +
+ "ZHKIJJkSMuZM51ZhDeUpVpMillJZpvURzSaUu8TxmWyQ4sN1HLGJuVCyo1rGYzbr" +
+ "G6nipyrXO7Z7vS43pcWFeb5bU4saY8yVux4640jFLmIWjVTaVtUu6xHFmprC7jGK" +
+ "0oY3kblGmTI1k3ubEQo4klMaSc87iGrnc67p0dLLSaMM8WbgykoqxHuhUIiSVgcN" +
+ "s4ReusZ2W9pwcOl7l6OFfAh11ZNRZnWh576MW2q1bFKxVnLe+3xhp5sO/llybe2u" +
+ "6vZwQiJ63JuaKKNCGBLFFoua715rvMY1dJZyLBbrOZ5XV5qeIKQWC7JDCltJRnjc" +
+ "MWVKILJ3QpiLVSjwUMweGw6NEzJrF1i1Fr4tLGZjFiWmbSyagjBTJHzlDjD4ecQ6" +
+ "82snBkEBIfIt4B0kgWTyUekmpzCiQ5yh1wM4G8SeOG+NNwKdjDrIdZ3nnxc5azJS" +
+ "gWIWMigBFTrbdrcC3d1FulyStyYtcJGJReZlFmTVNTS4yPGPG6m4mU4UpUnHfhrr" +
+ "wWZWNdRvxxpo63XA16Gk8d9EE0Xhw0MmKiDFJNWV25mGqnfPHiSZDmy0tLVotC9m" +
+ "E3s7B8efHiO2NasFiqCyLUrMVTLjOkidBUijvl11NMuFdid4Pnq556pj0CZeWiKi" +
+ "RE4EFhe7nIB0MWSoVFVEKlEgdTKChKRIxmMBSnnMiG9dA90RI90p4oXnQyoVOzwO" +
+ "XmFFm7kU1EJfOeLl7pwCnXR2AkONIgVXEixG8HO3zk2uUXZ4KDRPGOMQcFigu6MB" +
+ "AynwUr5tMSp4Zm3S97lkYwrKbmYdS7N0thbaW8cMcuPGm2iNlkxeVSsrDdwwNvjm" +
+ "OMsQWV0bYCzEe/EuduWNOYe4t4neTnLWQ7yaysyt7Nq5jW3w84tro7rFbxrm3ROc" +
+ "yItTKia31oMVVVzMmKibuKkZYOb3Z3UnBYN1JxUtiasqwcnVw0qRd45sTvWJOrIZ" +
+ "cp3W8pbyud6rMm8TWW/KOlHvrjW2vNJMEmW6wk8+aSBDqHZe3wLGK4+WYxQYao+a" +
+ "FMLu3Zia4DJiYsHLW8vWVSaquNQVVUQ7dSGGWs7cgmMXdseVDzwzwgEvmRsCB5fB" +
+ "QVQXq0Zj5wJrB6UFaTgUTjAXmHe6AjIdsFIpFIYZ5zPJpMFN97axjrOebjescSIe" +
+ "OlxIjJYuYzMCWWMVihKxiTtW+9a1edTMrhldTnO8F0E1nhOr4yVONeDjTro3vk4e" +
+ "VFXbfM/6MUFZJlNZZ+RMiADvEl+AAvwQB3/wP//fyr////pgQg94DwHe94+e89AU" +
+ "H2NBDuwvr6eX3b72JJyiefd58+Vd8GQIqkiC6wJSbBm5uQAAAKq7u5JKoSaaqQKQ" +
+ "l21VBRUlVJEKkqkqklKlVSiCooVFg+BcYAA+7T5I+gBL4hzdzp5AMgOtGq4ADa13" +
+ "bYpbuB97AXvu0OR1329gffKPus6EiQIGhBMJE8hNE02U9Q0NDQGhp+qYgkgCIklT" +
+ "0IaaZADQAAAAAAaeiIiUn6JqJgaI2hNGAA0Bk9QAmgk9VJJEyZJ6npNlNNBoZoTC" +
+ "NDaTRkD1BiBEiAiKRKekw0mIBpo0aMTQZMjI00YIkiARpomQhkE1EfqnqNA02oAA" +
+ "Bo53OJuRwkNrkuMUJOhNQiCKMocWFChEEQrUGVTGgg0sMW2bqgkJBgahUxttdb03" +
+ "1poJEQAhSSeqS4RwucrgpgGDRopQUVIkNExkDQSGATIZGCmTCKIkUjZJZESZSaMx" +
+ "BmaRQQFlNGJKRIQihnBz6Pqb1dXa7ucrjgmcuCGgbYNpgK8AKEFIr8o4gKQFwMGj" +
+ "vveHmstx7CuEmmgYnRQhB3iu/mzlcrWdLQASIoDpmY0D1WpCxNppg6VoTStS8btY" +
+ "ssBpPUaC7k8vu+aXzwycRqJj4XNyCaEL8W6PxaWpQ2NtCG2kMTE6TpoDCHUaLpoa" +
+ "W1Dm0upHlZaDritXaTgmhQQNtsojjagMpMIthjtQ0xZUttPCv+T0I+nD/mkZQ8ZD" +
+ "zjB4ZdHI+/AJQaEvDFvWEt9eecKhyJv73XRVYff5934ryHcPuxRvk/OTX8AQBAXI" +
+ "YIooDEBEg2yTSZqtrWliJNFtWstQg22mzaljNU2WpmzNipNtVbdVtq9Gq1bKqplA" +
+ "FijAQQWAEEEFi/vVAFgAq0IILEWRBPH+qAgv4VAEvYexHwNTvPzKQKnq9pQt7ith" +
+ "SFQE3KoT92BcQS5rF1INoi0BQOEBIieUUBAgVIw0feYQlJIxilA5IyloT2iIDEdI" +
+ "qoG946hlU0gdFhujgx6GOFTZJSSpDwQuVTcllZOqH4ZyZC0BlmkC4cCwsYRI2uGk" +
+ "ouXauJiysgW2UY5iFJOlmzOCGH4iZGZYXJxDLdJ5I+okgLjdFcGyxGcTuXzC2QNL" +
+ "MmgZDlHJwpxaWwzw0jjTdXZYSK7Qr5tMVE1KLGpqexpkXBFICAcNsKQUZzMFIgVm" +
+ "knN2YKiGSuBbRzatIQgm+KaQZAS8uDHTnWrudlkM5iRrvStxKFwKKVWkrxS0Gc5b" +
+ "46jB4beDQDNZhiAYwuRpE1mlIxJctXj6hyy5cxgiVA40kzeEpxsaUJjkvd5gjFhh" +
+ "XMuSAhJw0YIxgxczl8mAJ0klHCWrkkchWY7a9j4Nu7SQ0sThJQxDvI40wEU4mYE8" +
+ "5vWPNKDdBTZq8WAka53apCRSSNpCqgUBIEqkKIRCCLDdFlqlxAohLqDOd5oy51ju" +
+ "LwUEYBLpqiqzTi6CEFgheJY6jhnYUa1qiwwzdN4qAkZJTTMxtG2YbaURoLQYUs8E" +
+ "LNMt81O4S4MhIrqC8Y2RJqiBikskgX1Ls0fwJ4OCaGBlINkgmKE6hXECwCkyUOuw" +
+ "dQqIBJJNGXYw2m6AgaYHhuJJJCxy4jkmrBKJZbYWNXa3ElQyVBKsZAmKeWFLmqL/" +
+ "aqWV6VDzrw/jTfYq6/bw8pT5+4NHZ5DpJIDo3mpeN6SJGMka7izeeoko43C2Epfp" +
+ "g4TpoXY3puxOTFNpHLlJkTMJ/cig8exbJ4wXM1wqI/cnSPX4zRN3hNeGDNBlDPCc" +
+ "RjKdSlEXMcLYVo5zrESzdhn5oQgF7Vy7d/xXre3+0a929Re2659oOIpGmnWprpit" +
+ "uWOpOh/bvzdU3UXeNVH5d/XiT9umGfzpTP5/9FU8nQ2l+WGPykDtzW8+x9V9eEZL" +
+ "xXZrntkuw70ekWyrvMhHrucZm9KfynpN9pZTE+0MTHTPffeZ6Ne/Z488WceGj41e" +
+ "xPJ4/IOaZmtZu7us13BA3KgkZGgZhXkEnmKKSCdMrtunVFC2hCzVzNmb4pa9MrfR" +
+ "5L368R+A5cTbzcuFIBItqqa9ZJWrv440HQdtONRRNMqQLRvCoXjJsHsNjp3oqjTU" +
+ "nuUk+tSSqY06SBeONJjOPZlitBWP2Y/a4myrWhja8Y48ITl3w70cPAUvOLu3N73x" +
+ "oNCWxRXKJMZBOcsIiYNsbb6IqgA1MYWCyzFLX46tyDIsrZmBdV11KBpmbcG2jSmW" +
+ "klZqbJwQmXHcfS+kqBbvzhoFYwQVevOaUWDtMkiQ4OL3wfiGhdLDJF2oWKWCGRKi" +
+ "hQlR9vBWB8QPr7h+/XlnwgBkZ6IHoruquvYHPb3d2c9Vu1qFs4DoTfPOZy5eaTfG" +
+ "EbeW2TVkZWcjbLyy5fXm3YKb4ufb/wb81JfR8qaTCaWBkN5OAgOisFhTR2+eXXkc" +
+ "3pGtx5da9R7O60uzr4vD1ctQeFni4kxCBF61C2yR4amYWm6emxGhMsrBSNygglLJ" +
+ "ju41nhlzS1oTvHIJ3iKAtp6aslyLp2Xz4u2mDjOOFZxL3c45xPx8u1djCMsttzHL" +
+ "vlwW7OA48Dxvhzz0vTvl3lSnfgXC1bTvQOQPN9u0GMqUZDiUu+0SqNTncw4JrOJd" +
+ "C5ae2h229JhHJcsamPYtGY2nqSYKK7ZkCWcOaeo6wnA5uE6UmOicOKSlx01thtO2" +
+ "U5RWOvTw6+Fysmd8Kd83F6zpjTvnstmbnM78jhR6FmzlfenLa9NuMaGgsxrWUpGv" +
+ "xczOq5bXKtNQPDHEHk5QkHLA7Ei3HDC6vuGTk25mxRUpKKkrlGpasCNz44/k+3tD" +
+ "wDe5wjgdDHrPy8gsg2W5zWGfiMkjEJmgQcnm7BcPMOgmPy6pIvZOyXeDh5m5rpxh" +
+ "u2O72A7GexroWfc4Pg/Hs7+FoQ8r9jIQtaxoXODg+TR8z0PRzeAOoeeRuMi7hdOS" +
+ "81h4GqNyguIRmNhQKnFMJWaZLQzV+urXgFRWKiY8ZIxJo6GynpoUkgAnNj57hPkk" +
+ "CiIEgKoYhUZF/EFX75QYsoLiXAfylQHsFzFbiMlVTCoUCVRu0SOlVOuaqN2WvP1c" +
+ "77nObXJxriiMINSQogBTFkqqmEoC2VXvQXneIkUdJiMdJihT4fO2rWLdy1y9kXJW" +
+ "wjNZBRy2pfGS/8Lwdy9Cmq8fh9iYjz/X4mvTlzXpX65f5J38LH6DNGfi2efIIvIZ" +
+ "10n5NE1kN59vlWXnOfKiq7ER8fWpiWWAkhS+t+LrfbL2atTnX7FlB6UvlXavrdWX" +
+ "HX4WKTvtWbyZlXdbue7pYypbJ5UnERU0llbaJ5ZvPfC98s8bTLO12ZXNItLa866P" +
+ "2611pp3tR1vrwgjnvvzhWTmUw9oSQv1dZnBnZnRGfK8QzR5ObplZCCc5ujfT9R6v" +
+ "JL1s8iD5lDfnIokmLJsX6RI1PafLCcKs/Tg4AkOMBDBIQit/raxnAKMUBAZBr9yq" +
+ "s1/QXIbVpWgIAgmEILgYvh0yWOUmv3jAUfKBfkdBqK0fOeYVyHCSZHQ6VMFk2HIr" +
+ "sD0RNdD7WUaPgRyIZcjoUkiB+YRfCWIeIcpVQPm6Q1BfgQaJofhQUEMgZOGDeJA9" +
+ "IPcCCRV4AUgAYPdw6IdQASI4FnXKQHmcg2w6ALxIMpE3ZaAxxeCoTJ0HTJEbxQOz" +
+ "vOl4O5xZ05zeiMkPQD3Jg7lQsvJS7KCkLTfpQmQlEPQs76EiGVGr9s8U7Q7yKUh6" +
+ "XQJAgcEPOW6rmfKxk0kYB6NnWeroUq8BmBHowHKGqH4gESifAlozD0+eQ0j4kT02" +
+ "LZ4WaPDW2w+IYtHZeImTcCWCRQLWBxyHfijRhjIpsF6jmAN08BB4SheIvMCQv3O9" +
+ "IBxhPz0SkvgHt3FCKbZGAMBDgJArIhI9BSIY8gc5jHmj+E+p9S/UAPryP36WOYnx" +
+ "34Ii7m5qkMm9mPRFNHfnTkYoj0GQr4OOeHrNeCzAYlhhc5B9Dx8dhsYr6Q8qgkWn" +
+ "ZzILYoTDz4BIKReoEWCYEF+GtaVpIuJ9O+zUiaxtJE68pepgbqZg0bMuPgcmlPnY" +
+ "g6RPUYjuCge0Uj8+CFpsWlfLghvvAgHOAUAaHOuBCwTEJ1iNdj0An37bTZlzLF7r" +
+ "i8nzHeJWS8Y6zJjrLCcqH4JHhRMidIZSkw8EIub4C6LDowDzJO0NYq0kILgV0Xug" +
+ "kCCZveXnig8iigRgdCLAPCpCoaA8AMX+M94icjIEiHwoKCEQhEX3HtmPnzHMo4T8" +
+ "NPcs2WZJYUlDwPX7E5AKIDuKSJ5wxZlKKsPwLwU8KDrAPQyZ+Jla9ISK/IHBC8hL" +
+ "AJi8KMiPQXfpqpK+sINQSQJGgioXVwYxvvIhV0sJEIsZpIely4rWA1B7CQPyZJLQ" +
+ "OahcYOxhvMPiDui49WezMfDbrdT686aJ+EQ2kJErap94yg2ISh+eqqB0QQPpBERM" +
+ "BBR+wkAAH2CA+KJEV+wAFcxBkBfIpkCZ2gULsgCIciHoB1hJQ9gIEguUgoVulKgg" +
+ "ntUcGAJr0oJHR6UMgdYB4JHEEfADtXgvEGyLL8+ama2oQMkPuYKfH8tziwAEEz7M" +
+ "qXYXsAoQHsjwQYik4/RunvQcfeEFs6nFYUjPo+WPguYCD9BY7j7j/PYGCWLpEvWu" +
+ "7/IZokD080Zk5wSD1AVqPRbsHEFBSr0sXtjlDoV5UI6IgNFeEvHffv4n0LiGvfQ5" +
+ "KFaH4Gqpz0Mxh9UDG/SNxy6H6DRQBcV+sBle8GiGx3QAXgqTMlrqSTAkr2SSQEFV" +
+ "9QEYOxHymNgdkGXw8Y+fRsHrgXw0GR09kMpCq5MlDiZDzgGOLxJuHDgRqQOet5Kp" +
+ "ezggkS1jSF0MO0JZ2yqQKSLF7UIgkEZK5OM/HYXOHJeOW9vBr8HHbkuWPxox6fms" +
+ "GumVzMqBnqecSQsuBDogwNRVQM9eBnKY0b2gZRHesEG2rOE4hkmdWB6V5y1KgqA1" +
+ "BGhikPMUQmrL7akye+mkvllmGuOkpMekkiTCSRACmrhLIlulAF9N5rthlpQ/XQkp" +
+ "01zssYOxeeIYRSTWbG2KBe2SOKBXQ5DU55aOtIvBbCk+zYig+CBkc6wH3bQOiaPv" +
+ "iscLEZjILNSSmX9OdgQXgna+HtgT0K4DwhmvgWOYSV0NSQuh8OHmg/ExtAoX4Pob" +
+ "q+dVHoXJ7hVNiGlVA2bGEGEH1bRIRBDhCQDs2oQtWIbppQHsVDJEQ2qoEALIiIJh" +
+ "iA5Ibr489zs18KLdIk2wVcpFRBx6+tiaCCj5EMxEzMCxQyTxJ8gAo5ZcS4gmZqKG" +
+ "0IlJiAbs+AEAgERPIieEQN50HzB2KnFiLFTJR7Q0qNQ4QXyCtKqBvJY82LSiEDtD" +
+ "SMDyDTVAlMx1KR0pMIRUiJ7YF7xSGDGU8MEIMgEjhWgojVGuXwHA5gtwUckHgZqo" +
+ "ezI2FDLsfUAQ3ZjoWaTPcjarhqjpVVrhZIQ6SsgnCohVS0itMJYhS0GK7o0K+ky5" +
+ "Y7gH3tCGO3xVQLLkMHlUMsfgQTLECRQxOLscliplNO4omhGOIJICZNgKF+kPDnyh" +
+ "3ErwNoatDOLWiFE0bhwyOBJEYDfGHjaG8xFtMBoWYA6HNgFycuim5Q7p2qoGrMrZ" +
+ "iV9I6DYoCVwCNjaBmh9VIACEQL8wi1kyAWKD09rwynBSL7BDbiUwABZHykpFUzkw" +
+ "tIaZSwCn04GkNoQOlasfSOXAYa64AHCJyMVG81eg8guTY5JtM+Empxh2Tu34PTsv" +
+ "KYzszJQ7oZY4pJ7Ci6JrOjEozq8F0gbgliwihrt8mJA2tda3aqkAfanxBmq2ZHU5" +
+ "0MvBycGZje43sNn5CYiGYNwJBIRNj/EqmR34YYffKj41OKr74Ihj1OnAC82B5rJS" +
+ "xuPCk5SnOICrQbAWFCMDZEMllsNkyUZkhMzrWJAiQm+4YC0K62MK0mlrmIc8DWIE" +
+ "FjI4sXzhL8vpkYEZwSigrGArDcBGj0gGFAr4FqGFQ1SOjTvH0TulJ1XWHAIDBQFU" +
+ "2BL7SBXa+99dSAvxCgIPnOIVhPMmTqqgYRFDUUEsUuxDfjmwMpaAek0+O9i+KyRp" +
+ "AG8DGE3qEdlsT9H5BPmUugch5YLMiAwTAkdnj7Y3zvRe4V3q41uohGNQNXT1Czcw" +
+ "ZOHoCYis+EOsTzziYOV5ZAwqoHrl2ATKFHnpRssDzmLdSlJDg7CCwocglqhuE+Eo" +
+ "jpsHOFogASPtXBwKZ802h3flM1s1tZA8sM4cPDnAT6uS6umbSt9nww6rDoI6wdYP" +
+ "ABwCkD4MpyWUDjtRIBzdU79HbBiX3vcZZGYTeQOlZsLH/hj78oFxFCAR3XQLAaGA" +
+ "dDiPltBD5eyxp0sa6DUCQ9yB3omnTqYzNOQ7dGkZocqlwqH9pIRCGyUGWBqQyCxy" +
+ "ehq7n/X63fbu3lvZivHbt2xc3MNMke2l6Uc4OiBRsMViTMcmSUZzTiouB0cMzMDc" +
+ "MhAn5DyXqlkdoH6TOX/ia/RnX2fHg6KQTF18xSwHCgLERnIs7MqnDBCuu5uA3wgA" +
+ "RixX8J05hR8PDApxlQIJmGtpRVjPTQ4WhDIBRyoZ5o1kdEjBho15A6uhLHeFCwXL" +
+ "+9soCWWtfZsFJSQSLh/i4cADpq1VAz4GFTiJjhUbKosgl7B751ekmAW8qEBkjrpJ" +
+ "Tsj2D0AkIBD0X4qoEMX0AA0zQzao5o5TTzd5LNDKrnPfRfO1p44OgI4xIzjnvqR2" +
+ "Kz5Gwg+DJUL4dAjsyge+pYSePvEmKovgUXXilLjBfO4fT3oTYGwHVC0J2gKaO2qo" +
+ "GfZ3ymu7AqTWofKKHc998pr01xD2hKFgCFCO1eIWDjYeGgvGgWPaFTjzJlNzf2GX" +
+ "XyGuBywpbCI9aM6UO+tOtaQSqpWu2BesY5kXgwTFHTUPCg+y8oeXVwQ7yjsYrMak" +
+ "XS4XXDAJlUBAhUGk7oKAYdKTLFPcGom1CBxTjSRRsoYbfcOs9iE2BKVx8w4aN9z7" +
+ "7xds1BTpEnKyEY4TEIk3XeTS9hcaRANIX4k22qCDj84dwRJjo5YkxitJJAO9xXTk" +
+ "OFA/MS7JYZDxNviHhoYrl0bDxFvhTQwSQimhAnQFiYoaaHrMgkYrCOGBtDa5Bmne" +
+ "OFKwdG8DmOpCyvhqGYNRcB69KAlJSFA5hCUHKDE4GFcRwyRmEbfPPpveJJIDaQgw" +
+ "rWJ/P78yCMO9svE7GZpvnPSWaCtoEgL2jLabbxBVKIsbSY3YtJJ+NjNh8b8AilDw" +
+ "UPusGoZAu82EYImSRSk5GnwVIKWpSvFeBQnOAdAMuTV9DgEQgQgvrro7JHSHZZfM" +
+ "JCKmTtQFOCceAYcT265PCAg2SE+XhMkKlPgHB9+HTOoLI8s4BJuk9F7wqDCjRw6y" +
+ "D8yVeukRZ7qrFZYrAMMmhmgFDKEdZztkqFY4HuEkfuhz9pTsXzFtqqB5Tv5gsZ8h" +
+ "mh8x8wAfZSHNyDX0vZDTySL94fOjqfD0KHsVflvrWX5ow8Q0QhFVMbcpmX80Ezgf" +
+ "HYjMuA8wLy42E7Sz3rziuCIB2DsghxkkRy0Bzp6FVAA8MKcFvSjqknlxdHAT0wDn" +
+ "07kBQcd9oLK7tKmnZYnZZrh6DrhvciJ0ss6vdzXdwMQKJMWT7tXSHPByoD9hWNqM" +
+ "OwE85ypXmQLQwbXSkJWY6qxCwo6HFcFLCAk6bCVHFyYQc5H6Ezm+mNHD03wkk6j7" +
+ "m480R07W+QkhCKSnJVvGUvBBlRzDZDeeaNvGwHd0PT2wTy2HnkWtuMhkklgK66LZ" +
+ "BC6hKMJnOxOpo4YaB5V7rgiiWQXGCiJrYk4Y59qslhcA8/XJNJQLb+5tUzHJCBgj" +
+ "Qx3GrzzHn6xmZ9A0PtV9dbezpCHExoEDwlrH8dllA4YEY1mhsA0dIPPsj4Mi73vz" +
+ "nrsvJLs5YqABDfroHBg+ShQ0IgOs44NI4F8CIIsVXHQ6z3KS4MOhdxigYOImz2UG" +
+ "gJAuBhpsgLrldXnhNQ4jLCUyTxyhrIrwuyYrqo6MJzQ2Wl3AdDzKOb3Cydryz5Do" +
+ "pHBHMKBNdAOAdXJhYMgMb2s9Fp70MSClw9KpTbdzhHAuMGAtobHQJ2SURvgbbhyt" +
+ "BecsuXl+2jKigzt7goBTjmpC8RowanZdxJOhWjwhwrm99FSiJ2OgLLnm8pnjT1Fc" +
+ "CXCc0JaZijcmjpDACeVTrZneXxGRA+184I985kcHQIQIEFMgWfO635rg0SZSO/at" +
+ "HtcUKa3TZ8OJoImYsgRoKAhiZKIBUsG7yTOFlDFncMU9EG4CMLUKMxbiCaMDYdhs" +
+ "JSKdyLFJCQmviCCLgGuUz81ptojXx2oe4d2iHnAkVSdhzcfH2K2UnIQ9u0F30MHB" +
+ "OBY0UHMYYjgCQTAWMbwXTZQXaOgnfjckJ+BO475Zyfo8/R0NlEMBq8c94sZJiNrn" +
+ "yJ8OoMIDQPjt9uJK8Rk5aFDYbJfWSynwRhgIbQoB0+IsZPFGy4yADzZLYokaBywD" +
+ "CRmTeH5tmhDzPmA2rD32gaqneqHMNqA3FgsMePDM9KB69ebN4HOAhc26eoGFI1QJ" +
+ "m898wsO5qZxBxcWUgvtw5Q8AMEOOJJ8HEEk6B45ZyIoFaB5KW8FLb/M4KYSZIP/T" +
+ "y/DoMk5Ami3wPAH8EyWhTaUsFlQ+g6AEFdgHlJWNLpOCvdk3q+hWdqbTJWRS1dey" +
+ "wOAQwQUmsxpFozUQbFTRcPzhmHw0BxsEHFHdI2kUHjDkRPSGAp3SUo8BEdPPPTw4" +
+ "44KbQ4SZsIKdYe3WCo1EtM7zKTu1VAoZ7hPFDfU88SlCY2aHVSnVAOBA5wzuGlcH" +
+ "Rs8STcvGCu0xIzUFjkwcvlheRAzgRbJkzf/N0YjQwJYrJ16VzC1gueMTW4Rt5rYT" +
+ "IRNwYQYtHOtSD6ShBHOQzP37jm+TT/gvnq0DgyDuezyZv7FGKF8j4kpFLwakHPsy" +
+ "LSDphCyxQLl7xgnr+Pl8wbTsF8dx04kwB75wFRLdNRIBmhw2pH3UCbB9EgE9z5eI" +
+ "BPN3vYxzTZ4nEgVR4qoGQtM+BuGwlgV1WoHG4EaoNASMhGBgXYFRVYIXlASg6LSg" +
+ "GqeHmiyAsDilBBOqQsS4Og5rap1miKqAdUA6AdYTWmgTRQWeULDLBzlSEcEEDJbB" +
+ "4nTaBTC2glnEXi2haNhLoJcdgCNAkhcqbCc44gFrBrre1RE7eydRrtb9wdNITgOo" +
+ "j4QWulZiLl9z7V6DbnFmgcimAjOFhQs7UI75C551aKdXmUEHKSvEOCldH1YzE3wo" +
+ "E42BxwHl9Xk7YSa0g1vV9CriIWOztgqD6DgKN3AvOkS3ODdnTdtll+abk1SRIIGv" +
+ "fALBUOBR7ZFBZ4BUpBnSQ4hFHFEZ473Y3P+zY7O60Rs1LaWqHHIcwa8txlB4jJJE" +
+ "w5YZFHWAZUEtKyoIGdMwDYlA+A9mFgSZbOw4M6OOSmPkMl1OYzvpRASmvvXmUjTp" +
+ "8joGG1lR1cQpEEugzJBUyZnlygzInkeR9IZ+wHyATZQgPmd1ZmIUecB8pAzd6P0t" +
+ "AUK45zvDzCusNxdKPDohseJeeAI6ZvadwEcFQCRCgsXNcDfG6wqIm732cGQgwkIA" +
+ "SKEgydIjIZQ4a2thurU6wysrTQQglytZnEFtKoQOjdqfOmiDah274ym7EDxm9s9L" +
+ "CegGgMopkIt4LQ1Xtb9yBS7B2LUpK7hUpgHQVCXmwmbMOQqGHhGVvfpgEjVDoew6" +
+ "qNbwaB5vajnexW8pSBC73poOsSDMENqjGDoVUvvCS9M4jdfRrEmuQYwM5KDSHMK3" +
+ "B64lqG9DhQ0JoNQHlDlAPccRKnfODi2TDOoYNSZAcBzrUAVglyHGRUI0bMziEWOU" +
+ "JYnAOUMt6Rku3X2Za5l+nJIHiJXNq4xzccGdzaqu4qJJiDRBAN2TBKurol+bv9SB" +
+ "CSAX8+8Hl/r7sZnxy9PYe6Z7cvs98YtZ/SwPrgMD9OXynBh/XzxwXwdWFeXp/iVD" +
+ "kMgNriWpJDP1n5azCg6/xxxEvwpxkfhIP9s+2nQ/fn4vF9+jJ+ngfdWL4CPb5czf" +
+ "UQwvVtZEuz7Om9iWrwP/ePX0KAP0+V9inRoSgybccCP6dPd+K+f24YnQ9YpYUGst" +
+ "TKKFMYQdT2HL0fr+fbVW3qvv1NLVbRWSUrVJUxgSVjWktRaoqKNrFWmUUVMjUUmp" +
+ "li0zKazDabQ0YKDYxZMGg1BpRpYUwpQCMhoC8nsJe4+Dy3Xr8S8ifkOz/vaP7ETx" +
+ "FiYoqdkOeLbBtH+bHadmz2QGsccbGX7OU2D+LhZDxGPjMsOyV+DZO9PSeDPkEcZO" +
+ "SS8UzBJ+ecnUZhlZ9ZyM/ad22YYrjBcAz/3V2B8/JiuT7ED9kw+rGGSGmqTbJiMm" +
+ "LSysmTaS0aks2bSzWlZtg1EpSSYlNkqItCalNFstNttqaprSmpS0pqU1LNFgKpZV" +
+ "srWWrM0lJM1bEW0qbEmiLVtRGZUbSprWbNaLUqaks021KtbS2RlllbMsywtspLGj" +
+ "SaVEzMYk2NmzWptlrJWmSoRZSsptlZZLRGTaNKm2LJmmyUmSWRk0WpqlUZJJiWlp" +
+ "tkjGjUy01TaUkrKzSlLTMzAbNg2KlpJMl63e7/d+ENF1fgGLHuf56NGdqOvg7hSN" +
+ "iHHED5NKzQnm2yaAQJTIxieFJM3ij3X3qh5AHBhk2riuNRvBd1dJNK/o55W5e1NX" +
+ "ks/nngBUDz7INtUfFdK0JrgNgbjAdgkJGRczQCngL6Zh4BT2UW6xEWOCC4FzQuaj" +
+ "OxoBErUsV1z6K8cAICwJGRj6fB5iCC6h8QhiZB9qLr5NFyCenPzIPnc0WwotMInx" +
+ "4sAoHfMU5HgU6hhRBkppj/FgHNLt0ubr4APQXPI06DXqSSyDZid8zuPuLwXKN4cj" +
+ "jq/w8zETQQQXn+w0DiEJEiKh7fzQ5LMfgQXmXrdtA+sBzTIigGxVCwsOYhmJycnC" +
+ "CGplhE8/sdAhQXcsIRJFJISEJE8flHQO6cgR0ZCoE/TcCd+BBP7orIml5zlZgw9K" +
+ "QKKpGkiwgESxpnXK9pYwUAa89ij5sPoUYZjQ0lyAcxQc/xtRzIOJISJHL7Ny0JDw" +
+ "BwZa4MDUFR8D5CCCwzTyVsZejnQapAVGYICC5dDXtXOsmZXMO7mFWN7P56mEGIAc" +
+ "JHHBsharUAUcAp9UrviBIAxJ08i+RBO3Ah2QAgiK4kThwo8sDCf0aftxqENQKMTv" +
+ "TZBCNMVoDJwdi4fVhYNQyMy4KjH6SlEAvexZaMCmxViqK0e1JpDA33Zg0xuGQl9E" +
+ "hiQvQ2FHNA6XqGDe6CB3obIHAhBD+L/2H7JweCnNu3h8F/bQAgQghowH1UAW3ICg" +
+ "LRMWh9MD3nL6B5zvW/rtbABAW7j9J/ubhTjE1Dh6fjPlrh4F1mHx9l6oKaKdL9MC" +
+ "Czogscg9WEHR1P1lXLtPyv2av6+Uc38L73W4ynzSHQzT7n4a9fw9G0pHvHQQT3Ww" +
+ "CpsYtnkcGJdhEoMqdwTQQQWf8H7l+Sm0erEmuPTqAC3f/RC5LqgrQdfyPN+J3eTy" +
+ "V4GlQVzdO0KeqEArm/KUORmgILgIYcAUkDE9WuptiUObqmYfnmExHY8cNvsWx4o2" +
+ "QtFrwFybGSaII/YzOu4hsM00VwmYOAJQ3KQY+rag56UiZKVHIpnxryUn41uF8d2K" +
+ "fszLbyzAkMTuQc1BJQQHPuhBBej0s+yiFTpnRcrVGp26/SPoGgGLAjmBAhpnAPYi" +
+ "hGHgg8hN+hAh0NObgHp2R/M6Jo+S9Uw80pUFedRU1bYFRVog6sTPEHADwMAG0oUe" +
+ "ZTzCfk4pmd1M7BJIMNGsaaugBm+bdBpLDSNwIBiBVKx5dQgre1pCrhP2FD5vX9bb" +
+ "a28/PP14155vN5a8GIiRRgLCSaKIJMBu9u1u/IdZNWhKp6tcoZGbueNNIlSQLYOV" +
+ "guF/I1QEFvm6liJuQ/g648tjVjId/WMg6iEQnkcuhltYdGxoELryIDySIMiK9wD4" +
+ "MbBiPihigLkeo0OhARBcol9jMSNhf2ITsgILYNseps5hodZnnUYfDxJFi4UQzXNx" +
+ "EsQsWIsPUhf4XvqFHwQ+WPfTBIHct1LIZYv2+juqALF8D9dhxOkM18bdDBT3QEFx" +
+ "IIWRNxv+UV8R+J/0R2XJbrEIOYHU+pkgRzsDEdIZEebTO4gQJeqofJbdkqra4esL" +
+ "roGjHL6Gsy4rZI+PElgZlHIH1++YJmDEhF6psaR1U3IWVmpF3VwE9oiTMpi8Nzz+" +
+ "aHRDUDwW+WIdt3zPNOewJzPCB9E6jmCYHFX8LoITudMz7/N1SyV8kTcL0XLh4A7N" +
+ "JzfBgyjFkYbKgC8xPTQ2NEVHr3NX3I8oB8QLJn4JCrIRrrR5SSiELOBCqIlECSOq" +
+ "AgtNF/5UYIUAbvmgBgPL1xIT9UkTRqqrX53ixpCNGKHEwP1PwJh+ma3ptrBwODbq" +
+ "SORcDEiR6PVwOxokOUEsjBbkzcaucQzU4IBkiIQDSXJdCotjbIzzDs8lfNscXA3I" +
+ "EjvBoCBmX1Xq+IE6m5+HREB7xUkefMhRTIUUVEoGUY2sxAvjsdB3GZnYoMTuuOZk" +
+ "0IILqZh+sKgLQ1ULBUF4SYf1u+nDkki7SjNoBQWIGv3PuY3TIDM1QtuJ3SNep/DE" +
+ "5GEdQMHhYWdISJCEh+RRD7S+bd8OK+sbha0qU3NES7e5JJCEsxa4lA5ucJdrboo7" +
+ "v42uXj7XKXZXimppWTWQJDU2Uks0imZSWU2bLZWUpEzCgmWQzZKmlstNa2pqlKaa" +
+ "aU0pppMDbLLVlqzSSa2lTEtKzZJmtWpNSkylFpqsptkZrNNSzS1S2bNoqllIpMmS" +
+ "lmYDKLKzVm1LKVNkglKVKmyy0EstNixZmkjEiWms2xGFpVEWVNNKkSaWUpmMKLNQ" +
+ "l1leHUD7BQQf0nxooh+rfDYdYFRbCkgUOlBI6EukdLgodLEh6iosAIZUDGcFIBnT" +
+ "5PfxeXIybIEK3a2JhwXN4a5XZyCUN1QHKuKm53cudZGkYw+CUhgAg4jiFUxQcoWX" +
+ "ZiDnC1kcAxisjx4FhBuB1RLpkW/L1JdQMQyPlqBhAGDxWuoWKaLLctSBSGSu4x/U" +
+ "+UGMFxxCH7+CQBDUTBsMAfQX99QooSAcCZEiD6vqNtZoMtphkjx94b82mEcdDU6C" +
+ "GIfhpBNHRGdiSEhKQ5wXmRP0FuHscjHIQQXE+/JA9QIe5u/rPZ7iGp3RjqDlESQZ" +
+ "JCQm/LYfclj52MSyQjrCotj6Nhs9YNtpjG0eYiFHs4e+RkLZGv6lQVs25H8UcydI" +
+ "dBwSSJWZ2GkMV5JBvs3IEHqRvh5VCbiosL1RQbNSevAFkgodQSGXyDwMAKI48pbY" +
+ "nKYY5o3AkxfgcNu/2TS8/z4OpVwpwYLoslFDS0dpbVLklyLktcy0qrt1rkkVDQKa" +
+ "U5mIfn7qbHUwB+pUzzDYgdOwHNMsQqIeAQgWJ7CdQLne/Uch/L74GbnkIeSHVY7B" +
+ "6HzdzDBZDLh9FDDd7l51/E5mJCBgdFYeAu3YglszcA0yVJwA+V7zU+xXQdNIJq0w" +
+ "kfMItgm3gj2uGRgGUX4BpO2ZVeDftfXE9vP1ve16wzwEEF4VAF3VrV67Ndd89m7O" +
+ "GA6EokveXN9MfaQsQ3ZZKcK50mcwJlSsZTgk98c5KYw84IzEZbkvNTsNqzPLKyHo" +
+ "Px0sFlfMO5q7Gy/RLjgGa3WwaF0oI5J5CEBrzAuFdT9Mc82Cdw1XLYdAocXnucxw" +
+ "MDq4Gb5ImDg/Y1aNUuciSSLGs30w7o64wiPJkCOJGESEZEDZGBLmOHlrwGGQG1zj" +
+ "MtuCoxq7RpQlgtQ/YQ5xHKBJJHiia0FHVsRLGQe6Aj+2KgIUQACACiJEFxCraZaP" +
+ "BqeGpHqJ2lIlZ0RymyqrLMZVKEz6wYDwNnVwEvXcGMYxgkEpwJK03QsQ0IAGhJqy" +
+ "CBkmqpjC2e6t4I+Zf0JUTC8cgiBBIMOpm5aNIYWCqlcG2GZjNkLK8i6B/LSEtoDR" +
+ "RIJtyOGwPFu5CEb0Y2d1QVrHSAerk2mlwOR0esAyQ5waYkWyRMAgkNlX1WA43hGO" +
+ "YdDY3OWXJQzDIuXC51atcCh9k/jjTxk4r31uGHUMNV7DyEEFu9aoidiNHFzHFW3k" +
+ "pl23DYUqswRQLrmUK++C6OIeCEEGO4Oxqcy5rvYfEQIEszhUi+UBMa/NHV+bZCGB" +
+ "BmDsfjN+oGAKjwgfAOjBz3eAT0JSBhgZHiXA7HejAOj31UJ0cC5soXLOxcOBUy41" +
+ "LJM6Q8Jwpx4F2KjgcPvn3BRaXEe2Z4vPu2/yeP+aH5JvaiC4fKQAcndicHNDcD9b" +
+ "ShgrZAQXSGTpCSlPzKD5gwnhsz+p8ujoewiFBY3pKLSeXXMDRxzJq44NJzlzG7rV" +
+ "oWrj1/nLbhdUFc+SIUCENGZwNenyhKIbAqfWTOCRY+YUj3gzmpUR68AgUjUPy+0G" +
+ "2hIxUaJCNpMRpoFYjY0WIzNmFoMaNFtEYklpFixGtGxg0UUVJoKiwYNaTRqTKQRU" +
+ "G1Bo221i1VFhYBqNjRFIKqgpJIRS7/L9Xk8v315svJO9OR4u/ONn5FGPE3fMqdtS" +
+ "xkZBu7kta5NbuU8MxyZMYMgmsNmMhnKfGmtyIG2LzBpqWYIbdmCYi0lYLJxwCFFa" +
+ "zJE6zEudHD27ZzbOeSgpk/HnkQbT7twqaaJXNvUzMuUt1hyhU7ceZcph42+VTlXU" +
+ "cZ9UZZJyYojLjaeJHfJU1UZUEmBfLumu8yW5skuyE9uh2BmVxJZi6KxaXBNwSolw" +
+ "BqBcQLj3ucNZIYZLYtirLu3brW6UYgZgZJiDIGiwpsgg7g1AITkgM6FHITxDDnGt" +
+ "4SDHzZbL5s8fec5PCq5DOzDRdWS+0h5Y2INZak1D29cpVyb2aVrV3Wlt7rQhLa3e" +
+ "m3ZwPNcXywE2Qesk1XN24HvZ2Xa6nlm8Pf/xdyRThQkO1NjuAA=="
diff --git a/test/bench/go1/revcomp_test.go b/test/bench/go1/revcomp_test.go
new file mode 100644
index 000000000..9256164d7
--- /dev/null
+++ b/test/bench/go1/revcomp_test.go
@@ -0,0 +1,85 @@
+// Copyright 2011 The Go Authors. All rights reserved.
+// Use of this source code is governed by a BSD-style
+// license that can be found in the LICENSE file.
+
+// This benchmark, taken from the shootout, tests array indexing
+// and array bounds elimination performance.
+
+package go1
+
+import (
+ "bufio"
+ "bytes"
+ "io/ioutil"
+ "testing"
+)
+
+var revCompTable = [256]uint8{
+ 'A': 'T', 'a': 'T',
+ 'C': 'G', 'c': 'G',
+ 'G': 'C', 'g': 'C',
+ 'T': 'A', 't': 'A',
+ 'U': 'A', 'u': 'A',
+ 'M': 'K', 'm': 'K',
+ 'R': 'Y', 'r': 'Y',
+ 'W': 'W', 'w': 'W',
+ 'S': 'S', 's': 'S',
+ 'Y': 'R', 'y': 'R',
+ 'K': 'M', 'k': 'M',
+ 'V': 'B', 'v': 'B',
+ 'H': 'D', 'h': 'D',
+ 'D': 'H', 'd': 'H',
+ 'B': 'V', 'b': 'V',
+ 'N': 'N', 'n': 'N',
+}
+
+func revcomp(data []byte) {
+ in := bufio.NewReader(bytes.NewBuffer(data))
+ out := ioutil.Discard
+ buf := make([]byte, 1024*1024)
+ line, err := in.ReadSlice('\n')
+ for err == nil {
+ out.Write(line)
+
+ // Accumulate reversed complement in buf[w:]
+ nchar := 0
+ w := len(buf)
+ for {
+ line, err = in.ReadSlice('\n')
+ if err != nil || line[0] == '>' {
+ break
+ }
+ line = line[0 : len(line)-1]
+ nchar += len(line)
+ if len(line)+nchar/60+128 >= w {
+ nbuf := make([]byte, len(buf)*5)
+ copy(nbuf[len(nbuf)-len(buf):], buf)
+ w += len(nbuf) - len(buf)
+ buf = nbuf
+ }
+
+ // This loop is the bottleneck.
+ for _, c := range line {
+ w--
+ buf[w] = revCompTable[c]
+ }
+ }
+
+ // Copy down to beginning of buffer, inserting newlines.
+ // The loop left room for the newlines and 128 bytes of padding.
+ i := 0
+ for j := w; j < len(buf); j += 60 {
+ n := copy(buf[i:i+60], buf[j:])
+ buf[i+n] = '\n'
+ i += n + 1
+ }
+ out.Write(buf[0:i])
+ }
+}
+
+func BenchmarkRevcomp25M(b *testing.B) {
+ b.SetBytes(int64(len(fasta25m)))
+ for i := 0; i < b.N; i++ {
+ revcomp(fasta25m)
+ }
+}
diff --git a/test/bench/go1/template_test.go b/test/bench/go1/template_test.go
new file mode 100644
index 000000000..db4839a48
--- /dev/null
+++ b/test/bench/go1/template_test.go
@@ -0,0 +1,76 @@
+// Copyright 2011 The Go Authors. All rights reserved.
+// Use of this source code is governed by a BSD-style
+// license that can be found in the LICENSE file.
+
+// This benchmark tests text/template throughput,
+// converting a large data structure with a simple template.
+
+package go1
+
+import (
+ "bytes"
+ "io/ioutil"
+ "strings"
+ "testing"
+ "text/template"
+)
+
+// After removing \t and \n this generates identical output to
+// json.Marshal, making it easy to test for correctness.
+const tmplText = `
+{
+ "tree":{{template "node" .Tree}},
+ "username":"{{.Username}}"
+}
+{{define "node"}}
+{
+ "name":"{{.Name}}",
+ "kids":[
+ {{range $i, $k := .Kids}}
+ {{if $i}}
+ ,
+ {{end}}
+ {{template "node" $k}}
+ {{end}}
+ ],
+ "cl_weight":{{.CLWeight}},
+ "touches":{{.Touches}},
+ "min_t":{{.MinT}},
+ "max_t":{{.MaxT}},
+ "mean_t":{{.MeanT}}
+}
+{{end}}
+`
+
+func stripTabNL(r rune) rune {
+ if r == '\t' || r == '\n' {
+ return -1
+ }
+ return r
+}
+
+var tmpl = template.Must(template.New("main").Parse(strings.Map(stripTabNL, tmplText)))
+
+func init() {
+ var buf bytes.Buffer
+ if err := tmpl.Execute(&buf, &jsondata); err != nil {
+ panic(err)
+ }
+ if !bytes.Equal(buf.Bytes(), jsonbytes) {
+ println(buf.Len(), len(jsonbytes))
+ panic("wrong output")
+ }
+}
+
+func tmplexec() {
+ if err := tmpl.Execute(ioutil.Discard, &jsondata); err != nil {
+ panic(err)
+ }
+}
+
+func BenchmarkTemplate(b *testing.B) {
+ b.SetBytes(int64(len(jsonbytes)))
+ for i := 0; i < b.N; i++ {
+ tmplexec()
+ }
+}
diff --git a/test/bench/binary-tree-freelist.go b/test/bench/shootout/binary-tree-freelist.go
index 071a4e06e..071a4e06e 100644
--- a/test/bench/binary-tree-freelist.go
+++ b/test/bench/shootout/binary-tree-freelist.go
diff --git a/test/bench/binary-tree-freelist.txt b/test/bench/shootout/binary-tree-freelist.txt
index f8286dd88..f8286dd88 100644
--- a/test/bench/binary-tree-freelist.txt
+++ b/test/bench/shootout/binary-tree-freelist.txt
diff --git a/test/bench/binary-tree.c b/test/bench/shootout/binary-tree.c
index 1b4070406..1b4070406 100644
--- a/test/bench/binary-tree.c
+++ b/test/bench/shootout/binary-tree.c
diff --git a/test/bench/binary-tree.go b/test/bench/shootout/binary-tree.go
index 9f867d11a..9f867d11a 100644
--- a/test/bench/binary-tree.go
+++ b/test/bench/shootout/binary-tree.go
diff --git a/test/bench/binary-tree.txt b/test/bench/shootout/binary-tree.txt
index f8286dd88..f8286dd88 100644
--- a/test/bench/binary-tree.txt
+++ b/test/bench/shootout/binary-tree.txt
diff --git a/test/bench/chameneosredux.c b/test/bench/shootout/chameneosredux.c
index ed78c31d7..ed78c31d7 100644
--- a/test/bench/chameneosredux.c
+++ b/test/bench/shootout/chameneosredux.c
diff --git a/test/bench/chameneosredux.go b/test/bench/shootout/chameneosredux.go
index 2cb144004..339579862 100644
--- a/test/bench/chameneosredux.go
+++ b/test/bench/shootout/chameneosredux.go
@@ -49,20 +49,20 @@ const (
)
var complement = [...]int{
- red | red<<2: red,
- red | yellow<<2: blue,
- red | blue<<2: yellow,
- yellow | red<<2: blue,
+ red | red<<2: red,
+ red | yellow<<2: blue,
+ red | blue<<2: yellow,
+ yellow | red<<2: blue,
yellow | yellow<<2: yellow,
- yellow | blue<<2: red,
- blue | red<<2: yellow,
- blue | yellow<<2: red,
- blue | blue<<2: blue,
+ yellow | blue<<2: red,
+ blue | red<<2: yellow,
+ blue | yellow<<2: red,
+ blue | blue<<2: blue,
}
var colname = [...]string{
- blue: "blue",
- red: "red",
+ blue: "blue",
+ red: "red",
yellow: "yellow",
}
diff --git a/test/bench/chameneosredux.txt b/test/bench/shootout/chameneosredux.txt
index 6016d59a8..6016d59a8 100644
--- a/test/bench/chameneosredux.txt
+++ b/test/bench/shootout/chameneosredux.txt
diff --git a/test/bench/fannkuch-parallel.go b/test/bench/shootout/fannkuch-parallel.go
index 7e9b98d50..7e9b98d50 100644
--- a/test/bench/fannkuch-parallel.go
+++ b/test/bench/shootout/fannkuch-parallel.go
diff --git a/test/bench/fannkuch-parallel.txt b/test/bench/shootout/fannkuch-parallel.txt
index e66f779ea..e66f779ea 100644
--- a/test/bench/fannkuch-parallel.txt
+++ b/test/bench/shootout/fannkuch-parallel.txt
diff --git a/test/bench/fannkuch.c b/test/bench/shootout/fannkuch.c
index e576b5441..e576b5441 100644
--- a/test/bench/fannkuch.c
+++ b/test/bench/shootout/fannkuch.c
diff --git a/test/bench/fannkuch.go b/test/bench/shootout/fannkuch.go
index b554c77b1..b554c77b1 100644
--- a/test/bench/fannkuch.go
+++ b/test/bench/shootout/fannkuch.go
diff --git a/test/bench/fannkuch.txt b/test/bench/shootout/fannkuch.txt
index e66f779ea..e66f779ea 100644
--- a/test/bench/fannkuch.txt
+++ b/test/bench/shootout/fannkuch.txt
diff --git a/test/bench/fasta-1000.out b/test/bench/shootout/fasta-1000.out
index f1caba0d6..f1caba0d6 100644
--- a/test/bench/fasta-1000.out
+++ b/test/bench/shootout/fasta-1000.out
diff --git a/test/bench/fasta.c b/test/bench/shootout/fasta.c
index 64c1c5205..64c1c5205 100644
--- a/test/bench/fasta.c
+++ b/test/bench/shootout/fasta.c
diff --git a/test/bench/fasta.go b/test/bench/shootout/fasta.go
index d13edd5dc..17ff5dae5 100644
--- a/test/bench/fasta.go
+++ b/test/bench/shootout/fasta.go
@@ -70,7 +70,7 @@ const (
IA = 3877
IC = 29573
- LookupSize = 4096
+ LookupSize = 4096
LookupScale float64 = LookupSize - 1
)
@@ -178,7 +178,6 @@ func main() {
Random(homosapiens, 5**n)
}
-
type buffer []byte
func (b *buffer) Flush() {
diff --git a/test/bench/fasta.txt b/test/bench/shootout/fasta.txt
index f1caba0d6..f1caba0d6 100644
--- a/test/bench/fasta.txt
+++ b/test/bench/shootout/fasta.txt
diff --git a/test/bench/k-nucleotide-parallel.go b/test/bench/shootout/k-nucleotide-parallel.go
index 96c80d8f0..96c80d8f0 100644
--- a/test/bench/k-nucleotide-parallel.go
+++ b/test/bench/shootout/k-nucleotide-parallel.go
diff --git a/test/bench/k-nucleotide-parallel.txt b/test/bench/shootout/k-nucleotide-parallel.txt
index 84169b8ec..84169b8ec 100644
--- a/test/bench/k-nucleotide-parallel.txt
+++ b/test/bench/shootout/k-nucleotide-parallel.txt
diff --git a/test/bench/k-nucleotide.c b/test/bench/shootout/k-nucleotide.c
index 3bace391c..3bace391c 100644
--- a/test/bench/k-nucleotide.c
+++ b/test/bench/shootout/k-nucleotide.c
diff --git a/test/bench/k-nucleotide.go b/test/bench/shootout/k-nucleotide.go
index fdc98ed47..fdc98ed47 100644
--- a/test/bench/k-nucleotide.go
+++ b/test/bench/shootout/k-nucleotide.go
diff --git a/test/bench/k-nucleotide.txt b/test/bench/shootout/k-nucleotide.txt
index 84169b8ec..84169b8ec 100644
--- a/test/bench/k-nucleotide.txt
+++ b/test/bench/shootout/k-nucleotide.txt
diff --git a/test/bench/mandelbrot.c b/test/bench/shootout/mandelbrot.c
index c177c088c..c177c088c 100644
--- a/test/bench/mandelbrot.c
+++ b/test/bench/shootout/mandelbrot.c
diff --git a/test/bench/mandelbrot.go b/test/bench/shootout/mandelbrot.go
index 1f9fbfd3d..1f9fbfd3d 100644
--- a/test/bench/mandelbrot.go
+++ b/test/bench/shootout/mandelbrot.go
diff --git a/test/bench/mandelbrot.txt b/test/bench/shootout/mandelbrot.txt
index 2f7bbbc6b..2f7bbbc6b 100644
--- a/test/bench/mandelbrot.txt
+++ b/test/bench/shootout/mandelbrot.txt
Binary files differ
diff --git a/test/bench/meteor-contest.c b/test/bench/shootout/meteor-contest.c
index 19c43402c..19c43402c 100644
--- a/test/bench/meteor-contest.c
+++ b/test/bench/shootout/meteor-contest.c
diff --git a/test/bench/meteor-contest.go b/test/bench/shootout/meteor-contest.go
index 6660810eb..34a4e23f9 100644
--- a/test/bench/meteor-contest.go
+++ b/test/bench/shootout/meteor-contest.go
@@ -43,7 +43,6 @@ import (
var max_solutions = flag.Int("n", 2100, "maximum number of solutions")
-
func boolInt(b bool) int8 {
if b {
return 1
@@ -115,7 +114,6 @@ var piece_def = [10][4]int8{
[4]int8{E, E, E, SW},
}
-
/* To minimize the amount of work done in the recursive solve function below,
* I'm going to allocate enough space for all legal rotations of each piece
* at each position on the board. That's 10 pieces x 50 board positions x
@@ -138,7 +136,6 @@ func rotate(dir int8) int8 { return (dir + 2) % PIVOT }
/* Returns the direction flipped on the horizontal axis */
func flip(dir int8) int8 { return (PIVOT - dir) % PIVOT }
-
/* Returns the new cell index from the specified cell in the
* specified direction. The index is only valid if the
* starting cell and direction have been checked by the
@@ -322,7 +319,6 @@ func record_piece(piece int, minimum int8, first_empty int8, piece_mask uint64)
piece_counts[piece][minimum]++
}
-
/* Fill the entire board going cell by cell. If any cells are "trapped"
* they will be left alone.
*/
@@ -351,7 +347,6 @@ func fill_contiguous_space(board []int8, index int8) {
}
}
-
/* To thin the number of pieces, I calculate if any of them trap any empty
* cells at the edges. There are only a handful of exceptions where the
* the board can be solved with the trapped cells. For example: piece 8 can
@@ -382,7 +377,6 @@ func has_island(cell []int8, piece int) bool {
return true
}
-
/* Calculate all six rotations of the specified piece at the specified index.
* We calculate only half of piece 3's rotations. This is because any solution
* found has an identical solution rotated 180 degrees. Thus we can reduce the
@@ -417,7 +411,6 @@ func calc_pieces() {
}
}
-
/* Calculate all 32 possible states for a 5-bit row and all rows that will
* create islands that follow any of the 32 possible rows. These pre-
* calculated 5-bit rows will be used to find islands in a partially solved
@@ -530,7 +523,6 @@ func calc_rows() {
}
}
-
/* Calculate islands while solving the board.
*/
func boardHasIslands(cell int8) int8 {
@@ -545,7 +537,6 @@ func boardHasIslands(cell int8) int8 {
return bad_even_triple[current_triple]
}
-
/* The recursive solve algorithm. Try to place each permutation in the upper-
* leftmost empty cell. Mark off available pieces as it goes along.
* Because the board is a bit mask, the piece number and bit mask must be saved
diff --git a/test/bench/meteor-contest.txt b/test/bench/shootout/meteor-contest.txt
index 38d9783d6..38d9783d6 100644
--- a/test/bench/meteor-contest.txt
+++ b/test/bench/shootout/meteor-contest.txt
diff --git a/test/bench/nbody.c b/test/bench/shootout/nbody.c
index 3b95b0592..3b95b0592 100644
--- a/test/bench/nbody.c
+++ b/test/bench/shootout/nbody.c
diff --git a/test/bench/nbody.go b/test/bench/shootout/nbody.go
index e9f4517e8..988f3ba9c 100644
--- a/test/bench/nbody.go
+++ b/test/bench/shootout/nbody.go
@@ -125,39 +125,39 @@ func (sys System) advance(dt float64) {
var (
jupiter = Body{
- x: 4.84143144246472090e+00,
- y: -1.16032004402742839e+00,
- z: -1.03622044471123109e-01,
- vx: 1.66007664274403694e-03 * daysPerYear,
- vy: 7.69901118419740425e-03 * daysPerYear,
- vz: -6.90460016972063023e-05 * daysPerYear,
+ x: 4.84143144246472090e+00,
+ y: -1.16032004402742839e+00,
+ z: -1.03622044471123109e-01,
+ vx: 1.66007664274403694e-03 * daysPerYear,
+ vy: 7.69901118419740425e-03 * daysPerYear,
+ vz: -6.90460016972063023e-05 * daysPerYear,
mass: 9.54791938424326609e-04 * solarMass,
}
saturn = Body{
- x: 8.34336671824457987e+00,
- y: 4.12479856412430479e+00,
- z: -4.03523417114321381e-01,
- vx: -2.76742510726862411e-03 * daysPerYear,
- vy: 4.99852801234917238e-03 * daysPerYear,
- vz: 2.30417297573763929e-05 * daysPerYear,
+ x: 8.34336671824457987e+00,
+ y: 4.12479856412430479e+00,
+ z: -4.03523417114321381e-01,
+ vx: -2.76742510726862411e-03 * daysPerYear,
+ vy: 4.99852801234917238e-03 * daysPerYear,
+ vz: 2.30417297573763929e-05 * daysPerYear,
mass: 2.85885980666130812e-04 * solarMass,
}
uranus = Body{
- x: 1.28943695621391310e+01,
- y: -1.51111514016986312e+01,
- z: -2.23307578892655734e-01,
- vx: 2.96460137564761618e-03 * daysPerYear,
- vy: 2.37847173959480950e-03 * daysPerYear,
- vz: -2.96589568540237556e-05 * daysPerYear,
+ x: 1.28943695621391310e+01,
+ y: -1.51111514016986312e+01,
+ z: -2.23307578892655734e-01,
+ vx: 2.96460137564761618e-03 * daysPerYear,
+ vy: 2.37847173959480950e-03 * daysPerYear,
+ vz: -2.96589568540237556e-05 * daysPerYear,
mass: 4.36624404335156298e-05 * solarMass,
}
neptune = Body{
- x: 1.53796971148509165e+01,
- y: -2.59193146099879641e+01,
- z: 1.79258772950371181e-01,
- vx: 2.68067772490389322e-03 * daysPerYear,
- vy: 1.62824170038242295e-03 * daysPerYear,
- vz: -9.51592254519715870e-05 * daysPerYear,
+ x: 1.53796971148509165e+01,
+ y: -2.59193146099879641e+01,
+ z: 1.79258772950371181e-01,
+ vx: 2.68067772490389322e-03 * daysPerYear,
+ vy: 1.62824170038242295e-03 * daysPerYear,
+ vz: -9.51592254519715870e-05 * daysPerYear,
mass: 5.15138902046611451e-05 * solarMass,
}
sun = Body{
diff --git a/test/bench/nbody.txt b/test/bench/shootout/nbody.txt
index 1731557ce..1731557ce 100644
--- a/test/bench/nbody.txt
+++ b/test/bench/shootout/nbody.txt
diff --git a/test/bench/pidigits.c b/test/bench/shootout/pidigits.c
index c064da0dd..c064da0dd 100644
--- a/test/bench/pidigits.c
+++ b/test/bench/shootout/pidigits.c
diff --git a/test/bench/pidigits.go b/test/bench/shootout/pidigits.go
index e59312177..a0f21a91d 100644
--- a/test/bench/pidigits.go
+++ b/test/bench/shootout/pidigits.go
@@ -38,9 +38,9 @@ POSSIBILITY OF SUCH DAMAGE.
package main
import (
- "big"
"flag"
"fmt"
+ "math/big"
)
var n = flag.Int("n", 27, "number of digits")
diff --git a/test/bench/pidigits.txt b/test/bench/shootout/pidigits.txt
index ad946a9e8..ad946a9e8 100644
--- a/test/bench/pidigits.txt
+++ b/test/bench/shootout/pidigits.txt
diff --git a/test/bench/regex-dna-parallel.go b/test/bench/shootout/regex-dna-parallel.go
index 1335e4d34..9c6d42101 100644
--- a/test/bench/regex-dna-parallel.go
+++ b/test/bench/shootout/regex-dna-parallel.go
@@ -39,8 +39,8 @@ import (
"fmt"
"io/ioutil"
"os"
- "runtime"
"regexp"
+ "runtime"
)
var variants = []string{
diff --git a/test/bench/regex-dna-parallel.txt b/test/bench/shootout/regex-dna-parallel.txt
index e23e71fd6..e23e71fd6 100644
--- a/test/bench/regex-dna-parallel.txt
+++ b/test/bench/shootout/regex-dna-parallel.txt
diff --git a/test/bench/regex-dna.c b/test/bench/shootout/regex-dna.c
index 134f8215c..134f8215c 100644
--- a/test/bench/regex-dna.c
+++ b/test/bench/shootout/regex-dna.c
diff --git a/test/bench/regex-dna.go b/test/bench/shootout/regex-dna.go
index 042d7f283..042d7f283 100644
--- a/test/bench/regex-dna.go
+++ b/test/bench/shootout/regex-dna.go
diff --git a/test/bench/regex-dna.txt b/test/bench/shootout/regex-dna.txt
index e23e71fd6..e23e71fd6 100644
--- a/test/bench/regex-dna.txt
+++ b/test/bench/shootout/regex-dna.txt
diff --git a/test/bench/reverse-complement.c b/test/bench/shootout/reverse-complement.c
index b34c84696..b34c84696 100644
--- a/test/bench/reverse-complement.c
+++ b/test/bench/shootout/reverse-complement.c
diff --git a/test/bench/reverse-complement.go b/test/bench/shootout/reverse-complement.go
index baa30ffcc..baa30ffcc 100644
--- a/test/bench/reverse-complement.go
+++ b/test/bench/shootout/reverse-complement.go
diff --git a/test/bench/reverse-complement.txt b/test/bench/shootout/reverse-complement.txt
index 14d792ade..14d792ade 100644
--- a/test/bench/reverse-complement.txt
+++ b/test/bench/shootout/reverse-complement.txt
diff --git a/test/bench/spectral-norm-parallel.go b/test/bench/shootout/spectral-norm-parallel.go
index 2706f39ec..2706f39ec 100644
--- a/test/bench/spectral-norm-parallel.go
+++ b/test/bench/shootout/spectral-norm-parallel.go
diff --git a/test/bench/spectral-norm.c b/test/bench/shootout/spectral-norm.c
index 832eb3d21..832eb3d21 100644
--- a/test/bench/spectral-norm.c
+++ b/test/bench/shootout/spectral-norm.c
diff --git a/test/bench/spectral-norm.go b/test/bench/shootout/spectral-norm.go
index 6667f3e04..6667f3e04 100644
--- a/test/bench/spectral-norm.go
+++ b/test/bench/shootout/spectral-norm.go
diff --git a/test/bench/spectral-norm.txt b/test/bench/shootout/spectral-norm.txt
index b9885983e..b9885983e 100644
--- a/test/bench/spectral-norm.txt
+++ b/test/bench/shootout/spectral-norm.txt
diff --git a/test/bench/threadring.c b/test/bench/shootout/threadring.c
index 2c4fb7751..2c4fb7751 100644
--- a/test/bench/threadring.c
+++ b/test/bench/shootout/threadring.c
diff --git a/test/bench/threadring.go b/test/bench/shootout/threadring.go
index 031908a20..e76dd0b45 100644
--- a/test/bench/threadring.go
+++ b/test/bench/shootout/threadring.go
@@ -52,7 +52,7 @@ func f(i int, in <-chan int, out chan<- int) {
fmt.Printf("%d\n", i)
os.Exit(0)
}
- out <- n-1
+ out <- n - 1
}
}
diff --git a/test/bench/threadring.txt b/test/bench/shootout/threadring.txt
index f9aaa4d56..f9aaa4d56 100644
--- a/test/bench/threadring.txt
+++ b/test/bench/shootout/threadring.txt
diff --git a/test/bench/timing.log b/test/bench/shootout/timing.log
index 2541a766b..2541a766b 100644
--- a/test/bench/timing.log
+++ b/test/bench/shootout/timing.log
diff --git a/test/bench/timing.sh b/test/bench/shootout/timing.sh
index 473c9b312..dd3e664f4 100755
--- a/test/bench/timing.sh
+++ b/test/bench/shootout/timing.sh
@@ -5,7 +5,11 @@
set -e
-eval $(gomake --no-print-directory -f ../../src/Make.inc go-env)
+eval $(go tool dist env)
+O=$GOCHAR
+GC="go tool ${O}g"
+LD="go tool ${O}l"
+
PATH=.:$PATH
havegccgo=false
diff --git a/test/bigalg.go b/test/bigalg.go
index 902ba8410..55a15c30a 100644
--- a/test/bigalg.go
+++ b/test/bigalg.go
@@ -1,9 +1,11 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
+// Test the internal "algorithms" for objects larger than a word: hashing, equality etc.
+
package main
type T struct {
diff --git a/test/bigmap.go b/test/bigmap.go
index 843a15174..37e049846 100644
--- a/test/bigmap.go
+++ b/test/bigmap.go
@@ -1,9 +1,11 @@
-// $G $F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
+// Test behavior of maps with large elements.
+
package main
func seq(x, y int) [1000]byte {
diff --git a/test/blank.go b/test/blank.go
index 681a5e77c..961ed153b 100644
--- a/test/blank.go
+++ b/test/blank.go
@@ -1,9 +1,11 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
+// Test behavior of the blank identifier (_).
+
package main
import _ "fmt"
@@ -101,6 +103,46 @@ func main() {
}
h(a, b)
+
+ m()
+}
+
+type I interface {
+ M(_ int, y int)
+}
+
+type TI struct{}
+
+func (TI) M(x int, y int) {
+ if x != y {
+ println("invalid M call:", x, y)
+ panic("bad M")
+ }
+}
+
+var fp = func(_ int, y int) {}
+
+func init() {
+ fp = fp1
+}
+
+func fp1(x, y int) {
+ if x != y {
+ println("invalid fp1 call:", x, y)
+ panic("bad fp1")
+ }
+}
+
+
+func m() {
+ var i I
+
+ i = TI{}
+ i.M(1, 1)
+ i.M(2, 2)
+
+ fp(1, 1)
+ fp(2, 2)
}
// useless but legal
@@ -120,3 +162,4 @@ func _() {
func ff() {
var _ int = 1
}
+
diff --git a/test/blank1.go b/test/blank1.go
index 5bc1efce5..c6e038a0d 100644
--- a/test/blank1.go
+++ b/test/blank1.go
@@ -1,12 +1,16 @@
-// errchk $G -e $D/$F.go
+// errorcheck
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
+// Test that incorrect uses of the blank identifer are caught.
+// Does not compile.
+
package _ // ERROR "invalid package name _"
func main() {
_() // ERROR "cannot use _ as value"
x := _+1 // ERROR "cannot use _ as value"
+ _ = x
}
diff --git a/test/bugs/bug395.go b/test/bugs/bug395.go
new file mode 100644
index 000000000..adf74497c
--- /dev/null
+++ b/test/bugs/bug395.go
@@ -0,0 +1,22 @@
+// echo bug395 is broken # takes 90+ seconds to break
+// # $G $D/$F.go || echo bug395
+
+// Copyright 2011 The Go Authors. All rights reserved.
+// Use of this source code is governed by a BSD-style
+// license that can be found in the LICENSE file.
+
+// Issue 1909
+// Would OOM due to exponential recursion on Foo's expanded methodset in nodefmt
+package test
+
+type Foo interface {
+ Bar() interface {
+ Foo
+ }
+ Baz() interface {
+ Foo
+ }
+ Bug() interface {
+ Foo
+ }
+}
diff --git a/test/chan/doubleselect.go b/test/chan/doubleselect.go
index 3c7412ed6..ac559302d 100644
--- a/test/chan/doubleselect.go
+++ b/test/chan/doubleselect.go
@@ -1,11 +1,12 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
-// This test is designed to flush out the case where two cases of a select can
+// Test the situation in which two cases of a select can
// both end up running. See http://codereview.appspot.com/180068.
+
package main
import (
@@ -82,5 +83,4 @@ func main() {
// However, the result of the bug linked to at the top is that we'll
// end up panicking with: "throw: bad g->status in ready".
recver(cmux)
- print("PASS\n")
}
diff --git a/test/chan/fifo.go b/test/chan/fifo.go
index 0dddfcaa0..70d20b31f 100644
--- a/test/chan/fifo.go
+++ b/test/chan/fifo.go
@@ -1,10 +1,10 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
-// Verify that unbuffered channels act as pure fifos.
+// Test that unbuffered channels act as pure fifos.
package main
diff --git a/test/chan/goroutines.go b/test/chan/goroutines.go
index d8f8803df..6ffae7df6 100644
--- a/test/chan/goroutines.go
+++ b/test/chan/goroutines.go
@@ -1,11 +1,11 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
-// make a lot of goroutines, threaded together.
-// tear them down cleanly.
+// Torture test for goroutines.
+// Make a lot of goroutines, threaded together, and tear them down cleanly.
package main
@@ -21,7 +21,7 @@ func f(left, right chan int) {
func main() {
var n = 10000
if len(os.Args) > 1 {
- var err os.Error
+ var err error
n, err = strconv.Atoi(os.Args[1])
if err != nil {
print("bad arg\n")
diff --git a/test/chan/nonblock.go b/test/chan/nonblock.go
index 33afb3291..7e3c0c74d 100644
--- a/test/chan/nonblock.go
+++ b/test/chan/nonblock.go
@@ -1,11 +1,11 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
-// Verify channel operations that test for blocking
-// Use several sizes and types of operands
+// Test channel operations that test for blocking.
+// Use several sizes and types of operands.
package main
@@ -279,5 +279,4 @@ func main() {
<-sync
}
}
- print("PASS\n")
}
diff --git a/test/chan/perm.go b/test/chan/perm.go
index 038ff94e3..7e152c5eb 100644
--- a/test/chan/perm.go
+++ b/test/chan/perm.go
@@ -1,9 +1,13 @@
-// errchk $G -e $D/$F.go
+// errorcheck
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
+// Test various correct and incorrect permutations of send-only,
+// receive-only, and bidirectional channels.
+// Does not compile.
+
package main
var (
@@ -48,4 +52,11 @@ func main() {
case x := <-cs: // ERROR "receive"
_ = x
}
+
+ for _ = range cs {// ERROR "receive"
+ }
+
+ close(c)
+ close(cs)
+ close(cr) // ERROR "receive"
}
diff --git a/test/chan/powser1.go b/test/chan/powser1.go
index dc4ff5325..6bf2a9111 100644
--- a/test/chan/powser1.go
+++ b/test/chan/powser1.go
@@ -1,9 +1,11 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
+// Test concurrency primitives: power series.
+
// Power series package
// A power series is a channel, along which flow rational
// coefficients. A denominator of zero signifies the end.
diff --git a/test/chan/powser2.go b/test/chan/powser2.go
index bc329270d..33abd5c53 100644
--- a/test/chan/powser2.go
+++ b/test/chan/powser2.go
@@ -1,18 +1,21 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
+// Test concurrency primitives: power series.
+
+// Like powser1.go but uses channels of interfaces.
+// Has not been cleaned up as much as powser1.go, to keep
+// it distinct and therefore a different test.
+
// Power series package
// A power series is a channel, along which flow rational
// coefficients. A denominator of zero signifies the end.
// Original code in Newsqueak by Doug McIlroy.
// See Squinting at Power Series by Doug McIlroy,
// http://www.cs.bell-labs.com/who/rsc/thread/squint.pdf
-// Like powser1.go but uses channels of interfaces.
-// Has not been cleaned up as much as powser1.go, to keep
-// it distinct and therefore a different test.
package main
diff --git a/test/chan/select.go b/test/chan/select.go
index be4eb3f42..38fa7e1e3 100644
--- a/test/chan/select.go
+++ b/test/chan/select.go
@@ -1,9 +1,11 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
+// Test simple select.
+
package main
var counter uint
diff --git a/test/chan/select2.go b/test/chan/select2.go
index e24c51ed1..40bc357b5 100644
--- a/test/chan/select2.go
+++ b/test/chan/select2.go
@@ -1,9 +1,11 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2010 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
+// Test that selects do not consume undue memory.
+
package main
import "runtime"
@@ -35,14 +37,17 @@ func main() {
go sender(c, 100000)
receiver(c, dummy, 100000)
runtime.GC()
- runtime.MemStats.Alloc = 0
+ memstats := new(runtime.MemStats)
+ runtime.ReadMemStats(memstats)
+ alloc := memstats.Alloc
// second time shouldn't increase footprint by much
go sender(c, 100000)
receiver(c, dummy, 100000)
runtime.GC()
+ runtime.ReadMemStats(memstats)
- if runtime.MemStats.Alloc > 1e5 {
- println("BUG: too much memory for 100,000 selects:", runtime.MemStats.Alloc)
+ if memstats.Alloc-alloc > 1e5 {
+ println("BUG: too much memory for 100,000 selects:", memstats.Alloc-alloc)
}
}
diff --git a/test/chan/select3.go b/test/chan/select3.go
index d919de3e0..847d8ed37 100644
--- a/test/chan/select3.go
+++ b/test/chan/select3.go
@@ -1,10 +1,10 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2010 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
-// Tests verifying the semantics of the select statement
+// Test the semantics of the select statement
// for basic empty/non-empty cases.
package main
@@ -197,13 +197,13 @@ func main() {
})
testBlock(never, func() {
select {
- case x := <-closedch:
+ case x := (<-closedch):
_ = x
}
})
testBlock(never, func() {
select {
- case x, ok := <-closedch:
+ case x, ok := (<-closedch):
_, _ = x, ok
}
})
diff --git a/test/chan/select4.go b/test/chan/select4.go
index 46618ac88..500364038 100644
--- a/test/chan/select4.go
+++ b/test/chan/select4.go
@@ -1,4 +1,10 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// run
+
+// Copyright 2010 The Go Authors. All rights reserved.
+// Use of this source code is governed by a BSD-style
+// license that can be found in the LICENSE file
+
+// Test that a select statement proceeds when a value is ready.
package main
diff --git a/test/chan/select5.go b/test/chan/select5.go
index 607182167..13cde1afe 100644
--- a/test/chan/select5.go
+++ b/test/chan/select5.go
@@ -7,7 +7,10 @@
// license that can be found in the LICENSE file.
// Generate test of channel operations and simple selects.
-// Only doing one real send or receive at a time, but phrased
+// The output of this program is compiled and run to do the
+// actual test.
+
+// Each test does only one real send or receive at a time, but phrased
// in various ways that the compiler may or may not rewrite
// into simpler expressions.
@@ -18,7 +21,7 @@ import (
"fmt"
"io"
"os"
- "template"
+ "text/template"
)
func main() {
diff --git a/test/chan/select6.go b/test/chan/select6.go
index 2ba6810ac..af470a0d0 100644
--- a/test/chan/select6.go
+++ b/test/chan/select6.go
@@ -1,10 +1,10 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2011 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
-// Issue 2075
+// Test for select: Issue 2075
// A bug in select corrupts channel queues of failed cases
// if there are multiple waiters on those channels and the
// select is the last in the queue. If further waits are made
diff --git a/test/chan/select7.go b/test/chan/select7.go
new file mode 100644
index 000000000..20456a9d6
--- /dev/null
+++ b/test/chan/select7.go
@@ -0,0 +1,68 @@
+// run
+
+// Copyright 2011 The Go Authors. All rights reserved.
+// Use of this source code is governed by a BSD-style
+// license that can be found in the LICENSE file.
+
+// Test select when discarding a value.
+
+package main
+
+import "runtime"
+
+func recv1(c <-chan int) {
+ <-c
+}
+
+func recv2(c <-chan int) {
+ select {
+ case <-c:
+ }
+}
+
+func recv3(c <-chan int) {
+ c2 := make(chan int)
+ select {
+ case <-c:
+ case <-c2:
+ }
+}
+
+func send1(recv func(<-chan int)) {
+ c := make(chan int)
+ go recv(c)
+ runtime.Gosched()
+ c <- 1
+}
+
+func send2(recv func(<-chan int)) {
+ c := make(chan int)
+ go recv(c)
+ runtime.Gosched()
+ select {
+ case c <- 1:
+ }
+}
+
+func send3(recv func(<-chan int)) {
+ c := make(chan int)
+ go recv(c)
+ runtime.Gosched()
+ c2 := make(chan int)
+ select {
+ case c <- 1:
+ case c2 <- 1:
+ }
+}
+
+func main() {
+ send1(recv1)
+ send2(recv1)
+ send3(recv1)
+ send1(recv2)
+ send2(recv2)
+ send3(recv2)
+ send1(recv3)
+ send2(recv3)
+ send3(recv3)
+}
diff --git a/test/chan/sendstmt.go b/test/chan/sendstmt.go
index ee6f765cf..a92c4f63a 100644
--- a/test/chan/sendstmt.go
+++ b/test/chan/sendstmt.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2011 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/chan/sieve1.go b/test/chan/sieve1.go
index 55076c925..acc310f6c 100644
--- a/test/chan/sieve1.go
+++ b/test/chan/sieve1.go
@@ -1,9 +1,11 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
+// Test concurrency primitives: classical inefficient concurrent prime sieve.
+
// Generate primes up to 100 using channels, checking the results.
// This sieve consists of a linear chain of divisibility filters,
// equivalent to trial-dividing each n by all primes p ≤ n.
diff --git a/test/chan/sieve2.go b/test/chan/sieve2.go
index 7f2ed9157..09e5c527b 100644
--- a/test/chan/sieve2.go
+++ b/test/chan/sieve2.go
@@ -1,9 +1,11 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
+// Test concurrency primitives: prime sieve of Eratosthenes.
+
// Generate primes up to 100 using channels, checking the results.
// This sieve is Eratosthenesque and only considers odd candidates.
// See discussion at <http://blog.onideas.ws/eratosthenes.go>.
@@ -13,7 +15,6 @@ package main
import (
"container/heap"
"container/ring"
- "container/vector"
)
// Return a chan of odd numbers, starting from 5.
@@ -47,13 +48,28 @@ type PeekCh struct {
ch chan int
}
-// Heap of PeekCh, sorting by head values.
-type PeekChHeap struct {
- *vector.Vector
-}
+// Heap of PeekCh, sorting by head values, satisfies Heap interface.
+type PeekChHeap []*PeekCh
func (h *PeekChHeap) Less(i, j int) bool {
- return h.At(i).(*PeekCh).head < h.At(j).(*PeekCh).head
+ return (*h)[i].head < (*h)[j].head
+}
+
+func (h *PeekChHeap) Swap(i, j int) {
+ (*h)[i], (*h)[j] = (*h)[j], (*h)[i]
+}
+
+func (h *PeekChHeap) Len() int {
+ return len(*h)
+}
+
+func (h *PeekChHeap) Pop() (v interface{}) {
+ *h, v = (*h)[:h.Len()-1], (*h)[h.Len()-1]
+ return
+}
+
+func (h *PeekChHeap) Push(v interface{}) {
+ *h = append(*h, v.(*PeekCh))
}
// Return a channel to serve as a sending proxy to 'out'.
@@ -108,26 +124,26 @@ func Sieve() chan int {
// Merge channels of multiples of 'primes' into 'composites'.
go func() {
- h := &PeekChHeap{new(vector.Vector)}
+ var h PeekChHeap
min := 15
for {
m := multiples(<-primes)
head := <-m
for min < head {
composites <- min
- minchan := heap.Pop(h).(*PeekCh)
+ minchan := heap.Pop(&h).(*PeekCh)
min = minchan.head
minchan.head = <-minchan.ch
- heap.Push(h, minchan)
+ heap.Push(&h, minchan)
}
for min == head {
- minchan := heap.Pop(h).(*PeekCh)
+ minchan := heap.Pop(&h).(*PeekCh)
min = minchan.head
minchan.head = <-minchan.ch
- heap.Push(h, minchan)
+ heap.Push(&h, minchan)
}
composites <- head
- heap.Push(h, &PeekCh{<-m, m})
+ heap.Push(&h, &PeekCh{<-m, m})
}
}()
diff --git a/test/chan/zerosize.go b/test/chan/zerosize.go
index 617c9dab3..50aca857c 100644
--- a/test/chan/zerosize.go
+++ b/test/chan/zerosize.go
@@ -1,10 +1,10 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2011 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
-// Making channels of a zero-sized type should not panic.
+// Test making channels of a zero-sized type.
package main
diff --git a/test/chancap.go b/test/chancap.go
index 3f3789fbc..b3e40233f 100644
--- a/test/chancap.go
+++ b/test/chancap.go
@@ -1,9 +1,11 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
+// Test the cap predeclared function applied to channels.
+
package main
func main() {
diff --git a/test/char_lit.go b/test/char_lit.go
index 99be77a57..836c3c1a2 100644
--- a/test/char_lit.go
+++ b/test/char_lit.go
@@ -1,9 +1,11 @@
-// $G $F.go && $L $F.$A &&./$A.out
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
+// Test character literal syntax.
+
package main
import "os"
diff --git a/test/char_lit1.go b/test/char_lit1.go
index dc5385291..489744b6e 100644
--- a/test/char_lit1.go
+++ b/test/char_lit1.go
@@ -1,9 +1,12 @@
-// errchk $G -e $F.go
+// errorcheck
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
+// Verify that illegal character literals are detected.
+// Does not compile.
+
package main
const (
diff --git a/test/closedchan.go b/test/closedchan.go
index 95314b334..043a92d38 100644
--- a/test/closedchan.go
+++ b/test/closedchan.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
@@ -11,6 +11,10 @@
package main
+import "os"
+
+var failed bool
+
type Chan interface {
Send(int)
Nbsend(int) bool
@@ -225,19 +229,23 @@ func test1(c Chan) {
// recv a close signal (a zero value)
if x := c.Recv(); x != 0 {
println("test1: recv on closed:", x, c.Impl())
+ failed = true
}
if x, ok := c.Recv2(); x != 0 || ok {
println("test1: recv2 on closed:", x, ok, c.Impl())
+ failed = true
}
// should work with select: received a value without blocking, so selected == true.
x, selected := c.Nbrecv()
if x != 0 || !selected {
println("test1: recv on closed nb:", x, selected, c.Impl())
+ failed = true
}
x, ok, selected := c.Nbrecv2()
if x != 0 || ok || !selected {
println("test1: recv2 on closed nb:", x, ok, selected, c.Impl())
+ failed = true
}
}
@@ -247,12 +255,14 @@ func test1(c Chan) {
// the value should have been discarded.
if x := c.Recv(); x != 0 {
println("test1: recv on closed got non-zero after send on closed:", x, c.Impl())
+ failed = true
}
// similarly Send.
shouldPanic(func() { c.Send(2) })
if x := c.Recv(); x != 0 {
println("test1: recv on closed got non-zero after send on closed:", x, c.Impl())
+ failed = true
}
}
@@ -260,6 +270,7 @@ func testasync1(c Chan) {
// should be able to get the last value via Recv
if x := c.Recv(); x != 1 {
println("testasync1: Recv did not get 1:", x, c.Impl())
+ failed = true
}
test1(c)
@@ -269,6 +280,7 @@ func testasync2(c Chan) {
// should be able to get the last value via Recv2
if x, ok := c.Recv2(); x != 1 || !ok {
println("testasync1: Recv did not get 1, true:", x, ok, c.Impl())
+ failed = true
}
test1(c)
@@ -278,6 +290,7 @@ func testasync3(c Chan) {
// should be able to get the last value via Nbrecv
if x, selected := c.Nbrecv(); x != 1 || !selected {
println("testasync2: Nbrecv did not get 1, true:", x, selected, c.Impl())
+ failed = true
}
test1(c)
@@ -287,6 +300,7 @@ func testasync4(c Chan) {
// should be able to get the last value via Nbrecv2
if x, ok, selected := c.Nbrecv2(); x != 1 || !ok || !selected {
println("testasync2: Nbrecv did not get 1, true, true:", x, ok, selected, c.Impl())
+ failed = true
}
test1(c)
}
@@ -327,4 +341,19 @@ func main() {
testclosed(mk(closedasync()))
}
}
+
+ var ch chan int
+ shouldPanic(func() {
+ close(ch)
+ })
+
+ ch = make(chan int)
+ close(ch)
+ shouldPanic(func() {
+ close(ch)
+ })
+
+ if failed {
+ os.Exit(1)
+ }
}
diff --git a/test/closure.go b/test/closure.go
index 3033c02ed..ae38900ba 100644
--- a/test/closure.go
+++ b/test/closure.go
@@ -1,11 +1,15 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
+// Test the behavior of closures.
+
package main
+import "runtime"
+
var c = make(chan int)
func check(a []int) {
@@ -76,8 +80,9 @@ func h() {
func newfunc() func(int) int { return func(x int) int { return x } }
-
func main() {
+ var fail bool
+
go f()
check([]int{1, 4, 5, 4})
@@ -89,17 +94,27 @@ func main() {
go h()
check([]int{100, 200, 101, 201, 500, 101, 201, 500})
+ memstats := new(runtime.MemStats)
+ runtime.ReadMemStats(memstats)
+ n0 := memstats.Mallocs
+
x, y := newfunc(), newfunc()
- if x == y {
- println("newfunc returned same func")
- panic("fail")
- }
if x(1) != 1 || y(2) != 2 {
println("newfunc returned broken funcs")
- panic("fail")
+ fail = true
+ }
+
+ runtime.ReadMemStats(memstats)
+ if n0 != memstats.Mallocs {
+ println("newfunc allocated unexpectedly")
+ fail = true
}
ff(1)
+
+ if fail {
+ panic("fail")
+ }
}
func ff(x int) {
diff --git a/test/cmp.go b/test/cmp.go
new file mode 100644
index 000000000..a56ca6ead
--- /dev/null
+++ b/test/cmp.go
@@ -0,0 +1,421 @@
+// run
+
+// Copyright 2009 The Go Authors. All rights reserved.
+// Use of this source code is governed by a BSD-style
+// license that can be found in the LICENSE file.
+
+// Test equality and inequality operations.
+
+package main
+
+import "unsafe"
+
+var global bool
+func use(b bool) { global = b }
+
+func stringptr(s string) uintptr { return *(*uintptr)(unsafe.Pointer(&s)) }
+
+func isfalse(b bool) {
+ if b {
+ // stack will explain where
+ panic("wanted false, got true")
+ }
+}
+
+func istrue(b bool) {
+ if !b {
+ // stack will explain where
+ panic("wanted true, got false")
+ }
+}
+
+type T *int
+
+func main() {
+ var a []int
+ var b map[string]int
+
+ var c string = "hello"
+ var d string = "hel" // try to get different pointer
+ d = d + "lo"
+ if stringptr(c) == stringptr(d) {
+ panic("compiler too smart -- got same string")
+ }
+
+ var e = make(chan int)
+
+ var ia interface{} = a
+ var ib interface{} = b
+ var ic interface{} = c
+ var id interface{} = d
+ var ie interface{} = e
+
+ // these comparisons are okay because
+ // string compare is okay and the others
+ // are comparisons where the types differ.
+ isfalse(ia == ib)
+ isfalse(ia == ic)
+ isfalse(ia == id)
+ isfalse(ib == ic)
+ isfalse(ib == id)
+ istrue(ic == id)
+ istrue(ie == ie)
+
+ istrue(ia != ib)
+ istrue(ia != ic)
+ istrue(ia != id)
+ istrue(ib != ic)
+ istrue(ib != id)
+ isfalse(ic != id)
+ isfalse(ie != ie)
+
+ // these are not okay, because there is no comparison on slices or maps.
+ //isfalse(a == ib)
+ //isfalse(a == ic)
+ //isfalse(a == id)
+ //isfalse(b == ic)
+ //isfalse(b == id)
+
+ istrue(c == id)
+ istrue(e == ie)
+
+ //isfalse(ia == b)
+ isfalse(ia == c)
+ isfalse(ia == d)
+ isfalse(ib == c)
+ isfalse(ib == d)
+ istrue(ic == d)
+ istrue(ie == e)
+
+ //istrue(a != ib)
+ //istrue(a != ic)
+ //istrue(a != id)
+ //istrue(b != ic)
+ //istrue(b != id)
+ isfalse(c != id)
+ isfalse(e != ie)
+
+ //istrue(ia != b)
+ istrue(ia != c)
+ istrue(ia != d)
+ istrue(ib != c)
+ istrue(ib != d)
+ isfalse(ic != d)
+ isfalse(ie != e)
+
+ // 6g used to let this go through as true.
+ var g uint64 = 123
+ var h int64 = 123
+ var ig interface{} = g
+ var ih interface{} = h
+ isfalse(ig == ih)
+ istrue(ig != ih)
+
+ // map of interface should use == on interface values,
+ // not memory.
+ var m = make(map[interface{}]int)
+ m[ic] = 1
+ m[id] = 2
+ if m[c] != 2 {
+ println("m[c] = ", m[c])
+ panic("bad m[c]")
+ }
+
+ // non-interface comparisons
+ {
+ c := make(chan int)
+ c1 := (<-chan int)(c)
+ c2 := (chan<- int)(c)
+ istrue(c == c1)
+ istrue(c == c2)
+ istrue(c1 == c)
+ istrue(c2 == c)
+
+ isfalse(c != c1)
+ isfalse(c != c2)
+ isfalse(c1 != c)
+ isfalse(c2 != c)
+
+ d := make(chan int)
+ isfalse(c == d)
+ isfalse(d == c)
+ isfalse(d == c1)
+ isfalse(d == c2)
+ isfalse(c1 == d)
+ isfalse(c2 == d)
+
+ istrue(c != d)
+ istrue(d != c)
+ istrue(d != c1)
+ istrue(d != c2)
+ istrue(c1 != d)
+ istrue(c2 != d)
+ }
+
+ // named types vs not
+ {
+ var x = new(int)
+ var y T
+ var z T = x
+
+ isfalse(x == y)
+ istrue(x == z)
+ isfalse(y == z)
+
+ isfalse(y == x)
+ istrue(z == x)
+ isfalse(z == y)
+
+ istrue(x != y)
+ isfalse(x != z)
+ istrue(y != z)
+
+ istrue(y != x)
+ isfalse(z != x)
+ istrue(z != y)
+ }
+
+ // structs
+ {
+ var x = struct {
+ x int
+ y string
+ }{1, "hi"}
+ var y = struct {
+ x int
+ y string
+ }{2, "bye"}
+ var z = struct {
+ x int
+ y string
+ }{1, "hi"}
+
+ isfalse(x == y)
+ isfalse(y == x)
+ isfalse(y == z)
+ isfalse(z == y)
+ istrue(x == z)
+ istrue(z == x)
+
+ istrue(x != y)
+ istrue(y != x)
+ istrue(y != z)
+ istrue(z != y)
+ isfalse(x != z)
+ isfalse(z != x)
+
+ var m = make(map[struct {
+ x int
+ y string
+ }]int)
+ m[x] = 10
+ m[y] = 20
+ m[z] = 30
+ istrue(m[x] == 30)
+ istrue(m[y] == 20)
+ istrue(m[z] == 30)
+ istrue(m[x] != 10)
+ isfalse(m[x] != 30)
+ isfalse(m[y] != 20)
+ isfalse(m[z] != 30)
+ isfalse(m[x] == 10)
+
+ var m1 = make(map[struct {
+ x int
+ y string
+ }]struct {
+ x int
+ y string
+ })
+ m1[x] = x
+ m1[y] = y
+ m1[z] = z
+ istrue(m1[x] == z)
+ istrue(m1[y] == y)
+ istrue(m1[z] == z)
+ istrue(m1[x] == x)
+ isfalse(m1[x] != z)
+ isfalse(m1[y] != y)
+ isfalse(m1[z] != z)
+ isfalse(m1[x] != x)
+
+ var ix, iy, iz interface{} = x, y, z
+
+ isfalse(ix == iy)
+ isfalse(iy == ix)
+ isfalse(iy == iz)
+ isfalse(iz == iy)
+ istrue(ix == iz)
+ istrue(iz == ix)
+
+ isfalse(x == iy)
+ isfalse(y == ix)
+ isfalse(y == iz)
+ isfalse(z == iy)
+ istrue(x == iz)
+ istrue(z == ix)
+
+ isfalse(ix == y)
+ isfalse(iy == x)
+ isfalse(iy == z)
+ isfalse(iz == y)
+ istrue(ix == z)
+ istrue(iz == x)
+
+ istrue(ix != iy)
+ istrue(iy != ix)
+ istrue(iy != iz)
+ istrue(iz != iy)
+ isfalse(ix != iz)
+ isfalse(iz != ix)
+
+ istrue(x != iy)
+ istrue(y != ix)
+ istrue(y != iz)
+ istrue(z != iy)
+ isfalse(x != iz)
+ isfalse(z != ix)
+
+ istrue(ix != y)
+ istrue(iy != x)
+ istrue(iy != z)
+ istrue(iz != y)
+ isfalse(ix != z)
+ isfalse(iz != x)
+ }
+
+ // structs with _ fields
+ {
+ var x = struct {
+ x int
+ _ []int
+ y float64
+ _ float64
+ z int
+ }{
+ x: 1, y: 2, z: 3,
+ }
+ var ix interface{} = x
+
+ istrue(x == x)
+ istrue(x == ix)
+ istrue(ix == x)
+ istrue(ix == ix)
+ }
+
+ // arrays
+ {
+ var x = [2]string{"1", "hi"}
+ var y = [2]string{"2", "bye"}
+ var z = [2]string{"1", "hi"}
+
+ isfalse(x == y)
+ isfalse(y == x)
+ isfalse(y == z)
+ isfalse(z == y)
+ istrue(x == z)
+ istrue(z == x)
+
+ istrue(x != y)
+ istrue(y != x)
+ istrue(y != z)
+ istrue(z != y)
+ isfalse(x != z)
+ isfalse(z != x)
+
+ var m = make(map[[2]string]int)
+ m[x] = 10
+ m[y] = 20
+ m[z] = 30
+ istrue(m[x] == 30)
+ istrue(m[y] == 20)
+ istrue(m[z] == 30)
+ isfalse(m[x] != 30)
+ isfalse(m[y] != 20)
+ isfalse(m[z] != 30)
+
+ var ix, iy, iz interface{} = x, y, z
+
+ isfalse(ix == iy)
+ isfalse(iy == ix)
+ isfalse(iy == iz)
+ isfalse(iz == iy)
+ istrue(ix == iz)
+ istrue(iz == ix)
+
+ isfalse(x == iy)
+ isfalse(y == ix)
+ isfalse(y == iz)
+ isfalse(z == iy)
+ istrue(x == iz)
+ istrue(z == ix)
+
+ isfalse(ix == y)
+ isfalse(iy == x)
+ isfalse(iy == z)
+ isfalse(iz == y)
+ istrue(ix == z)
+ istrue(iz == x)
+
+ istrue(ix != iy)
+ istrue(iy != ix)
+ istrue(iy != iz)
+ istrue(iz != iy)
+ isfalse(ix != iz)
+ isfalse(iz != ix)
+
+ istrue(x != iy)
+ istrue(y != ix)
+ istrue(y != iz)
+ istrue(z != iy)
+ isfalse(x != iz)
+ isfalse(z != ix)
+
+ istrue(ix != y)
+ istrue(iy != x)
+ istrue(iy != z)
+ istrue(iz != y)
+ isfalse(ix != z)
+ isfalse(iz != x)
+ }
+
+ shouldPanic(p1)
+ shouldPanic(p2)
+ shouldPanic(p3)
+ shouldPanic(p4)
+}
+
+func p1() {
+ var a []int
+ var ia interface{} = a
+ use(ia == ia)
+}
+
+func p2() {
+ var b []int
+ var ib interface{} = b
+ use(ib == ib)
+}
+
+func p3() {
+ var a []int
+ var ia interface{} = a
+ var m = make(map[interface{}]int)
+ m[ia] = 1
+}
+
+func p4() {
+ var b []int
+ var ib interface{} = b
+ var m = make(map[interface{}]int)
+ m[ib] = 1
+}
+
+func shouldPanic(f func()) {
+ defer func() {
+ if recover() == nil {
+ panic("function should panic")
+ }
+ }()
+ f()
+}
diff --git a/test/cmp1.go b/test/cmp1.go
deleted file mode 100644
index 698544c58..000000000
--- a/test/cmp1.go
+++ /dev/null
@@ -1,130 +0,0 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
-
-// Copyright 2009 The Go Authors. All rights reserved.
-// Use of this source code is governed by a BSD-style
-// license that can be found in the LICENSE file.
-
-package main
-
-import "unsafe"
-
-func use(bool) {}
-
-func stringptr(s string) uintptr { return *(*uintptr)(unsafe.Pointer(&s)) }
-
-func isfalse(b bool) {
- if b {
- // stack will explain where
- panic("wanted false, got true")
- }
-}
-
-func istrue(b bool) {
- if !b {
- // stack will explain where
- panic("wanted true, got false")
- }
-}
-
-type T *int
-
-func main() {
- var a []int
- var b map[string]int
-
- var c string = "hello"
- var d string = "hel" // try to get different pointer
- d = d + "lo"
- if stringptr(c) == stringptr(d) {
- panic("compiler too smart -- got same string")
- }
-
- var e = make(chan int)
-
- var ia interface{} = a
- var ib interface{} = b
- var ic interface{} = c
- var id interface{} = d
- var ie interface{} = e
-
- // these comparisons are okay because
- // string compare is okay and the others
- // are comparisons where the types differ.
- isfalse(ia == ib)
- isfalse(ia == ic)
- isfalse(ia == id)
- isfalse(ib == ic)
- isfalse(ib == id)
- istrue(ic == id)
- istrue(ie == ie)
-
- // these are okay because one side of the
- // comparison need only be assignable to the other.
- isfalse(a == ib)
- isfalse(a == ic)
- isfalse(a == id)
- isfalse(b == ic)
- isfalse(b == id)
- istrue(c == id)
- istrue(e == ie)
-
- isfalse(ia == b)
- isfalse(ia == c)
- isfalse(ia == d)
- isfalse(ib == c)
- isfalse(ib == d)
- istrue(ic == d)
- istrue(ie == e)
-
- // 6g used to let this go through as true.
- var g uint64 = 123
- var h int64 = 123
- var ig interface{} = g
- var ih interface{} = h
- isfalse(ig == ih)
-
- // map of interface should use == on interface values,
- // not memory.
- // TODO: should m[c], m[d] be valid here?
- var m = make(map[interface{}]int)
- m[ic] = 1
- m[id] = 2
- if m[ic] != 2 {
- println("m[ic] = ", m[ic])
- panic("bad m[ic]")
- }
-
- // non-interface comparisons
- {
- c := make(chan int)
- c1 := (<-chan int)(c)
- c2 := (chan<- int)(c)
- istrue(c == c1)
- istrue(c == c2)
- istrue(c1 == c)
- istrue(c2 == c)
-
- d := make(chan int)
- isfalse(c == d)
- isfalse(d == c)
- isfalse(d == c1)
- isfalse(d == c2)
- isfalse(c1 == d)
- isfalse(c2 == d)
- }
-
- // named types vs not
- {
- var x = new(int)
- var y T
- var z T = x
-
- isfalse(x == y)
- istrue(x == z)
- isfalse(y == z)
-
- isfalse(y == x)
- istrue(z == x)
- isfalse(z == y)
- }
-}
diff --git a/test/cmp2.go b/test/cmp2.go
deleted file mode 100644
index f6f124f2e..000000000
--- a/test/cmp2.go
+++ /dev/null
@@ -1,15 +0,0 @@
-// $G $D/$F.go && $L $F.$A && ! ./$A.out
-
-// Copyright 2009 The Go Authors. All rights reserved.
-// Use of this source code is governed by a BSD-style
-// license that can be found in the LICENSE file.
-
-package main
-
-func use(bool) { }
-
-func main() {
- var a []int
- var ia interface{} = a
- use(ia == ia)
-}
diff --git a/test/cmp3.go b/test/cmp3.go
deleted file mode 100644
index dd90bfb03..000000000
--- a/test/cmp3.go
+++ /dev/null
@@ -1,15 +0,0 @@
-// $G $D/$F.go && $L $F.$A && ! ./$A.out
-
-// Copyright 2009 The Go Authors. All rights reserved.
-// Use of this source code is governed by a BSD-style
-// license that can be found in the LICENSE file.
-
-package main
-
-func use(bool) { }
-
-func main() {
- var b []int
- var ib interface{} = b
- use(ib == ib)
-}
diff --git a/test/cmp4.go b/test/cmp4.go
deleted file mode 100644
index 3f9b2c0b8..000000000
--- a/test/cmp4.go
+++ /dev/null
@@ -1,14 +0,0 @@
-// $G $D/$F.go && $L $F.$A && ! ./$A.out
-
-// Copyright 2009 The Go Authors. All rights reserved.
-// Use of this source code is governed by a BSD-style
-// license that can be found in the LICENSE file.
-
-package main
-
-func main() {
- var a []int
- var ia interface{} = a
- var m = make(map[interface{}] int)
- m[ia] = 1
-}
diff --git a/test/cmp5.go b/test/cmp5.go
deleted file mode 100644
index 3a7d733f0..000000000
--- a/test/cmp5.go
+++ /dev/null
@@ -1,14 +0,0 @@
-// $G $D/$F.go && $L $F.$A && ! ./$A.out
-
-// Copyright 2009 The Go Authors. All rights reserved.
-// Use of this source code is governed by a BSD-style
-// license that can be found in the LICENSE file.
-
-package main
-
-func main() {
- var b []int
- var ib interface{} = b
- var m = make(map[interface{}] int)
- m[ib] = 1
-}
diff --git a/test/cmp6.go b/test/cmp6.go
index b3ea8ffeb..7d99aae18 100644
--- a/test/cmp6.go
+++ b/test/cmp6.go
@@ -1,9 +1,12 @@
-// errchk $G -e $D/$F.go
+// errorcheck
// Copyright 2010 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
+// Verify that incorrect comparisons are detected.
+// Does not compile.
+
package main
func use(bool) {}
@@ -11,22 +14,26 @@ func use(bool) {}
type T1 *int
type T2 *int
-type T3 struct {}
+type T3 struct{ z []int }
var t3 T3
+type T4 struct { _ []int; a float64 }
+
+var t4 T4
+
func main() {
// Arguments to comparison must be
// assignable one to the other (or vice versa)
// so chan int can be compared against
// directional channels but channel of different
// direction cannot be compared against each other.
- var c1 chan <-int
+ var c1 chan<- int
var c2 <-chan int
var c3 chan int
-
- use(c1 == c2) // ERROR "invalid operation|incompatible"
- use(c2 == c1) // ERROR "invalid operation|incompatible"
+
+ use(c1 == c2) // ERROR "invalid operation|incompatible"
+ use(c2 == c1) // ERROR "invalid operation|incompatible"
use(c1 == c3)
use(c2 == c2)
use(c3 == c1)
@@ -36,14 +43,33 @@ func main() {
var p1 T1
var p2 T2
var p3 *int
-
- use(p1 == p2) // ERROR "invalid operation|incompatible"
- use(p2 == p1) // ERROR "invalid operation|incompatible"
+
+ use(p1 == p2) // ERROR "invalid operation|incompatible"
+ use(p2 == p1) // ERROR "invalid operation|incompatible"
use(p1 == p3)
use(p2 == p2)
use(p3 == p1)
use(p3 == p2)
-
+
// Comparison of structs should have a good message
- use(t3 == t3) // ERROR "struct|expected"
+ use(t3 == t3) // ERROR "struct|expected"
+ use(t4 == t4) // ok; the []int is a blank field
+
+ // Slices, functions, and maps too.
+ var x []int
+ var f func()
+ var m map[int]int
+ use(x == x) // ERROR "slice can only be compared to nil"
+ use(f == f) // ERROR "func can only be compared to nil"
+ use(m == m) // ERROR "map can only be compared to nil"
+
+ // Comparison with interface that cannot return true
+ // (would panic).
+ var i interface{}
+ use(i == x) // ERROR "invalid operation"
+ use(x == i) // ERROR "invalid operation"
+ use(i == f) // ERROR "invalid operation"
+ use(f == i) // ERROR "invalid operation"
+ use(i == m) // ERROR "invalid operation"
+ use(m == i) // ERROR "invalid operation"
}
diff --git a/test/cmplx.go b/test/cmplx.go
index d5a77d684..248672e7d 100644
--- a/test/cmplx.go
+++ b/test/cmplx.go
@@ -1,9 +1,12 @@
-// errchk $G -e $D/$F.go
+// errorcheck
// Copyright 2010 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
+// Verify that incorrect invocations of the complex predeclared function are detected.
+// Does not compile.
+
package main
var (
diff --git a/test/cmplxdivide.c b/test/cmplxdivide.c
index b340f04d8..12dc4f1c0 100644
--- a/test/cmplxdivide.c
+++ b/test/cmplxdivide.c
@@ -51,6 +51,7 @@ main(void)
int i, j, k, l;
double complex n, d, q;
+ printf("// skip\n");
printf("// # generated by cmplxdivide.c\n");
printf("\n");
printf("package main\n");
diff --git a/test/cmplxdivide.go b/test/cmplxdivide.go
index 6a67b175d..92a98356d 100644
--- a/test/cmplxdivide.go
+++ b/test/cmplxdivide.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go $D/cmplxdivide1.go && $L $D/$F.$A && ./$A.out
+// run cmplxdivide1.go
// Copyright 2010 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
@@ -9,14 +9,14 @@
package main
import (
- "cmath"
"fmt"
"math"
+ "math/cmplx"
)
-type Test struct{
- f, g complex128
- out complex128
+type Test struct {
+ f, g complex128
+ out complex128
}
var nan = math.NaN()
@@ -25,9 +25,9 @@ var negzero = math.Copysign(0, -1)
func calike(a, b complex128) bool {
switch {
- case cmath.IsInf(a) && cmath.IsInf(b):
+ case cmplx.IsInf(a) && cmplx.IsInf(b):
return true
- case cmath.IsNaN(a) && cmath.IsNaN(b):
+ case cmplx.IsNaN(a) && cmplx.IsNaN(b):
return true
}
return a == b
@@ -36,7 +36,7 @@ func calike(a, b complex128) bool {
func main() {
bad := false
for _, t := range tests {
- x := t.f/t.g
+ x := t.f / t.g
if !calike(x, t.out) {
if !bad {
fmt.Printf("BUG\n")
diff --git a/test/cmplxdivide1.go b/test/cmplxdivide1.go
index 6a1dee9fe..e9031dd15 100644
--- a/test/cmplxdivide1.go
+++ b/test/cmplxdivide1.go
@@ -1,3 +1,4 @@
+// skip
// # generated by cmplxdivide.c
package main
diff --git a/test/complit.go b/test/complit.go
index f5f7aca9d..649be6d4d 100644
--- a/test/complit.go
+++ b/test/complit.go
@@ -1,9 +1,11 @@
-// $G $F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
+// Test composite literals.
+
package main
type T struct {
@@ -31,6 +33,18 @@ func eq(a []*R) {
}
}
+func teq(t *T, n int) {
+ for i := 0; i < n; i++ {
+ if t == nil || t.i != i {
+ panic("bad")
+ }
+ t = t.next
+ }
+ if t != nil {
+ panic("bad")
+ }
+}
+
type P struct {
a, b int
}
@@ -46,6 +60,9 @@ func main() {
var tp *T
tp = &T{0, 7.2, "hi", &t}
+ tl := &T{i: 0, next: &T{i: 1, next: &T{i: 2, next: &T{i: 3, next: &T{i: 4}}}}}
+ teq(tl, 5)
+
a1 := []int{1, 2, 3}
if len(a1) != 3 {
panic("a1")
@@ -93,6 +110,7 @@ func main() {
}
eq([]*R{itor(0), itor(1), itor(2), itor(3), itor(4), itor(5)})
+ eq([]*R{{0}, {1}, {2}, {3}, {4}, {5}})
p1 := NewP(1, 2)
p2 := NewP(1, 2)
diff --git a/test/complit1.go b/test/complit1.go
new file mode 100644
index 000000000..521401d73
--- /dev/null
+++ b/test/complit1.go
@@ -0,0 +1,42 @@
+// errorcheck
+
+// Copyright 2011 The Go Authors. All rights reserved.
+// Use of this source code is governed by a BSD-style
+// license that can be found in the LICENSE file.
+
+// Verify that illegal composite literals are detected.
+// Does not compile.
+
+package main
+
+var m map[int][3]int
+
+func f() [3]int
+
+func fp() *[3]int
+
+var mp map[int]*[3]int
+
+var (
+ _ = [3]int{1, 2, 3}[:] // ERROR "slice of unaddressable value"
+ _ = m[0][:] // ERROR "slice of unaddressable value"
+ _ = f()[:] // ERROR "slice of unaddressable value"
+
+ // these are okay because they are slicing a pointer to an array
+ _ = (&[3]int{1, 2, 3})[:]
+ _ = mp[0][:]
+ _ = fp()[:]
+)
+
+type T struct {
+ i int
+ f float64
+ s string
+ next *T
+}
+
+var (
+ _ = &T{0, 0, "", nil} // ok
+ _ = &T{i: 0, f: 0, s: "", next: {}} // ERROR "missing type in composite literal|omit types within composite literal"
+ _ = &T{0, 0, "", {}} // ERROR "missing type in composite literal|omit types within composite literal"
+)
diff --git a/test/compos.go b/test/compos.go
index 70f90f379..de688b39b 100644
--- a/test/compos.go
+++ b/test/compos.go
@@ -1,9 +1,11 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out || echo BUG: compos
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
+// Test that returning &T{} from a function causes an allocation.
+
package main
type T struct {
diff --git a/test/const.go b/test/const.go
index a55e13a40..80fbfaf3e 100644
--- a/test/const.go
+++ b/test/const.go
@@ -1,9 +1,11 @@
-// $G $F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
+// Test simple boolean and numeric constants.
+
package main
const (
diff --git a/test/const1.go b/test/const1.go
index 67f36e4fd..bc399c01c 100644
--- a/test/const1.go
+++ b/test/const1.go
@@ -1,9 +1,12 @@
-// errchk $G -e $F.go
+// errorcheck
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
+// Verify overflow is detected when using numeric constants.
+// Does not compile.
+
package main
type I interface{}
@@ -13,11 +16,11 @@ const (
Int8 int8 = 101
Minus1 int8 = -1
Uint8 uint8 = 102
- Const = 103
+ Const = 103
Float32 float32 = 104.5
Float64 float64 = 105.5
- ConstFloat = 106.5
+ ConstFloat = 106.5
Big float64 = 1e300
String = "abc"
@@ -35,32 +38,35 @@ var (
a8 = Int8 * Const / 100 // ERROR "overflow"
a9 = Int8 * (Const / 100) // OK
- b1 = Uint8 * Uint8 // ERROR "overflow"
- b2 = Uint8 * -1 // ERROR "overflow"
- b3 = Uint8 - Uint8 // OK
- b4 = Uint8 - Uint8 - Uint8 // ERROR "overflow"
- b5 = uint8(^0) // ERROR "overflow"
- b6 = ^uint8(0) // OK
- b7 = uint8(Minus1) // ERROR "overflow"
- b8 = uint8(int8(-1)) // ERROR "overflow"
- b8a = uint8(-1) // ERROR "overflow"
- b9 byte = (1 << 10) >> 8 // OK
- b10 byte = (1 << 10) // ERROR "overflow"
- b11 byte = (byte(1) << 10) >> 8 // ERROR "overflow"
- b12 byte = 1000 // ERROR "overflow"
- b13 byte = byte(1000) // ERROR "overflow"
- b14 byte = byte(100) * byte(100) // ERROR "overflow"
- b15 byte = byte(100) * 100 // ERROR "overflow"
- b16 byte = byte(0) * 1000 // ERROR "overflow"
- b16a byte = 0 * 1000 // OK
- b17 byte = byte(0) * byte(1000) // ERROR "overflow"
- b18 byte = Uint8 / 0 // ERROR "division by zero"
+ b1 = Uint8 * Uint8 // ERROR "overflow"
+ b2 = Uint8 * -1 // ERROR "overflow"
+ b3 = Uint8 - Uint8 // OK
+ b4 = Uint8 - Uint8 - Uint8 // ERROR "overflow"
+ b5 = uint8(^0) // ERROR "overflow"
+ b5a = int64(^0) // OK
+ b6 = ^uint8(0) // OK
+ b6a = ^int64(0) // OK
+ b7 = uint8(Minus1) // ERROR "overflow"
+ b8 = uint8(int8(-1)) // ERROR "overflow"
+ b8a = uint8(-1) // ERROR "overflow"
+ b9 byte = (1 << 10) >> 8 // OK
+ b10 byte = (1 << 10) // ERROR "overflow"
+ b11 byte = (byte(1) << 10) >> 8 // ERROR "overflow"
+ b12 byte = 1000 // ERROR "overflow"
+ b13 byte = byte(1000) // ERROR "overflow"
+ b14 byte = byte(100) * byte(100) // ERROR "overflow"
+ b15 byte = byte(100) * 100 // ERROR "overflow"
+ b16 byte = byte(0) * 1000 // ERROR "overflow"
+ b16a byte = 0 * 1000 // OK
+ b17 byte = byte(0) * byte(1000) // ERROR "overflow"
+ b18 byte = Uint8 / 0 // ERROR "division by zero"
- c1 float64 = Big
- c2 float64 = Big * Big // ERROR "overflow"
- c3 float64 = float64(Big) * Big // ERROR "overflow"
- c4 = Big * Big // ERROR "overflow"
- c5 = Big / 0 // ERROR "division by zero"
+ c1 float64 = Big
+ c2 float64 = Big * Big // ERROR "overflow"
+ c3 float64 = float64(Big) * Big // ERROR "overflow"
+ c4 = Big * Big // ERROR "overflow"
+ c5 = Big / 0 // ERROR "division by zero"
+ c6 = 1000 % 1e3 // ERROR "floating-point % operation"
)
func f(int)
diff --git a/test/const2.go b/test/const2.go
index bea1b9912..97d3d4c7d 100644
--- a/test/const2.go
+++ b/test/const2.go
@@ -1,12 +1,21 @@
-// errchk $G $D/$F.go
+// errorcheck
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
+// Verify that large integer constant expressions cause overflow.
+// Does not compile.
+
package main
const (
A int = 1
B byte; // ERROR "type without expr|expected .=."
)
+
+const LargeA = 1000000000000000000
+const LargeB = LargeA * LargeA * LargeA
+const LargeC = LargeB * LargeB * LargeB // ERROR "constant multiplication overflow"
+
+const AlsoLargeA = LargeA << 400 << 400 >> 400 >> 400 // ERROR "constant shift overflow"
diff --git a/test/const3.go b/test/const3.go
index 9bba6ced0..3f4e3d1ae 100644
--- a/test/const3.go
+++ b/test/const3.go
@@ -1,9 +1,11 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
+// Test typed integer constants.
+
package main
import "fmt"
diff --git a/test/const4.go b/test/const4.go
new file mode 100644
index 000000000..677fcefa7
--- /dev/null
+++ b/test/const4.go
@@ -0,0 +1,77 @@
+// run
+
+// Copyright 2011 The Go Authors. All rights reserved.
+// Use of this source code is governed by a BSD-style
+// license that can be found in the LICENSE file.
+
+// Test len constants and non-constants, http://golang.org/issue/3244.
+
+package main
+
+var b struct {
+ a[10]int
+}
+
+var m map[string][20]int
+
+var s [][30]int
+
+const (
+ n1 = len(b.a)
+ n2 = len(m[""])
+ n3 = len(s[10])
+)
+
+// Non-constants (see also const5.go).
+var (
+ n4 = len(f())
+ n5 = len(<-c)
+ n6 = cap(g())
+ n7 = cap(<-c1)
+)
+
+var calledF = false
+
+func f() *[40]int {
+ calledF = true
+ return nil
+}
+
+var c = func() chan *[50]int {
+ c := make(chan *[50]int, 2)
+ c <- nil
+ c <- new([50]int)
+ return c
+}()
+
+var calledG = false
+
+func g() *[60]int {
+ calledG = true
+ return nil
+}
+
+var c1 = func() chan *[70]int {
+ c := make(chan *[70]int, 2)
+ c <- nil
+ c <- new([70]int)
+ return c
+}()
+
+func main() {
+ if n1 != 10 || n2 != 20 || n3 != 30 || n4 != 40 || n5 != 50 || n6 != 60 || n7 != 70 {
+ println("BUG:", n1, n2, n3, n4, n5, n6, n7)
+ }
+ if !calledF {
+ println("BUG: did not call f")
+ }
+ if <-c == nil {
+ println("BUG: did not receive from c")
+ }
+ if !calledG {
+ println("BUG: did not call g")
+ }
+ if <-c1 == nil {
+ println("BUG: did not receive from c1")
+ }
+}
diff --git a/test/const5.go b/test/const5.go
new file mode 100644
index 000000000..8e0385e9a
--- /dev/null
+++ b/test/const5.go
@@ -0,0 +1,33 @@
+// errorcheck
+
+// Copyright 2011 The Go Authors. All rights reserved.
+// Use of this source code is governed by a BSD-style
+// license that can be found in the LICENSE file.
+
+// Test that len non-constants are not constants, http://golang.org/issue/3244.
+
+package p
+
+var b struct {
+ a[10]int
+}
+
+var m map[string][20]int
+
+var s [][30]int
+
+func f() *[40]int
+var c chan *[50]int
+
+const (
+ n1 = len(b.a)
+ n2 = len(m[""])
+ n3 = len(s[10])
+
+ n4 = len(f()) // ERROR "must be constant"
+ n5 = len(<-c) // ERROR "must be constant"
+
+ n6 = cap(f()) // ERROR "must be constant"
+ n7 = cap(<-c) // ERROR "must be constant"
+)
+
diff --git a/test/convert.go b/test/convert.go
index 0a75663d0..7280edf33 100644
--- a/test/convert.go
+++ b/test/convert.go
@@ -1,9 +1,11 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
+// Test types of constant expressions, using reflect.
+
package main
import "reflect"
diff --git a/test/convert1.go b/test/convert1.go
new file mode 100644
index 000000000..0f417a338
--- /dev/null
+++ b/test/convert1.go
@@ -0,0 +1,99 @@
+// errorcheck
+
+// Copyright 2011 The Go Authors. All rights reserved.
+// Use of this source code is governed by a BSD-style
+// license that can be found in the LICENSE file.
+
+// Verify that illegal conversions involving strings are detected.
+// Does not compile.
+
+package main
+
+type Tbyte []byte
+type Trune []rune
+type Tint64 []int64
+type Tstring string
+
+func main() {
+ s := "hello"
+ sb := []byte("hello")
+ sr := []rune("hello")
+ si := []int64{'h', 'e', 'l', 'l', 'o'}
+
+ ts := Tstring(s)
+ tsb := Tbyte(sb)
+ tsr := Trune(sr)
+ tsi := Tint64(si)
+
+ _ = string(s)
+ _ = []byte(s)
+ _ = []rune(s)
+ _ = []int64(s) // ERROR "cannot convert.*\[\]int64|invalid type conversion"
+ _ = Tstring(s)
+ _ = Tbyte(s)
+ _ = Trune(s)
+ _ = Tint64(s) // ERROR "cannot convert.*Tint64|invalid type conversion"
+
+ _ = string(sb)
+ _ = []byte(sb)
+ _ = []rune(sb) // ERROR "cannot convert.*\[\]rune|invalid type conversion"
+ _ = []int64(sb) // ERROR "cannot convert.*\[\]int64|invalid type conversion"
+ _ = Tstring(sb)
+ _ = Tbyte(sb)
+ _ = Trune(sb) // ERROR "cannot convert.*Trune|invalid type conversion"
+ _ = Tint64(sb) // ERROR "cannot convert.*Tint64|invalid type conversion"
+
+ _ = string(sr)
+ _ = []byte(sr) // ERROR "cannot convert.*\[\]byte|invalid type conversion"
+ _ = []rune(sr)
+ _ = []int64(sr) // ERROR "cannot convert.*\[\]int64|invalid type conversion"
+ _ = Tstring(sr)
+ _ = Tbyte(sr) // ERROR "cannot convert.*Tbyte|invalid type conversion"
+ _ = Trune(sr)
+ _ = Tint64(sr) // ERROR "cannot convert.*Tint64|invalid type conversion"
+
+ _ = string(si) // ERROR "cannot convert.* string|invalid type conversion"
+ _ = []byte(si) // ERROR "cannot convert.*\[\]byte|invalid type conversion"
+ _ = []rune(si) // ERROR "cannot convert.*\[\]rune|invalid type conversion"
+ _ = []int64(si)
+ _ = Tstring(si) // ERROR "cannot convert.*Tstring|invalid type conversion"
+ _ = Tbyte(si) // ERROR "cannot convert.*Tbyte|invalid type conversion"
+ _ = Trune(si) // ERROR "cannot convert.*Trune|invalid type conversion"
+ _ = Tint64(si)
+
+ _ = string(ts)
+ _ = []byte(ts)
+ _ = []rune(ts)
+ _ = []int64(ts) // ERROR "cannot convert.*\[\]int64|invalid type conversion"
+ _ = Tstring(ts)
+ _ = Tbyte(ts)
+ _ = Trune(ts)
+ _ = Tint64(ts) // ERROR "cannot convert.*Tint64|invalid type conversion"
+
+ _ = string(tsb)
+ _ = []byte(tsb)
+ _ = []rune(tsb) // ERROR "cannot convert.*\[\]rune|invalid type conversion"
+ _ = []int64(tsb) // ERROR "cannot convert.*\[\]int64|invalid type conversion"
+ _ = Tstring(tsb)
+ _ = Tbyte(tsb)
+ _ = Trune(tsb) // ERROR "cannot convert.*Trune|invalid type conversion"
+ _ = Tint64(tsb) // ERROR "cannot convert.*Tint64|invalid type conversion"
+
+ _ = string(tsr)
+ _ = []byte(tsr) // ERROR "cannot convert.*\[\]byte|invalid type conversion"
+ _ = []rune(tsr)
+ _ = []int64(tsr) // ERROR "cannot convert.*\[\]int64|invalid type conversion"
+ _ = Tstring(tsr)
+ _ = Tbyte(tsr) // ERROR "cannot convert.*Tbyte|invalid type conversion"
+ _ = Trune(tsr)
+ _ = Tint64(tsr) // ERROR "cannot convert.*Tint64|invalid type conversion"
+
+ _ = string(tsi) // ERROR "cannot convert.* string|invalid type conversion"
+ _ = []byte(tsi) // ERROR "cannot convert.*\[\]byte|invalid type conversion"
+ _ = []rune(tsi) // ERROR "cannot convert.*\[\]rune|invalid type conversion"
+ _ = []int64(tsi)
+ _ = Tstring(tsi) // ERROR "cannot convert.*Tstring|invalid type conversion"
+ _ = Tbyte(tsi) // ERROR "cannot convert.*Tbyte|invalid type conversion"
+ _ = Trune(tsi) // ERROR "cannot convert.*Trune|invalid type conversion"
+ _ = Tint64(tsi)
+}
diff --git a/test/convert3.go b/test/convert3.go
index be68c95b3..143aff04f 100644
--- a/test/convert3.go
+++ b/test/convert3.go
@@ -1,9 +1,12 @@
-// errchk $G $D/$F.go
+// errorcheck
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
+// Verify allowed and disallowed conversions.
+// Does not compile.
+
package main
// everything here is legal except the ERROR line
diff --git a/test/convlit.go b/test/convlit.go
index 90ac5490c..8a6145d2a 100644
--- a/test/convlit.go
+++ b/test/convlit.go
@@ -1,14 +1,15 @@
-// errchk $G -e $D/$F.go
+// errorcheck
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
+// Verify that illegal assignments with both explicit and implicit conversions of literals are detected.
+// Does not compile.
+
package main
-// explicit conversion of constants is work in progress.
-// the ERRORs in this block are debatable, but they're what
-// the language spec says for now.
+// explicit conversion of constants
var x1 = string(1)
var x2 string = string(1)
var x3 = int(1.5) // ERROR "convert|truncate"
@@ -36,7 +37,7 @@ var good3 int = 1e9
var good4 float64 = 1e20
// explicit conversion of string is okay
-var _ = []int("abc")
+var _ = []rune("abc")
var _ = []byte("abc")
// implicit is not
@@ -47,20 +48,20 @@ var _ []byte = "abc" // ERROR "cannot use|incompatible|invalid"
type Tstring string
var ss Tstring = "abc"
-var _ = []int(ss)
+var _ = []rune(ss)
var _ = []byte(ss)
// implicit is still not
-var _ []int = ss // ERROR "cannot use|incompatible|invalid"
+var _ []rune = ss // ERROR "cannot use|incompatible|invalid"
var _ []byte = ss // ERROR "cannot use|incompatible|invalid"
-// named slice is not
-type Tint []int
+// named slice is now ok
+type Trune []rune
type Tbyte []byte
-var _ = Tint("abc") // ERROR "convert|incompatible|invalid"
-var _ = Tbyte("abc") // ERROR "convert|incompatible|invalid"
+var _ = Trune("abc") // ok
+var _ = Tbyte("abc") // ok
// implicit is still not
-var _ Tint = "abc" // ERROR "cannot use|incompatible|invalid"
+var _ Trune = "abc" // ERROR "cannot use|incompatible|invalid"
var _ Tbyte = "abc" // ERROR "cannot use|incompatible|invalid"
diff --git a/test/convlit1.go b/test/convlit1.go
index 1e6673cb6..c06bd7443 100644
--- a/test/convlit1.go
+++ b/test/convlit1.go
@@ -1,9 +1,12 @@
-// errchk $G $D/$F.go
+// errorcheck
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
+// Verify that illegal uses of composite literals are detected.
+// Does not compile.
+
package main
var a = []int { "a" }; // ERROR "conver|incompatible|cannot"
diff --git a/test/copy.go b/test/copy.go
index 0b5bddbed..65ffb6ff8 100644
--- a/test/copy.go
+++ b/test/copy.go
@@ -1,10 +1,10 @@
-// $G $F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
-// Semi-exhaustive test for copy()
+// Semi-exhaustive test for the copy predeclared function.
package main
diff --git a/test/crlf.go b/test/crlf.go
new file mode 100644
index 000000000..292b63bf4
--- /dev/null
+++ b/test/crlf.go
@@ -0,0 +1,52 @@
+// $G $D/$F.go && $L $F.$A && ./$A.out >tmp.go &&
+// $G tmp.go && $L tmp.$A && ./$A.out
+// rm -f tmp.go
+
+// Copyright 2011 The Go Authors. All rights reserved.
+// Use of this source code is governed by a BSD-style
+// license that can be found in the LICENSE file.
+
+// Test source files and strings containing \r and \r\n.
+
+package main
+
+import (
+ "fmt"
+ "strings"
+)
+
+func main() {
+ prog = strings.Replace(prog, "BQ", "`", -1)
+ prog = strings.Replace(prog, "CR", "\r", -1)
+ fmt.Print(prog)
+}
+
+var prog = `
+package main
+CR
+
+import "fmt"
+
+var CR s = "hello\n" + CR
+ " world"CR
+
+var t = BQhelloCR
+ worldBQ
+
+var u = BQhCReCRlCRlCRoCR
+ worldBQ
+
+var golden = "hello\n world"
+
+func main() {
+ if s != golden {
+ fmt.Printf("s=%q, want %q", s, golden)
+ }
+ if t != golden {
+ fmt.Printf("t=%q, want %q", t, golden)
+ }
+ if u != golden {
+ fmt.Printf("u=%q, want %q", u, golden)
+ }
+}
+`
diff --git a/test/ddd.go b/test/ddd.go
index b95d6e883..01768b89f 100644
--- a/test/ddd.go
+++ b/test/ddd.go
@@ -1,9 +1,11 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2010 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
+// Test variadic functions and calls (dot-dot-dot).
+
package main
func sum(args ...int) int {
@@ -58,6 +60,10 @@ type U struct {
*T
}
+type I interface {
+ Sum(...int) int
+}
+
func main() {
if x := sum(1, 2, 3); x != 6 {
println("sum 6", x)
@@ -205,7 +211,14 @@ func main() {
println("i(=u).Sum", x)
panic("fail")
}
- /* TODO(rsc): Enable once nested method expressions work.
+ var s struct {
+ I
+ }
+ s.I = &u
+ if x := s.Sum(2, 3, 5, 8); x != 18 {
+ println("s{&u}.Sum", x)
+ panic("fail")
+ }
if x := (*U).Sum(&U{}, 1, 3, 5, 2); x != 11 {
println("(*U).Sum", x)
panic("fail")
@@ -214,5 +227,4 @@ func main() {
println("U.Sum", x)
panic("fail")
}
- */
}
diff --git a/test/ddd1.go b/test/ddd1.go
index 83e32de7b..1e070093c 100644
--- a/test/ddd1.go
+++ b/test/ddd1.go
@@ -1,9 +1,12 @@
-// errchk $G -e $D/$F.go
+// errorcheck
// Copyright 2010 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
+// Verify that illegal uses of ... are detected.
+// Does not compile.
+
package main
import "unsafe"
@@ -15,8 +18,8 @@ var (
_ = sum()
_ = sum(1.0, 2.0)
_ = sum(1.5) // ERROR "integer"
- _ = sum("hello") // ERROR "string.*as type int|incompatible"
- _ = sum([]int{1}) // ERROR "slice literal.*as type int|incompatible"
+ _ = sum("hello") // ERROR ".hello. .type string. as type int|incompatible"
+ _ = sum([]int{1}) // ERROR "\[\]int literal.*as type int|incompatible"
)
type T []T
diff --git a/test/ddd2.go b/test/ddd2.go
index a06af0c06..a141a39c7 100644
--- a/test/ddd2.go
+++ b/test/ddd2.go
@@ -1,9 +1,11 @@
-// true
+// skip
// Copyright 2010 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
+// This file is compiled and then imported by ddd3.go.
+
package ddd
func Sum(args ...int) int {
diff --git a/test/ddd3.go b/test/ddd3.go
index 5d5ebdf0f..82fce3149 100644
--- a/test/ddd3.go
+++ b/test/ddd3.go
@@ -4,6 +4,8 @@
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
+// Test that variadic functions work across package boundaries.
+
package main
import "./ddd2"
diff --git a/test/decl.go b/test/decl.go
index 95b6346c3..6f84245f1 100644
--- a/test/decl.go
+++ b/test/decl.go
@@ -1,10 +1,10 @@
-// $G $F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
-// Correct short declarations and redeclarations.
+// Test correct short declarations and redeclarations.
package main
diff --git a/test/declbad.go b/test/declbad.go
index 09f1dfb57..32d68e7ea 100644
--- a/test/declbad.go
+++ b/test/declbad.go
@@ -1,10 +1,11 @@
-// errchk $G -e $F.go
+// errorcheck
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
-// Incorrect short declarations and redeclarations.
+// Test that incorrect short declarations and redeclarations are detected.
+// Does not compile.
package main
diff --git a/test/defer.go b/test/defer.go
index bef8fbe26..2f67d3560 100644
--- a/test/defer.go
+++ b/test/defer.go
@@ -1,9 +1,11 @@
-// $G $F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
+// Test defer.
+
package main
import "fmt"
diff --git a/test/deferprint.go b/test/deferprint.go
index f1e75266f..72c98b19f 100644
--- a/test/deferprint.go
+++ b/test/deferprint.go
@@ -1,14 +1,17 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// cmpout
// Copyright 2010 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
+// Test that we can defer the predeclared functions print and println.
+
package main
func main() {
defer println(42, true, false, true, 1.5, "world", (chan int)(nil), []int(nil), (map[string]int)(nil), (func())(nil), byte(255))
defer println(1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20)
-// defer panic("dead")
+ // Disabled so the test doesn't crash but left here for reference.
+ // defer panic("dead")
defer print("printing: ")
}
diff --git a/test/deferprint.out b/test/deferprint.out
new file mode 100644
index 000000000..a71cfcebd
--- /dev/null
+++ b/test/deferprint.out
@@ -0,0 +1,2 @@
+printing: 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20
+42 true false true +1.500000e+000 world 0x0 [0/0]0x0 0x0 0x0 255
diff --git a/test/divide.go b/test/divide.go
index 5c0f45059..c91a33e9d 100644
--- a/test/divide.go
+++ b/test/divide.go
@@ -1,10 +1,10 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2011 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
-// divide corner cases
+// Test divide corner cases.
package main
diff --git a/test/dwarf/linedirectives.go b/test/dwarf/linedirectives.go
index 68434f0ab..cc4ffb000 100755..100644
--- a/test/dwarf/linedirectives.go
+++ b/test/dwarf/linedirectives.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2011 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/empty.go b/test/empty.go
index fa10d6931..92a79a4e0 100644
--- a/test/empty.go
+++ b/test/empty.go
@@ -1,9 +1,12 @@
-// $G $D/$F.go
+// compile
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
+// Test that top-level parenthesized declarations can be empty.
+// Compiles but does not run.
+
package P
import ( )
diff --git a/test/env.go b/test/env.go
index 28113bcb0..972374679 100644
--- a/test/env.go
+++ b/test/env.go
@@ -1,9 +1,12 @@
-// $G $F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
+// Test that the Go environment variables are present and accessible through
+// package os and package runtime.
+
package main
import (
@@ -12,18 +15,14 @@ import (
)
func main() {
- ga, e0 := os.Getenverror("GOARCH")
- if e0 != nil {
- print("$GOARCH: ", e0.String(), "\n")
- os.Exit(1)
- }
+ ga := os.Getenv("GOARCH")
if ga != runtime.GOARCH {
print("$GOARCH=", ga, "!= runtime.GOARCH=", runtime.GOARCH, "\n")
os.Exit(1)
}
- xxx, e1 := os.Getenverror("DOES_NOT_EXIST")
- if e1 != os.ENOENV {
- print("$DOES_NOT_EXIST=", xxx, "; err = ", e1.String(), "\n")
+ xxx := os.Getenv("DOES_NOT_EXIST")
+ if xxx != "" {
+ print("$DOES_NOT_EXIST=", xxx, "\n")
os.Exit(1)
}
}
diff --git a/test/eof.go b/test/eof.go
index 81f9fd028..06c779046 100644
--- a/test/eof.go
+++ b/test/eof.go
@@ -1,9 +1,12 @@
-// $G $D/$F.go
+// compile
// Copyright 2010 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
+// Test a source file does not need a final newline.
+// Compiles but does not run.
+
// No newline at the end of this file.
package main \ No newline at end of file
diff --git a/test/eof1.go b/test/eof1.go
index c39a3cfdb..2105b8908 100644
--- a/test/eof1.go
+++ b/test/eof1.go
@@ -1,9 +1,12 @@
-// $G $D/$F.go
+// compile
// Copyright 2010 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
-package main
+// Test that a comment ending a source file does not need a final newline.
+// Compiles but does not run.
+
+package eof1
// No newline at the end of this comment. \ No newline at end of file
diff --git a/test/escape.go b/test/escape.go
index d4d844704..e487bb895 100644
--- a/test/escape.go
+++ b/test/escape.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
@@ -6,8 +6,8 @@
package main
-// check for correct heap-moving of escaped variables.
-// it is hard to check for the allocations, but it is easy
+// Test for correct heap-moving of escaped variables.
+// It is hard to check for the allocations, but it is easy
// to check that if you call the function twice at the
// same stack level, the pointers returned should be
// different.
diff --git a/test/escape2.go b/test/escape2.go
new file mode 100644
index 000000000..624ea80b5
--- /dev/null
+++ b/test/escape2.go
@@ -0,0 +1,1067 @@
+// errchk -0 $G -m -l $D/$F.go
+
+// Copyright 2010 The Go Authors. All rights reserved.
+// Use of this source code is governed by a BSD-style
+// license that can be found in the LICENSE file.
+
+// Test, using compiler diagnostic flags, that the escape analysis is working.
+// Compiles but does not run. Inlining is disabled.
+
+package foo
+
+import (
+ "fmt"
+ "unsafe"
+)
+
+var gxx *int
+
+func foo1(x int) { // ERROR "moved to heap: x"
+ gxx = &x // ERROR "&x escapes to heap"
+}
+
+func foo2(yy *int) { // ERROR "leaking param: yy"
+ gxx = yy
+}
+
+func foo3(x int) *int { // ERROR "moved to heap: x"
+ return &x // ERROR "&x escapes to heap"
+}
+
+type T *T
+
+func foo3b(t T) { // ERROR "leaking param: t"
+ *t = t
+}
+
+// xx isn't going anywhere, so use of yy is ok
+func foo4(xx, yy *int) { // ERROR "xx does not escape" "yy does not escape"
+ xx = yy
+}
+
+// xx isn't going anywhere, so taking address of yy is ok
+func foo5(xx **int, yy *int) { // ERROR "xx does not escape" "yy does not escape"
+ xx = &yy // ERROR "&yy does not escape"
+}
+
+func foo6(xx **int, yy *int) { // ERROR "xx does not escape" "leaking param: yy"
+ *xx = yy
+}
+
+func foo7(xx **int, yy *int) { // ERROR "xx does not escape" "yy does not escape"
+ **xx = *yy
+}
+
+func foo8(xx, yy *int) int { // ERROR "xx does not escape" "yy does not escape"
+ xx = yy
+ return *xx
+}
+
+func foo9(xx, yy *int) *int { // ERROR "leaking param: xx" "leaking param: yy"
+ xx = yy
+ return xx
+}
+
+func foo10(xx, yy *int) { // ERROR "xx does not escape" "yy does not escape"
+ *xx = *yy
+}
+
+func foo11() int {
+ x, y := 0, 42
+ xx := &x // ERROR "&x does not escape"
+ yy := &y // ERROR "&y does not escape"
+ *xx = *yy
+ return x
+}
+
+var xxx **int
+
+func foo12(yyy **int) { // ERROR "leaking param: yyy"
+ xxx = yyy
+}
+
+func foo13(yyy **int) { // ERROR "yyy does not escape"
+ *xxx = *yyy
+}
+
+func foo14(yyy **int) { // ERROR "yyy does not escape"
+ **xxx = **yyy
+}
+
+func foo15(yy *int) { // ERROR "moved to heap: yy"
+ xxx = &yy // ERROR "&yy escapes to heap"
+}
+
+func foo16(yy *int) { // ERROR "leaking param: yy"
+ *xxx = yy
+}
+
+func foo17(yy *int) { // ERROR "yy does not escape"
+ **xxx = *yy
+}
+
+func foo18(y int) { // ERROR "moved to heap: "y"
+ *xxx = &y // ERROR "&y escapes to heap"
+}
+
+func foo19(y int) {
+ **xxx = y
+}
+
+type Bar struct {
+ i int
+ ii *int
+}
+
+func NewBar() *Bar {
+ return &Bar{42, nil} // ERROR "&Bar literal escapes to heap"
+}
+
+func NewBarp(x *int) *Bar { // ERROR "leaking param: x"
+ return &Bar{42, x} // ERROR "&Bar literal escapes to heap"
+}
+
+func NewBarp2(x *int) *Bar { // ERROR "x does not escape"
+ return &Bar{*x, nil} // ERROR "&Bar literal escapes to heap"
+}
+
+func (b *Bar) NoLeak() int { // ERROR "b does not escape"
+ return *(b.ii)
+}
+
+func (b *Bar) Leak() *int { // ERROR "leaking param: b"
+ return &b.i // ERROR "&b.i escapes to heap"
+}
+
+func (b *Bar) AlsoNoLeak() *int { // ERROR "b does not escape"
+ return b.ii
+}
+
+func (b Bar) AlsoLeak() *int { // ERROR "leaking param: b"
+ return b.ii
+}
+
+func (b Bar) LeaksToo() *int { // ERROR "leaking param: b"
+ v := 0 // ERROR "moved to heap: v"
+ b.ii = &v // ERROR "&v escapes"
+ return b.ii
+}
+
+func (b *Bar) LeaksABit() *int { // ERROR "b does not escape"
+ v := 0 // ERROR "moved to heap: v"
+ b.ii = &v // ERROR "&v escapes"
+ return b.ii
+}
+
+func (b Bar) StillNoLeak() int { // ERROR "b does not escape"
+ v := 0
+ b.ii = &v // ERROR "&v does not escape"
+ return b.i
+}
+
+func goLeak(b *Bar) { // ERROR "leaking param: b"
+ go b.NoLeak()
+}
+
+type Bar2 struct {
+ i [12]int
+ ii []int
+}
+
+func NewBar2() *Bar2 {
+ return &Bar2{[12]int{42}, nil} // ERROR "&Bar2 literal escapes to heap"
+}
+
+func (b *Bar2) NoLeak() int { // ERROR "b does not escape"
+ return b.i[0]
+}
+
+func (b *Bar2) Leak() []int { // ERROR "leaking param: b"
+ return b.i[:] // ERROR "b.i escapes to heap"
+}
+
+func (b *Bar2) AlsoNoLeak() []int { // ERROR "b does not escape"
+ return b.ii[0:1]
+}
+
+func (b Bar2) AgainNoLeak() [12]int { // ERROR "b does not escape"
+ return b.i
+}
+
+func (b *Bar2) LeakSelf() { // ERROR "leaking param: b"
+ b.ii = b.i[0:4] // ERROR "b.i escapes to heap"
+}
+
+func (b *Bar2) LeakSelf2() { // ERROR "leaking param: b"
+ var buf []int
+ buf = b.i[0:] // ERROR "b.i escapes to heap"
+ b.ii = buf
+}
+
+func foo21() func() int {
+ x := 42 // ERROR "moved to heap: x"
+ return func() int { // ERROR "func literal escapes to heap"
+ return x // ERROR "&x escapes to heap"
+ }
+}
+
+func foo22() int {
+ x := 42
+ return func() int { // ERROR "func literal does not escape"
+ return x
+ }()
+}
+
+func foo23(x int) func() int { // ERROR "moved to heap: x"
+ return func() int { // ERROR "func literal escapes to heap"
+ return x // ERROR "&x escapes to heap"
+ }
+}
+
+func foo23a(x int) func() int { // ERROR "moved to heap: x"
+ f := func() int { // ERROR "func literal escapes to heap"
+ return x // ERROR "&x escapes to heap"
+ }
+ return f
+}
+
+func foo23b(x int) *(func() int) { // ERROR "moved to heap: x"
+ f := func() int { return x } // ERROR "moved to heap: f" "func literal escapes to heap" "&x escapes to heap"
+ return &f // ERROR "&f escapes to heap"
+}
+
+func foo24(x int) int {
+ return func() int { // ERROR "func literal does not escape"
+ return x
+ }()
+}
+
+var x *int
+
+func fooleak(xx *int) int { // ERROR "leaking param: xx"
+ x = xx
+ return *x
+}
+
+func foonoleak(xx *int) int { // ERROR "xx does not escape"
+ return *x + *xx
+}
+
+func foo31(x int) int { // ERROR "moved to heap: x"
+ return fooleak(&x) // ERROR "&x escapes to heap"
+}
+
+func foo32(x int) int {
+ return foonoleak(&x) // ERROR "&x does not escape"
+}
+
+type Foo struct {
+ xx *int
+ x int
+}
+
+var F Foo
+var pf *Foo
+
+func (f *Foo) fooleak() { // ERROR "leaking param: f"
+ pf = f
+}
+
+func (f *Foo) foonoleak() { // ERROR "f does not escape"
+ F.x = f.x
+}
+
+func (f *Foo) Leak() { // ERROR "leaking param: f"
+ f.fooleak()
+}
+
+func (f *Foo) NoLeak() { // ERROR "f does not escape"
+ f.foonoleak()
+}
+
+func foo41(x int) { // ERROR "moved to heap: x"
+ F.xx = &x // ERROR "&x escapes to heap"
+}
+
+func (f *Foo) foo42(x int) { // ERROR "f does not escape" "moved to heap: x"
+ f.xx = &x // ERROR "&x escapes to heap"
+}
+
+func foo43(f *Foo, x int) { // ERROR "f does not escape" "moved to heap: x"
+ f.xx = &x // ERROR "&x escapes to heap"
+}
+
+func foo44(yy *int) { // ERROR "leaking param: yy"
+ F.xx = yy
+}
+
+func (f *Foo) foo45() { // ERROR "f does not escape"
+ F.x = f.x
+}
+
+func (f *Foo) foo46() { // ERROR "f does not escape"
+ F.xx = f.xx
+}
+
+func (f *Foo) foo47() { // ERROR "leaking param: f"
+ f.xx = &f.x // ERROR "&f.x escapes to heap"
+}
+
+var ptrSlice []*int
+
+func foo50(i *int) { // ERROR "leaking param: i"
+ ptrSlice[0] = i
+}
+
+var ptrMap map[*int]*int
+
+func foo51(i *int) { // ERROR "leaking param: i"
+ ptrMap[i] = i
+}
+
+func indaddr1(x int) *int { // ERROR "moved to heap: x"
+ return &x // ERROR "&x escapes to heap"
+}
+
+func indaddr2(x *int) *int { // ERROR "leaking param: x"
+ return *&x // ERROR "&x does not escape"
+}
+
+func indaddr3(x *int32) *int { // ERROR "leaking param: x"
+ return *(**int)(unsafe.Pointer(&x)) // ERROR "&x does not escape"
+}
+
+// From package math:
+
+func Float32bits(f float32) uint32 {
+ return *(*uint32)(unsafe.Pointer(&f)) // ERROR "&f does not escape"
+}
+
+func Float32frombits(b uint32) float32 {
+ return *(*float32)(unsafe.Pointer(&b)) // ERROR "&b does not escape"
+}
+
+func Float64bits(f float64) uint64 {
+ return *(*uint64)(unsafe.Pointer(&f)) // ERROR "&f does not escape"
+}
+
+func Float64frombits(b uint64) float64 {
+ return *(*float64)(unsafe.Pointer(&b)) // ERROR "&b does not escape"
+}
+
+// contrast with
+func float64bitsptr(f float64) *uint64 { // ERROR "moved to heap: f"
+ return (*uint64)(unsafe.Pointer(&f)) // ERROR "&f escapes to heap"
+}
+
+func float64ptrbitsptr(f *float64) *uint64 { // ERROR "leaking param: f"
+ return (*uint64)(unsafe.Pointer(f))
+}
+
+func typesw(i interface{}) *int { // ERROR "leaking param: i"
+ switch val := i.(type) {
+ case *int:
+ return val
+ case *int8:
+ v := int(*val) // ERROR "moved to heap: v"
+ return &v // ERROR "&v escapes to heap"
+ }
+ return nil
+}
+
+func exprsw(i *int) *int { // ERROR "leaking param: i"
+ switch j := i; *j + 110 {
+ case 12:
+ return j
+ case 42:
+ return nil
+ }
+ return nil
+
+}
+
+// assigning to an array element is like assigning to the array
+func foo60(i *int) *int { // ERROR "leaking param: i"
+ var a [12]*int
+ a[0] = i
+ return a[1]
+}
+
+func foo60a(i *int) *int { // ERROR "i does not escape"
+ var a [12]*int
+ a[0] = i
+ return nil
+}
+
+// assigning to a struct field is like assigning to the struct
+func foo61(i *int) *int { // ERROR "leaking param: i"
+ type S struct {
+ a, b *int
+ }
+ var s S
+ s.a = i
+ return s.b
+}
+
+func foo61a(i *int) *int { // ERROR "i does not escape"
+ type S struct {
+ a, b *int
+ }
+ var s S
+ s.a = i
+ return nil
+}
+
+// assigning to a struct field is like assigning to the struct but
+// here this subtlety is lost, since s.a counts as an assignment to a
+// track-losing dereference.
+func foo62(i *int) *int { // ERROR "leaking param: i"
+ type S struct {
+ a, b *int
+ }
+ s := new(S) // ERROR "new[(]S[)] does not escape"
+ s.a = i
+ return nil // s.b
+}
+
+type M interface {
+ M()
+}
+
+func foo63(m M) { // ERROR "m does not escape"
+}
+
+func foo64(m M) { // ERROR "leaking param: m"
+ m.M()
+}
+
+func foo64b(m M) { // ERROR "leaking param: m"
+ defer m.M()
+}
+
+type MV int
+
+func (MV) M() {}
+
+func foo65() {
+ var mv MV
+ foo63(&mv) // ERROR "&mv does not escape"
+}
+
+func foo66() {
+ var mv MV // ERROR "moved to heap: mv"
+ foo64(&mv) // ERROR "&mv escapes to heap"
+}
+
+func foo67() {
+ var mv MV
+ foo63(mv)
+}
+
+func foo68() {
+ var mv MV
+ foo64(mv) // escapes but it's an int so irrelevant
+}
+
+func foo69(m M) { // ERROR "leaking param: m"
+ foo64(m)
+}
+
+func foo70(mv1 *MV, m M) { // ERROR "leaking param: mv1" "leaking param: m"
+ m = mv1
+ foo64(m)
+}
+
+func foo71(x *int) []*int { // ERROR "leaking param: x"
+ var y []*int
+ y = append(y, x)
+ return y
+}
+
+func foo71a(x int) []*int { // ERROR "moved to heap: x"
+ var y []*int
+ y = append(y, &x) // ERROR "&x escapes to heap"
+ return y
+}
+
+func foo72() {
+ var x int
+ var y [1]*int
+ y[0] = &x // ERROR "&x does not escape"
+}
+
+func foo72aa() [10]*int {
+ var x int // ERROR "moved to heap: x"
+ var y [10]*int
+ y[0] = &x // ERROR "&x escapes to heap"
+ return y
+}
+
+func foo72a() {
+ var y [10]*int
+ for i := 0; i < 10; i++ {
+ // escapes its scope
+ x := i // ERROR "moved to heap: x"
+ y[i] = &x // ERROR "&x escapes to heap"
+ }
+ return
+}
+
+func foo72b() [10]*int {
+ var y [10]*int
+ for i := 0; i < 10; i++ {
+ x := i // ERROR "moved to heap: x"
+ y[i] = &x // ERROR "&x escapes to heap"
+ }
+ return y
+}
+
+// issue 2145
+func foo73() {
+ s := []int{3, 2, 1} // ERROR "\[\]int literal does not escape"
+ for _, v := range s {
+ vv := v // ERROR "moved to heap: vv"
+ // actually just escapes its scope
+ defer func() { // ERROR "func literal escapes to heap"
+ println(vv) // ERROR "&vv escapes to heap"
+ }()
+ }
+}
+
+func foo74() {
+ s := []int{3, 2, 1} // ERROR "\[\]int literal does not escape"
+ for _, v := range s {
+ vv := v // ERROR "moved to heap: vv"
+ // actually just escapes its scope
+ fn := func() { // ERROR "func literal escapes to heap"
+ println(vv) // ERROR "&vv escapes to heap"
+ }
+ defer fn()
+ }
+}
+
+func myprint(y *int, x ...interface{}) *int { // ERROR "x does not escape" "leaking param: y"
+ return y
+}
+
+func myprint1(y *int, x ...interface{}) *interface{} { // ERROR "y does not escape" "leaking param: x"
+ return &x[0] // ERROR "&x.0. escapes to heap"
+}
+
+func foo75(z *int) { // ERROR "leaking param: z"
+ myprint(z, 1, 2, 3) // ERROR "[.][.][.] argument does not escape"
+}
+
+func foo75a(z *int) { // ERROR "z does not escape"
+ myprint1(z, 1, 2, 3) // ERROR "[.][.][.] argument escapes to heap"
+}
+
+func foo76(z *int) { // ERROR "leaking param: z"
+ myprint(nil, z) // ERROR "[.][.][.] argument does not escape"
+}
+
+func foo76a(z *int) { // ERROR "leaking param: z"
+ myprint1(nil, z) // ERROR "[.][.][.] argument escapes to heap"
+}
+
+func foo76b() {
+ myprint(nil, 1, 2, 3) // ERROR "[.][.][.] argument does not escape"
+}
+
+func foo76c() {
+ myprint1(nil, 1, 2, 3) // ERROR "[.][.][.] argument escapes to heap"
+}
+
+func foo76d() {
+ defer myprint(nil, 1, 2, 3) // ERROR "[.][.][.] argument does not escape"
+}
+
+func foo76e() {
+ defer myprint1(nil, 1, 2, 3) // ERROR "[.][.][.] argument escapes to heap"
+}
+
+func foo76f() {
+ for {
+ // TODO: This one really only escapes its scope, but we don't distinguish yet.
+ defer myprint(nil, 1, 2, 3) // ERROR "[.][.][.] argument escapes to heap"
+ }
+}
+
+func foo76g() {
+ for {
+ defer myprint1(nil, 1, 2, 3) // ERROR "[.][.][.] argument escapes to heap"
+ }
+}
+
+func foo77(z []interface{}) { // ERROR "z does not escape"
+ myprint(nil, z...) // z does not escape
+}
+
+func foo77a(z []interface{}) { // ERROR "leaking param: z"
+ myprint1(nil, z...)
+}
+
+func foo78(z int) *int { // ERROR "moved to heap: z"
+ return &z // ERROR "&z escapes to heap"
+}
+
+func foo78a(z int) *int { // ERROR "moved to heap: z"
+ y := &z // ERROR "&z escapes to heap"
+ x := &y // ERROR "&y does not escape"
+ return *x // really return y
+}
+
+func foo79() *int {
+ return new(int) // ERROR "new[(]int[)] escapes to heap"
+}
+
+func foo80() *int {
+ var z *int
+ for {
+ // Really just escapes its scope but we don't distinguish
+ z = new(int) // ERROR "new[(]int[)] escapes to heap"
+ }
+ _ = z
+ return nil
+}
+
+func foo81() *int {
+ for {
+ z := new(int) // ERROR "new[(]int[)] does not escape"
+ _ = z
+ }
+ return nil
+}
+
+type Fooer interface {
+ Foo()
+}
+
+type LimitedFooer struct {
+ Fooer
+ N int64
+}
+
+func LimitFooer(r Fooer, n int64) Fooer { // ERROR "leaking param: r"
+ return &LimitedFooer{r, n} // ERROR "&LimitedFooer literal escapes to heap"
+}
+
+func foo90(x *int) map[*int]*int { // ERROR "leaking param: x"
+ return map[*int]*int{nil: x} // ERROR "map\[\*int\]\*int literal escapes to heap"
+}
+
+func foo91(x *int) map[*int]*int { // ERROR "leaking param: x"
+ return map[*int]*int{x: nil} // ERROR "map\[\*int\]\*int literal escapes to heap"
+}
+
+func foo92(x *int) [2]*int { // ERROR "leaking param: x"
+ return [2]*int{x, nil}
+}
+
+// does not leak c
+func foo93(c chan *int) *int { // ERROR "c does not escape"
+ for v := range c {
+ return v
+ }
+ return nil
+}
+
+// does not leak m
+func foo94(m map[*int]*int, b bool) *int { // ERROR "m does not escape"
+ for k, v := range m {
+ if b {
+ return k
+ }
+ return v
+ }
+ return nil
+}
+
+// does leak x
+func foo95(m map[*int]*int, x *int) { // ERROR "m does not escape" "leaking param: x"
+ m[x] = x
+}
+
+// does not leak m
+func foo96(m []*int) *int { // ERROR "m does not escape"
+ return m[0]
+}
+
+// does leak m
+func foo97(m [1]*int) *int { // ERROR "leaking param: m"
+ return m[0]
+}
+
+// does not leak m
+func foo98(m map[int]*int) *int { // ERROR "m does not escape"
+ return m[0]
+}
+
+// does leak m
+func foo99(m *[1]*int) []*int { // ERROR "leaking param: m"
+ return m[:]
+}
+
+// does not leak m
+func foo100(m []*int) *int { // ERROR "m does not escape"
+ for _, v := range m {
+ return v
+ }
+ return nil
+}
+
+// does leak m
+func foo101(m [1]*int) *int { // ERROR "leaking param: m"
+ for _, v := range m {
+ return v
+ }
+ return nil
+}
+
+// does not leak m
+func foo101a(m [1]*int) *int { // ERROR "m does not escape"
+ for i := range m { // ERROR "moved to heap: i"
+ return &i // ERROR "&i escapes to heap"
+ }
+ return nil
+}
+
+// does leak x
+func foo102(m []*int, x *int) { // ERROR "m does not escape" "leaking param: x"
+ m[0] = x
+}
+
+// does not leak x
+func foo103(m [1]*int, x *int) { // ERROR "m does not escape" "x does not escape"
+ m[0] = x
+}
+
+var y []*int
+
+// does not leak x
+func foo104(x []*int) { // ERROR "x does not escape"
+ copy(y, x)
+}
+
+// does not leak x
+func foo105(x []*int) { // ERROR "x does not escape"
+ _ = append(y, x...)
+}
+
+// does leak x
+func foo106(x *int) { // ERROR "leaking param: x"
+ _ = append(y, x)
+}
+
+func foo107(x *int) map[*int]*int { // ERROR "leaking param: x"
+ return map[*int]*int{x: nil} // ERROR "map.* literal escapes to heap"
+}
+
+func foo108(x *int) map[*int]*int { // ERROR "leaking param: x"
+ return map[*int]*int{nil: x} // ERROR "map.* literal escapes to heap"
+}
+
+func foo109(x *int) *int { // ERROR "leaking param: x"
+ m := map[*int]*int{x: nil} // ERROR "map.* literal does not escape"
+ for k, _ := range m {
+ return k
+ }
+ return nil
+}
+
+func foo110(x *int) *int { // ERROR "leaking param: x"
+ m := map[*int]*int{nil: x} // ERROR "map.* literal does not escape"
+ return m[nil]
+}
+
+func foo111(x *int) *int { // ERROR "leaking param: x"
+ m := []*int{x} // ERROR "\[\]\*int literal does not escape"
+ return m[0]
+}
+
+func foo112(x *int) *int { // ERROR "leaking param: x"
+ m := [1]*int{x}
+ return m[0]
+}
+
+func foo113(x *int) *int { // ERROR "leaking param: x"
+ m := Bar{ii: x}
+ return m.ii
+}
+
+func foo114(x *int) *int { // ERROR "leaking param: x"
+ m := &Bar{ii: x} // ERROR "&Bar literal does not escape"
+ return m.ii
+}
+
+func foo115(x *int) *int { // ERROR "leaking param: x"
+ return (*int)(unsafe.Pointer(uintptr(unsafe.Pointer(x)) + 1))
+}
+
+func foo116(b bool) *int {
+ if b {
+ x := 1 // ERROR "moved to heap: x"
+ return &x // ERROR "&x escapes to heap"
+ } else {
+ y := 1 // ERROR "moved to heap: y"
+ return &y // ERROR "&y escapes to heap"
+ }
+ return nil
+}
+
+func foo117(unknown func(interface{})) { // ERROR "unknown does not escape"
+ x := 1 // ERROR "moved to heap: x"
+ unknown(&x) // ERROR "&x escapes to heap"
+}
+
+func foo118(unknown func(*int)) { // ERROR "unknown does not escape"
+ x := 1 // ERROR "moved to heap: x"
+ unknown(&x) // ERROR "&x escapes to heap"
+}
+
+func external(*int)
+
+func foo119(x *int) { // ERROR "leaking param: x"
+ external(x)
+}
+
+func foo120() {
+ // formerly exponential time analysis
+L1:
+L2:
+L3:
+L4:
+L5:
+L6:
+L7:
+L8:
+L9:
+L10:
+L11:
+L12:
+L13:
+L14:
+L15:
+L16:
+L17:
+L18:
+L19:
+L20:
+L21:
+L22:
+L23:
+L24:
+L25:
+L26:
+L27:
+L28:
+L29:
+L30:
+L31:
+L32:
+L33:
+L34:
+L35:
+L36:
+L37:
+L38:
+L39:
+L40:
+L41:
+L42:
+L43:
+L44:
+L45:
+L46:
+L47:
+L48:
+L49:
+L50:
+L51:
+L52:
+L53:
+L54:
+L55:
+L56:
+L57:
+L58:
+L59:
+L60:
+L61:
+L62:
+L63:
+L64:
+L65:
+L66:
+L67:
+L68:
+L69:
+L70:
+L71:
+L72:
+L73:
+L74:
+L75:
+L76:
+L77:
+L78:
+L79:
+L80:
+L81:
+L82:
+L83:
+L84:
+L85:
+L86:
+L87:
+L88:
+L89:
+L90:
+L91:
+L92:
+L93:
+L94:
+L95:
+L96:
+L97:
+L98:
+L99:
+L100:
+ // use the labels to silence compiler errors
+ goto L1
+ goto L2
+ goto L3
+ goto L4
+ goto L5
+ goto L6
+ goto L7
+ goto L8
+ goto L9
+ goto L10
+ goto L11
+ goto L12
+ goto L13
+ goto L14
+ goto L15
+ goto L16
+ goto L17
+ goto L18
+ goto L19
+ goto L20
+ goto L21
+ goto L22
+ goto L23
+ goto L24
+ goto L25
+ goto L26
+ goto L27
+ goto L28
+ goto L29
+ goto L30
+ goto L31
+ goto L32
+ goto L33
+ goto L34
+ goto L35
+ goto L36
+ goto L37
+ goto L38
+ goto L39
+ goto L40
+ goto L41
+ goto L42
+ goto L43
+ goto L44
+ goto L45
+ goto L46
+ goto L47
+ goto L48
+ goto L49
+ goto L50
+ goto L51
+ goto L52
+ goto L53
+ goto L54
+ goto L55
+ goto L56
+ goto L57
+ goto L58
+ goto L59
+ goto L60
+ goto L61
+ goto L62
+ goto L63
+ goto L64
+ goto L65
+ goto L66
+ goto L67
+ goto L68
+ goto L69
+ goto L70
+ goto L71
+ goto L72
+ goto L73
+ goto L74
+ goto L75
+ goto L76
+ goto L77
+ goto L78
+ goto L79
+ goto L80
+ goto L81
+ goto L82
+ goto L83
+ goto L84
+ goto L85
+ goto L86
+ goto L87
+ goto L88
+ goto L89
+ goto L90
+ goto L91
+ goto L92
+ goto L93
+ goto L94
+ goto L95
+ goto L96
+ goto L97
+ goto L98
+ goto L99
+ goto L100
+}
+
+func foo121() {
+ for i := 0; i < 10; i++ {
+ defer myprint(nil, i) // ERROR "[.][.][.] argument escapes to heap"
+ go myprint(nil, i) // ERROR "[.][.][.] argument escapes to heap"
+ }
+}
+
+// same as foo121 but check across import
+func foo121b() {
+ for i := 0; i < 10; i++ {
+ defer fmt.Printf("%d", i) // ERROR "[.][.][.] argument escapes to heap"
+ go fmt.Printf("%d", i) // ERROR "[.][.][.] argument escapes to heap"
+ }
+}
+
+// a harmless forward jump
+func foo122() {
+ var i *int
+
+ goto L1
+L1:
+ i = new(int) // ERROR "does not escape"
+ _ = i
+}
+
+// a backward jump, increases loopdepth
+func foo123() {
+ var i *int
+
+L1:
+ i = new(int) // ERROR "escapes"
+
+ goto L1
+ _ = i
+}
diff --git a/test/escape3.go b/test/escape3.go
new file mode 100644
index 000000000..4c1989151
--- /dev/null
+++ b/test/escape3.go
@@ -0,0 +1,36 @@
+// run
+
+// Copyright 2011 The Go Authors. All rights reserved.
+// Use of this source code is governed by a BSD-style
+// license that can be found in the LICENSE file.
+
+// Test the run-time behavior of escape analysis-related optimizations.
+
+package main
+
+func main() {
+ test1()
+}
+
+func test1() {
+ check1(0)
+ check1(1)
+ check1(2)
+}
+
+type T1 struct {
+ X, Y, Z int
+}
+
+func f() int {
+ return 1
+}
+
+func check1(pass int) T1 {
+ v := []T1{{X: f(), Z: f()}}
+ if v[0].Y != 0 {
+ panic("nonzero init")
+ }
+ v[0].Y = pass
+ return v[0]
+}
diff --git a/test/escape4.go b/test/escape4.go
new file mode 100644
index 000000000..887570896
--- /dev/null
+++ b/test/escape4.go
@@ -0,0 +1,39 @@
+// errchk -0 $G -m $D/$F.go
+
+// Copyright 2010 The Go Authors. All rights reserved.
+// Use of this source code is governed by a BSD-style
+// license that can be found in the LICENSE file.
+
+// Test, using compiler diagnostic flags, that the escape analysis is working.
+// Compiles but does not run. Inlining is enabled.
+
+package foo
+
+var p *int
+
+func alloc(x int) *int { // ERROR "can inline alloc" "moved to heap: x"
+ return &x // ERROR "&x escapes to heap"
+}
+
+var f func()
+
+func f1() {
+ p = alloc(2) // ERROR "inlining call to alloc" "&x escapes to heap" "moved to heap: x"
+
+ // Escape analysis used to miss inlined code in closures.
+
+ func() { // ERROR "func literal does not escape"
+ p = alloc(3) // ERROR "inlining call to alloc" "&x escapes to heap" "moved to heap: x"
+ }()
+
+ f = func() { // ERROR "func literal escapes to heap"
+ p = alloc(3) // ERROR "inlining call to alloc" "&x escapes to heap" "moved to heap: x"
+ }
+ f()
+}
+
+func f2() {} // ERROR "can inline f2"
+
+// No inline for panic, recover.
+func f3() { panic(1) }
+func f4() { recover() }
diff --git a/test/fixedbugs/bug000.go b/test/fixedbugs/bug000.go
index ccb24e8e9..9104a57aa 100644
--- a/test/fixedbugs/bug000.go
+++ b/test/fixedbugs/bug000.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug002.go b/test/fixedbugs/bug002.go
index 230841974..3493426d3 100644
--- a/test/fixedbugs/bug002.go
+++ b/test/fixedbugs/bug002.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug003.go b/test/fixedbugs/bug003.go
index e45975be4..7165d9d20 100644
--- a/test/fixedbugs/bug003.go
+++ b/test/fixedbugs/bug003.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug004.go b/test/fixedbugs/bug004.go
index 20f467a5f..fb207e9bc 100644
--- a/test/fixedbugs/bug004.go
+++ b/test/fixedbugs/bug004.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug005.go b/test/fixedbugs/bug005.go
index 3bd2fe815..3798f8321 100644
--- a/test/fixedbugs/bug005.go
+++ b/test/fixedbugs/bug005.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug006.go b/test/fixedbugs/bug006.go
index 43b5dfb12..6761682b3 100644
--- a/test/fixedbugs/bug006.go
+++ b/test/fixedbugs/bug006.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug007.go b/test/fixedbugs/bug007.go
index d65f6da45..3d9fcb9e0 100644
--- a/test/fixedbugs/bug007.go
+++ b/test/fixedbugs/bug007.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug008.go b/test/fixedbugs/bug008.go
index 2baead11e..48f74a52d 100644
--- a/test/fixedbugs/bug008.go
+++ b/test/fixedbugs/bug008.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug009.go b/test/fixedbugs/bug009.go
index ef8263bb2..0467b297a 100644
--- a/test/fixedbugs/bug009.go
+++ b/test/fixedbugs/bug009.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug010.go b/test/fixedbugs/bug010.go
index 7d96988d4..f54b1d54a 100644
--- a/test/fixedbugs/bug010.go
+++ b/test/fixedbugs/bug010.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug011.go b/test/fixedbugs/bug011.go
index ce627472c..519c3585f 100644
--- a/test/fixedbugs/bug011.go
+++ b/test/fixedbugs/bug011.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug012.go b/test/fixedbugs/bug012.go
index ffd5b5570..38efb6d97 100644
--- a/test/fixedbugs/bug012.go
+++ b/test/fixedbugs/bug012.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug013.go b/test/fixedbugs/bug013.go
index 4b106775c..045786bf7 100644
--- a/test/fixedbugs/bug013.go
+++ b/test/fixedbugs/bug013.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug014.go b/test/fixedbugs/bug014.go
index dac2ce517..a20f0310e 100644
--- a/test/fixedbugs/bug014.go
+++ b/test/fixedbugs/bug014.go
@@ -1,4 +1,4 @@
-// errchk $G $D/$F.go
+// errorcheck
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
@@ -11,4 +11,5 @@ func main() {
var c01 uint8 = '\07'; // ERROR "oct|char"
var cx0 uint8 = '\x0'; // ERROR "hex|char"
var cx1 uint8 = '\x'; // ERROR "hex|char"
+ _, _, _, _ = c00, c01, cx0, cx1
}
diff --git a/test/fixedbugs/bug015.go b/test/fixedbugs/bug015.go
index 9178f626f..d3a9f22ed 100644
--- a/test/fixedbugs/bug015.go
+++ b/test/fixedbugs/bug015.go
@@ -1,4 +1,4 @@
-// errchk $G $D/$F.go
+// errorcheck
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug016.go b/test/fixedbugs/bug016.go
index 4fbfd48fd..18fac78f3 100644
--- a/test/fixedbugs/bug016.go
+++ b/test/fixedbugs/bug016.go
@@ -1,4 +1,4 @@
-// errchk $G -e $D/$F.go
+// errorcheck
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug017.go b/test/fixedbugs/bug017.go
index fdc986d9d..2f5960d10 100644
--- a/test/fixedbugs/bug017.go
+++ b/test/fixedbugs/bug017.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug020.go b/test/fixedbugs/bug020.go
index 896bf5707..cde3f8679 100644
--- a/test/fixedbugs/bug020.go
+++ b/test/fixedbugs/bug020.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go || echo BUG should compile
+// compile
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug021.go b/test/fixedbugs/bug021.go
index 201fa5f03..bf936e875 100644
--- a/test/fixedbugs/bug021.go
+++ b/test/fixedbugs/bug021.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug022.go b/test/fixedbugs/bug022.go
index f94a58569..65a8bfe9a 100644
--- a/test/fixedbugs/bug022.go
+++ b/test/fixedbugs/bug022.go
@@ -1,4 +1,4 @@
-// errchk $G $D/$F.go
+// errorcheck
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug023.go b/test/fixedbugs/bug023.go
index b3d3d4a3c..9b211cd54 100644
--- a/test/fixedbugs/bug023.go
+++ b/test/fixedbugs/bug023.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug024.go b/test/fixedbugs/bug024.go
index c7b17b7c0..2e235b7b4 100644
--- a/test/fixedbugs/bug024.go
+++ b/test/fixedbugs/bug024.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug026.go b/test/fixedbugs/bug026.go
index eacea3745..bfd03cc95 100644
--- a/test/fixedbugs/bug026.go
+++ b/test/fixedbugs/bug026.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug027.go b/test/fixedbugs/bug027.go
index acc295d51..874b47e7a 100644
--- a/test/fixedbugs/bug027.go
+++ b/test/fixedbugs/bug027.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
@@ -6,53 +6,76 @@
package main
+import "fmt"
+
type Element interface {
}
type Vector struct {
- nelem int;
- elem []Element;
+ nelem int
+ elem []Element
}
func New() *Vector {
- v := new(Vector);
- v.nelem = 0;
- v.elem = make([]Element, 10);
- return v;
+ v := new(Vector)
+ v.nelem = 0
+ v.elem = make([]Element, 10)
+ return v
}
func (v *Vector) At(i int) Element {
- return v.elem[i];
+ return v.elem[i]
}
func (v *Vector) Insert(e Element) {
- v.elem[v.nelem] = e;
- v.nelem++;
+ v.elem[v.nelem] = e
+ v.nelem++
}
func main() {
- type I struct { val int; };
- i0 := new(I); i0.val = 0;
- i1 := new(I); i1.val = 11;
- i2 := new(I); i2.val = 222;
- i3 := new(I); i3.val = 3333;
- i4 := new(I); i4.val = 44444;
- v := New();
- print("hi\n");
- v.Insert(i4);
- v.Insert(i3);
- v.Insert(i2);
- v.Insert(i1);
- v.Insert(i0);
+ type I struct{ val int }
+ i0 := new(I)
+ i0.val = 0
+ i1 := new(I)
+ i1.val = 11
+ i2 := new(I)
+ i2.val = 222
+ i3 := new(I)
+ i3.val = 3333
+ i4 := new(I)
+ i4.val = 44444
+ v := New()
+ r := "hi\n"
+ v.Insert(i4)
+ v.Insert(i3)
+ v.Insert(i2)
+ v.Insert(i1)
+ v.Insert(i0)
for i := 0; i < v.nelem; i++ {
- var x *I;
- x = v.At(i).(*I);
- print(i, " ", x.val, "\n"); // prints correct list
+ var x *I
+ x = v.At(i).(*I)
+ r += fmt.Sprintln(i, x.val) // prints correct list
}
for i := 0; i < v.nelem; i++ {
- print(i, " ", v.At(i).(*I).val, "\n");
+ r += fmt.Sprintln(i, v.At(i).(*I).val)
+ }
+ expect := `hi
+0 44444
+1 3333
+2 222
+3 11
+4 0
+0 44444
+1 3333
+2 222
+3 11
+4 0
+`
+ if r != expect {
+ panic(r)
}
}
+
/*
bug027.go:50: illegal types for operand
(<Element>I{}) CONV (<I>{})
diff --git a/test/fixedbugs/bug028.go b/test/fixedbugs/bug028.go
index 0488ad2cb..2edf5a910 100644
--- a/test/fixedbugs/bug028.go
+++ b/test/fixedbugs/bug028.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug030.go b/test/fixedbugs/bug030.go
index 7efde9b44..ffd29e057 100644
--- a/test/fixedbugs/bug030.go
+++ b/test/fixedbugs/bug030.go
@@ -1,4 +1,4 @@
-// errchk $G $D/$F.go
+// errorcheck
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug031.go b/test/fixedbugs/bug031.go
index acb4741e9..529e5ce84 100644
--- a/test/fixedbugs/bug031.go
+++ b/test/fixedbugs/bug031.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug035.go b/test/fixedbugs/bug035.go
index bd2a633f2..ae41a1795 100644
--- a/test/fixedbugs/bug035.go
+++ b/test/fixedbugs/bug035.go
@@ -1,4 +1,4 @@
-// errchk $G $D/$F.go
+// errorcheck
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug036.go b/test/fixedbugs/bug036.go
deleted file mode 100644
index cc20516ce..000000000
--- a/test/fixedbugs/bug036.go
+++ /dev/null
@@ -1,13 +0,0 @@
-// ! $G $D/$F.go >/dev/null
-// # ignoring error messages...
-
-// Copyright 2009 The Go Authors. All rights reserved.
-// Use of this source code is governed by a BSD-style
-// license that can be found in the LICENSE file.
-
-package main
-
-func main() {
- s := float(0);
- s := float(0); // BUG redeclaration
-}
diff --git a/test/fixedbugs/bug037.go b/test/fixedbugs/bug037.go
index ff7d28710..f17fb3fd7 100644
--- a/test/fixedbugs/bug037.go
+++ b/test/fixedbugs/bug037.go
@@ -1,4 +1,4 @@
-// errchk $G $D/$F.go
+// errorcheck
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug038.go b/test/fixedbugs/bug038.go
deleted file mode 100644
index 7585376a3..000000000
--- a/test/fixedbugs/bug038.go
+++ /dev/null
@@ -1,13 +0,0 @@
-// ! $G $D/$F.go >/dev/null
-// # ignoring error messages...
-
-// Copyright 2009 The Go Authors. All rights reserved.
-// Use of this source code is governed by a BSD-style
-// license that can be found in the LICENSE file.
-
-package main
-
-func main() {
- var z [3]byte;
- z := new([3]byte); // BUG redeclaration
-}
diff --git a/test/fixedbugs/bug039.go b/test/fixedbugs/bug039.go
index 7ac02ceeb..d34f5e62e 100644
--- a/test/fixedbugs/bug039.go
+++ b/test/fixedbugs/bug039.go
@@ -1,4 +1,4 @@
-// errchk $G $D/$F.go
+// errorcheck
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug040.go b/test/fixedbugs/bug040.go
index 912316cb6..007f47f9f 100644
--- a/test/fixedbugs/bug040.go
+++ b/test/fixedbugs/bug040.go
@@ -1,5 +1,4 @@
-// ! $G $D/$F.go >/dev/null
-// # ignoring error messages...
+// errorcheck
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
@@ -7,5 +6,6 @@
package main
-func main (x, x int) { // BUG redeclaration error
+func f (x, // GCCGO_ERROR "previous"
+ x int) { // ERROR "redeclared|redefinition" "duplicate"
}
diff --git a/test/fixedbugs/bug045.go b/test/fixedbugs/bug045.go
index 94888c40e..c66a2411a 100644
--- a/test/fixedbugs/bug045.go
+++ b/test/fixedbugs/bug045.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug046.go b/test/fixedbugs/bug046.go
index 8a9b79707..219e91d53 100644
--- a/test/fixedbugs/bug046.go
+++ b/test/fixedbugs/bug046.go
@@ -1,4 +1,4 @@
-// errchk $G $D/$F.go
+// errorcheck
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug047.go b/test/fixedbugs/bug047.go
index 5a776abce..7619ae73c 100644
--- a/test/fixedbugs/bug047.go
+++ b/test/fixedbugs/bug047.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug048.go b/test/fixedbugs/bug048.go
index b9fee7899..48ad751e2 100644
--- a/test/fixedbugs/bug048.go
+++ b/test/fixedbugs/bug048.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug049.go b/test/fixedbugs/bug049.go
index 8fd67ccd5..51990f2df 100644
--- a/test/fixedbugs/bug049.go
+++ b/test/fixedbugs/bug049.go
@@ -1,4 +1,4 @@
-// errchk $G $D/$F.go
+// errorcheck
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug050.go b/test/fixedbugs/bug050.go
index 585c44623..aba68b1dc 100644
--- a/test/fixedbugs/bug050.go
+++ b/test/fixedbugs/bug050.go
@@ -1,4 +1,4 @@
-// errchk $G $D/$F.go
+// errorcheck
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug051.go b/test/fixedbugs/bug051.go
index dd1662306..c4ba2eff6 100644
--- a/test/fixedbugs/bug051.go
+++ b/test/fixedbugs/bug051.go
@@ -1,4 +1,4 @@
-// errchk $G $D/$F.go
+// errorcheck
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug052.go b/test/fixedbugs/bug052.go
index d2c1b5061..440a00ebe 100644
--- a/test/fixedbugs/bug052.go
+++ b/test/fixedbugs/bug052.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug053.go b/test/fixedbugs/bug053.go
index c981403ed..00625fd7c 100644
--- a/test/fixedbugs/bug053.go
+++ b/test/fixedbugs/bug053.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug054.go b/test/fixedbugs/bug054.go
index c8a2272c2..01590585c 100644
--- a/test/fixedbugs/bug054.go
+++ b/test/fixedbugs/bug054.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug055.go b/test/fixedbugs/bug055.go
index 861739610..c3073cc1e 100644
--- a/test/fixedbugs/bug055.go
+++ b/test/fixedbugs/bug055.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug056.go b/test/fixedbugs/bug056.go
index 050a4a5c5..13eac2920 100644
--- a/test/fixedbugs/bug056.go
+++ b/test/fixedbugs/bug056.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug057.go b/test/fixedbugs/bug057.go
index d5d0f1d62..19b8651a5 100644
--- a/test/fixedbugs/bug057.go
+++ b/test/fixedbugs/bug057.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go
+// compile
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug058.go b/test/fixedbugs/bug058.go
index e2b4a241a..2b97dbf7c 100644
--- a/test/fixedbugs/bug058.go
+++ b/test/fixedbugs/bug058.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug059.go b/test/fixedbugs/bug059.go
index 6a77367d6..6f64b9e0b 100644
--- a/test/fixedbugs/bug059.go
+++ b/test/fixedbugs/bug059.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug060.go b/test/fixedbugs/bug060.go
index 82778b838..826072905 100644
--- a/test/fixedbugs/bug060.go
+++ b/test/fixedbugs/bug060.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug061.go b/test/fixedbugs/bug061.go
index aedcf70fe..ae99b186d 100644
--- a/test/fixedbugs/bug061.go
+++ b/test/fixedbugs/bug061.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug062.go b/test/fixedbugs/bug062.go
index 8ee5c84cb..1cc500365 100644
--- a/test/fixedbugs/bug062.go
+++ b/test/fixedbugs/bug062.go
@@ -1,4 +1,4 @@
-// errchk $G $D/$F.go
+// errorcheck
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug063.go b/test/fixedbugs/bug063.go
index 543e0b726..a3ae3f096 100644
--- a/test/fixedbugs/bug063.go
+++ b/test/fixedbugs/bug063.go
@@ -1,8 +1,8 @@
-// $G $D/$F.go
+// compile
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
-package main
+package bug063
const c = 0 ^ 0
diff --git a/test/fixedbugs/bug064.go b/test/fixedbugs/bug064.go
index 92d215423..d8b3bea9a 100644
--- a/test/fixedbugs/bug064.go
+++ b/test/fixedbugs/bug064.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go || echo BUG: compilation should succeed
+// compile
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug065.go b/test/fixedbugs/bug065.go
index a5d1beddd..a1e3b08bb 100644
--- a/test/fixedbugs/bug065.go
+++ b/test/fixedbugs/bug065.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug066.go b/test/fixedbugs/bug066.go
index 2fa5048f1..db3d7f860 100644
--- a/test/fixedbugs/bug066.go
+++ b/test/fixedbugs/bug066.go
@@ -1,10 +1,10 @@
-// $G $D/$F.go
+// compile
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
-package main
+package bug066
type Scope struct {
entries map[string] *Object;
diff --git a/test/fixedbugs/bug067.go b/test/fixedbugs/bug067.go
index b812f0116..aaeefb0ba 100644
--- a/test/fixedbugs/bug067.go
+++ b/test/fixedbugs/bug067.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
@@ -10,6 +10,6 @@ var c chan int
func main() {
c = make(chan int);
- go func() { print("ok\n"); c <- 0 } ();
+ go func() { c <- 0 } ();
<-c
}
diff --git a/test/fixedbugs/bug068.go b/test/fixedbugs/bug068.go
index a7cf4239c..2cb10ab3a 100644
--- a/test/fixedbugs/bug068.go
+++ b/test/fixedbugs/bug068.go
@@ -1,4 +1,4 @@
-// errchk $G $D/$F.go
+// errorcheck
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug069.go b/test/fixedbugs/bug069.go
index 9038387ac..7b07b773d 100644
--- a/test/fixedbugs/bug069.go
+++ b/test/fixedbugs/bug069.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go
+// compile
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug070.go b/test/fixedbugs/bug070.go
index 6afdd467d..3f3ffcf61 100644
--- a/test/fixedbugs/bug070.go
+++ b/test/fixedbugs/bug070.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
@@ -6,20 +6,35 @@
package main
+import "fmt"
+
func main() {
- var i, k int;
- outer:
- for k=0; k<2; k++ {
- print("outer loop top k ", k, "\n");
- if k != 0 { panic("k not zero") } // inner loop breaks this one every time
- for i=0; i<2; i++ {
- if i != 0 { panic("i not zero") } // loop breaks every time
- print("inner loop top i ", i, "\n");
+ var i, k int
+ var r string
+outer:
+ for k = 0; k < 2; k++ {
+ r += fmt.Sprintln("outer loop top k", k)
+ if k != 0 {
+ panic("k not zero")
+ } // inner loop breaks this one every time
+ for i = 0; i < 2; i++ {
+ if i != 0 {
+ panic("i not zero")
+ } // loop breaks every time
+ r += fmt.Sprintln("inner loop top i", i)
if true {
- print("do break\n");
- break outer;
+ r += "do break\n"
+ break outer
}
}
}
- print("broke\n");
+ r += "broke\n"
+ expect := `outer loop top k 0
+inner loop top i 0
+do break
+broke
+`
+ if r != expect {
+ panic(r)
+ }
}
diff --git a/test/fixedbugs/bug071.go b/test/fixedbugs/bug071.go
index a5003ffb9..ec38f7a97 100644
--- a/test/fixedbugs/bug071.go
+++ b/test/fixedbugs/bug071.go
@@ -1,10 +1,10 @@
-// $G $D/$F.go || echo BUG: compiler crashes
+// compile
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
-package main
+package bug071
type rat struct {
den int;
diff --git a/test/fixedbugs/bug072.go b/test/fixedbugs/bug072.go
index efe5626db..05ad93dac 100644
--- a/test/fixedbugs/bug072.go
+++ b/test/fixedbugs/bug072.go
@@ -1,4 +1,4 @@
-// errchk $G $D/$F.go
+// errorcheck
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug073.go b/test/fixedbugs/bug073.go
index 99e7cd19e..49b47ae46 100644
--- a/test/fixedbugs/bug073.go
+++ b/test/fixedbugs/bug073.go
@@ -1,4 +1,4 @@
-// errchk $G $D/$F.go
+// errorcheck
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug074.go b/test/fixedbugs/bug074.go
index 7b6d14e7e..fb789cb4c 100644
--- a/test/fixedbugs/bug074.go
+++ b/test/fixedbugs/bug074.go
@@ -1,4 +1,4 @@
-// errchk $G $D/$F.go
+// errorcheck
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug075.go b/test/fixedbugs/bug075.go
index 7aed13089..d0b7d14e7 100644
--- a/test/fixedbugs/bug075.go
+++ b/test/fixedbugs/bug075.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug076.go b/test/fixedbugs/bug076.go
index 2ca518d76..60aaa9760 100644
--- a/test/fixedbugs/bug076.go
+++ b/test/fixedbugs/bug076.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go && $L $F.$A
+// build
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug077.go b/test/fixedbugs/bug077.go
index 2cbf96d98..80581a8a3 100644
--- a/test/fixedbugs/bug077.go
+++ b/test/fixedbugs/bug077.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go || echo BUG: should compile
+// compile
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug078.go b/test/fixedbugs/bug078.go
index ddd3faeba..1041b858c 100644
--- a/test/fixedbugs/bug078.go
+++ b/test/fixedbugs/bug078.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug080.go b/test/fixedbugs/bug080.go
index bae16cdb2..32b2c53b9 100644
--- a/test/fixedbugs/bug080.go
+++ b/test/fixedbugs/bug080.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go || echo BUG: fails incorrectly
+// compile
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug081.go b/test/fixedbugs/bug081.go
index 026ce8002..c25d28837 100644
--- a/test/fixedbugs/bug081.go
+++ b/test/fixedbugs/bug081.go
@@ -1,4 +1,4 @@
-// errchk $G $D/$F.go
+// errorcheck
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug082.go b/test/fixedbugs/bug082.go
index 8353ec200..e184ef193 100644
--- a/test/fixedbugs/bug082.go
+++ b/test/fixedbugs/bug082.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug084.go b/test/fixedbugs/bug084.go
index c1054e550..700a67433 100644
--- a/test/fixedbugs/bug084.go
+++ b/test/fixedbugs/bug084.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug085.go b/test/fixedbugs/bug085.go
index 02be71753..93ae7e0a4 100644
--- a/test/fixedbugs/bug085.go
+++ b/test/fixedbugs/bug085.go
@@ -1,4 +1,4 @@
-// errchk $G $D/$F.go
+// errorcheck
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug086.go b/test/fixedbugs/bug086.go
index f96472fbb..fc69e0e3f 100644
--- a/test/fixedbugs/bug086.go
+++ b/test/fixedbugs/bug086.go
@@ -1,4 +1,4 @@
-// errchk $G $D/$F.go
+// errorcheck
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug087.go b/test/fixedbugs/bug087.go
index 4af8d976f..67e7210cd 100644
--- a/test/fixedbugs/bug087.go
+++ b/test/fixedbugs/bug087.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go || echo BUG: fails incorrectly
+// compile
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug089.go b/test/fixedbugs/bug089.go
index fd3dff3ec..e88f17bab 100644
--- a/test/fixedbugs/bug089.go
+++ b/test/fixedbugs/bug089.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go
+// compile
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug090.go b/test/fixedbugs/bug090.go
index 8318ab9c0..320bd57f5 100644
--- a/test/fixedbugs/bug090.go
+++ b/test/fixedbugs/bug090.go
@@ -1,4 +1,4 @@
-// errchk $G $D/$F.go
+// errorcheck
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug091.go b/test/fixedbugs/bug091.go
index c2ede7153..dbb1287a1 100644
--- a/test/fixedbugs/bug091.go
+++ b/test/fixedbugs/bug091.go
@@ -1,4 +1,4 @@
-// errchk $G $D/$F.go
+// errorcheck
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug092.go b/test/fixedbugs/bug092.go
index 8f05c478f..8027d941e 100644
--- a/test/fixedbugs/bug092.go
+++ b/test/fixedbugs/bug092.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug093.go b/test/fixedbugs/bug093.go
index f80eee01f..acd94466f 100644
--- a/test/fixedbugs/bug093.go
+++ b/test/fixedbugs/bug093.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out || echo BUG: fails incorrectly
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
@@ -10,7 +10,6 @@ type S struct {
}
func (p *S) M() {
- print("M\n");
}
type I interface {
diff --git a/test/fixedbugs/bug094.go b/test/fixedbugs/bug094.go
index 2953eb28d..3ef11da3d 100644
--- a/test/fixedbugs/bug094.go
+++ b/test/fixedbugs/bug094.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go || echo BUG: fails incorrectly
+// compile
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug096.go b/test/fixedbugs/bug096.go
index 9be687a7b..411ba74e0 100644
--- a/test/fixedbugs/bug096.go
+++ b/test/fixedbugs/bug096.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go || echo BUG should compile
+// compile
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug097.go b/test/fixedbugs/bug097.go
index ec3c21543..a067e0f57 100644
--- a/test/fixedbugs/bug097.go
+++ b/test/fixedbugs/bug097.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out || echo BUG wrong result
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug098.go b/test/fixedbugs/bug098.go
index 1dad4d502..eb4ee4de0 100644
--- a/test/fixedbugs/bug098.go
+++ b/test/fixedbugs/bug098.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go || echo BUG should compile
+// compile
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug099.go b/test/fixedbugs/bug099.go
index f76f0e873..03a5c454b 100644
--- a/test/fixedbugs/bug099.go
+++ b/test/fixedbugs/bug099.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out || echo BUG should not crash
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug101.go b/test/fixedbugs/bug101.go
index 92487deaa..82e496a8a 100644
--- a/test/fixedbugs/bug101.go
+++ b/test/fixedbugs/bug101.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug102.go b/test/fixedbugs/bug102.go
index 1d97eb4a8..f1c2324b7 100644
--- a/test/fixedbugs/bug102.go
+++ b/test/fixedbugs/bug102.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out || echo BUG: should not crash
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug103.go b/test/fixedbugs/bug103.go
index b789be1c4..1cb710e36 100644
--- a/test/fixedbugs/bug103.go
+++ b/test/fixedbugs/bug103.go
@@ -1,4 +1,4 @@
-// errchk $G $D/$F.go
+// errorcheck
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug104.go b/test/fixedbugs/bug104.go
index dd4bb5834..f0c19a8aa 100644
--- a/test/fixedbugs/bug104.go
+++ b/test/fixedbugs/bug104.go
@@ -1,4 +1,4 @@
-// errchk $G $D/$F.go
+// errorcheck
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug107.go b/test/fixedbugs/bug107.go
index d0b062a65..dcd8e9d11 100644
--- a/test/fixedbugs/bug107.go
+++ b/test/fixedbugs/bug107.go
@@ -1,4 +1,4 @@
-// errchk $G $D/$F.go
+// errorcheck
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
@@ -6,7 +6,7 @@
package main
import os "os"
-type _ os.Error
+type _ os.FileInfo
func f() (os int) {
// In the next line "os" should refer to the result variable, not
// to the package.
diff --git a/test/fixedbugs/bug108.go b/test/fixedbugs/bug108.go
index 5c7649f08..9f2a27ebd 100644
--- a/test/fixedbugs/bug108.go
+++ b/test/fixedbugs/bug108.go
@@ -1,4 +1,4 @@
-// errchk $G $D/$F.go
+// errorcheck
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
@@ -7,4 +7,5 @@
package main
func f() {
v := 1 << 1025; // ERROR "overflow|stupid shift"
+ _ = v
}
diff --git a/test/fixedbugs/bug109.go b/test/fixedbugs/bug109.go
index 766657723..556dc34dd 100644
--- a/test/fixedbugs/bug109.go
+++ b/test/fixedbugs/bug109.go
@@ -1,10 +1,10 @@
-// $G $D/$F.go || echo BUG: should compile
+// compile
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
-package main
+package bug109
func f(a float64) float64 {
e := 1.0
diff --git a/test/fixedbugs/bug110.go b/test/fixedbugs/bug110.go
index 4e43d1c01..5528ba3f1 100644
--- a/test/fixedbugs/bug110.go
+++ b/test/fixedbugs/bug110.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go && $L $F.$A || echo BUG: const bug
+// build
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug111.go b/test/fixedbugs/bug111.go
index e72b343ae..d977bd54f 100644
--- a/test/fixedbugs/bug111.go
+++ b/test/fixedbugs/bug111.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out || echo BUG should compile and run
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug112.go b/test/fixedbugs/bug112.go
index 3c932843c..e2ed5c0d4 100644
--- a/test/fixedbugs/bug112.go
+++ b/test/fixedbugs/bug112.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go || echo BUG should compile
+// compile
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug113.go b/test/fixedbugs/bug113.go
index 4fd322d53..a1e61cb36 100644
--- a/test/fixedbugs/bug113.go
+++ b/test/fixedbugs/bug113.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go && $L $F.$A && (! ./$A.out || echo BUG: should not succeed)
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
@@ -21,8 +21,24 @@ func main() {
if foo2(v2) != 1 {
panic(2)
}
+
+ shouldPanic(p1)
+}
+
+func p1() {
+ var i I
+ i = 1
var v3 = i.(int32) // This type conversion should fail at runtime.
if foo2(v3) != 1 {
panic(3)
}
}
+
+func shouldPanic(f func()) {
+ defer func() {
+ if recover() == nil {
+ panic("function should panic")
+ }
+ }()
+ f()
+}
diff --git a/test/fixedbugs/bug114.go b/test/fixedbugs/bug114.go
index 974b7cf26..99e66a2dd 100644
--- a/test/fixedbugs/bug114.go
+++ b/test/fixedbugs/bug114.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go && $L $F.$A && (./$A.out || echo BUG: bug114 failed)
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug115.go b/test/fixedbugs/bug115.go
index 16b22d707..7cc3dc40a 100644
--- a/test/fixedbugs/bug115.go
+++ b/test/fixedbugs/bug115.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go || echo BUG: bug115 should compile
+// compile
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug116.go b/test/fixedbugs/bug116.go
index 42ca80343..5d8e52031 100644
--- a/test/fixedbugs/bug116.go
+++ b/test/fixedbugs/bug116.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out || echo BUG: bug116
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug117.go b/test/fixedbugs/bug117.go
index ad89ebf52..038826cbc 100644
--- a/test/fixedbugs/bug117.go
+++ b/test/fixedbugs/bug117.go
@@ -1,4 +1,4 @@
-// errchk $G $D/$F.go
+// errorcheck
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug118.go b/test/fixedbugs/bug118.go
index 1271f5b0c..198b8ff28 100644
--- a/test/fixedbugs/bug118.go
+++ b/test/fixedbugs/bug118.go
@@ -1,10 +1,10 @@
-// $G $D/$F.go || echo BUG should compile
+// compile
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
-package main
+package bug118
func Send(c chan int) int {
select {
diff --git a/test/fixedbugs/bug119.go b/test/fixedbugs/bug119.go
index 750507891..6f2514c24 100644
--- a/test/fixedbugs/bug119.go
+++ b/test/fixedbugs/bug119.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out || echo BUG: should not fail
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug120.go b/test/fixedbugs/bug120.go
index 2a71957d8..58355e53d 100644
--- a/test/fixedbugs/bug120.go
+++ b/test/fixedbugs/bug120.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out || echo BUG: bug120
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
@@ -41,16 +41,16 @@ func main() {
ok := true
for i := 0; i < len(tests); i++ {
t := tests[i]
- v := strconv.Ftoa64(t.f, 'g', -1)
+ v := strconv.FormatFloat(t.f, 'g', -1, 64)
if v != t.out {
println("Bad float64 const:", t.in, "want", t.out, "got", v)
- x, err := strconv.Atof64(t.out)
+ x, err := strconv.ParseFloat(t.out, 64)
if err != nil {
println("bug120: strconv.Atof64", t.out)
panic("fail")
}
- println("\twant exact:", strconv.Ftoa64(x, 'g', 1000))
- println("\tgot exact: ", strconv.Ftoa64(t.f, 'g', 1000))
+ println("\twant exact:", strconv.FormatFloat(x, 'g', 1000, 64))
+ println("\tgot exact: ", strconv.FormatFloat(t.f, 'g', 1000, 64))
ok = false
}
}
diff --git a/test/fixedbugs/bug121.go b/test/fixedbugs/bug121.go
index 15c8451da..5adf9827f 100644
--- a/test/fixedbugs/bug121.go
+++ b/test/fixedbugs/bug121.go
@@ -1,4 +1,4 @@
-// errchk $G $D/$F.go
+// errorcheck
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug122.go b/test/fixedbugs/bug122.go
index 72bf38a83..fb4eb9f3a 100644
--- a/test/fixedbugs/bug122.go
+++ b/test/fixedbugs/bug122.go
@@ -1,4 +1,4 @@
-// errchk $G $D/$F.go
+// errorcheck
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug123.go b/test/fixedbugs/bug123.go
index bdac67417..f38551a91 100644
--- a/test/fixedbugs/bug123.go
+++ b/test/fixedbugs/bug123.go
@@ -1,4 +1,4 @@
-// errchk $G $D/$F.go
+// errorcheck
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug126.go b/test/fixedbugs/bug126.go
index a8d56e122..f5d976341 100644
--- a/test/fixedbugs/bug126.go
+++ b/test/fixedbugs/bug126.go
@@ -1,4 +1,4 @@
-// errchk $G $D/$F.go
+// errorcheck
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug127.go b/test/fixedbugs/bug127.go
index 25b48114d..f8ea99470 100644
--- a/test/fixedbugs/bug127.go
+++ b/test/fixedbugs/bug127.go
@@ -1,4 +1,4 @@
-// errchk $G $D/$F.go
+// errorcheck
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug128.go b/test/fixedbugs/bug128.go
index 3fd647c00..e8cbea079 100644
--- a/test/fixedbugs/bug128.go
+++ b/test/fixedbugs/bug128.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out || echo BUG: should compile
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug129.go b/test/fixedbugs/bug129.go
index d1e2d8b56..157ce78ff 100644
--- a/test/fixedbugs/bug129.go
+++ b/test/fixedbugs/bug129.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go || echo BUG129
+// compile
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug130.go b/test/fixedbugs/bug130.go
index 855c7072b..16b029af3 100644
--- a/test/fixedbugs/bug130.go
+++ b/test/fixedbugs/bug130.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out || echo BUG: should run
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug131.go b/test/fixedbugs/bug131.go
index e5d4ca07d..0ebbd2606 100644
--- a/test/fixedbugs/bug131.go
+++ b/test/fixedbugs/bug131.go
@@ -1,4 +1,4 @@
-// errchk $G $D/$F.go
+// errorcheck
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug132.go b/test/fixedbugs/bug132.go
index bab8996f1..e334566c7 100644
--- a/test/fixedbugs/bug132.go
+++ b/test/fixedbugs/bug132.go
@@ -1,4 +1,4 @@
-// errchk $G $D/$F.go
+// errorcheck
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug135.go b/test/fixedbugs/bug135.go
index 470135ed4..34d234e22 100644
--- a/test/fixedbugs/bug135.go
+++ b/test/fixedbugs/bug135.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go || echo BUG: should compile
+// compile
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug136.go b/test/fixedbugs/bug136.go
index 7491b65d8..bea9bac08 100644
--- a/test/fixedbugs/bug136.go
+++ b/test/fixedbugs/bug136.go
@@ -1,4 +1,4 @@
-// errchk $G $D/$F.go
+// errorcheck
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug137.go b/test/fixedbugs/bug137.go
index 9d43f431b..48368177a 100644
--- a/test/fixedbugs/bug137.go
+++ b/test/fixedbugs/bug137.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go || echo BUG should compile
+// compile
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug139.go b/test/fixedbugs/bug139.go
index 2bdbef1c0..095e5c93c 100644
--- a/test/fixedbugs/bug139.go
+++ b/test/fixedbugs/bug139.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go || echo BUG should compile
+// compile
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug140.go b/test/fixedbugs/bug140.go
index 441c57a48..8caf1d7d9 100644
--- a/test/fixedbugs/bug140.go
+++ b/test/fixedbugs/bug140.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go || echo BUG should compile
+// compile
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug141.go b/test/fixedbugs/bug141.go
index 756ba308d..81ba6f1b5 100644
--- a/test/fixedbugs/bug141.go
+++ b/test/fixedbugs/bug141.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out || echo BUG: should run
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
@@ -20,7 +20,7 @@ type Getter interface {
func f1(p Empty) {
switch x := p.(type) {
- default: println("failed to match interface"); os.Exit(1);
+ default: println("failed to match interface", x); os.Exit(1);
case Getter: break;
}
diff --git a/test/fixedbugs/bug142.go b/test/fixedbugs/bug142.go
index e54458baf..e28d889a9 100644
--- a/test/fixedbugs/bug142.go
+++ b/test/fixedbugs/bug142.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out || echo BUG: bug142
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug143.go b/test/fixedbugs/bug143.go
index 2f575fcfe..a43e40667 100644
--- a/test/fixedbugs/bug143.go
+++ b/test/fixedbugs/bug143.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go || echo BUG should compile
+// compile
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug144.go b/test/fixedbugs/bug144.go
index bab9a4402..9f8ec7667 100644
--- a/test/fixedbugs/bug144.go
+++ b/test/fixedbugs/bug144.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go || echo BUG should compile
+// compile
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug145.go b/test/fixedbugs/bug145.go
index c59bcebd6..602fe7426 100644
--- a/test/fixedbugs/bug145.go
+++ b/test/fixedbugs/bug145.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go || echo BUG should compile
+// compile
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug146.go b/test/fixedbugs/bug146.go
index 16324c741..e29f910ba 100644
--- a/test/fixedbugs/bug146.go
+++ b/test/fixedbugs/bug146.go
@@ -1,4 +1,4 @@
-// errchk $G $D/$F.go
+// errorcheck
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug147.go b/test/fixedbugs/bug147.go
index a16630b87..e8b3d2439 100644
--- a/test/fixedbugs/bug147.go
+++ b/test/fixedbugs/bug147.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out || echo BUG: bug147
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug148.go b/test/fixedbugs/bug148.go
index daedff105..b67870b12 100644
--- a/test/fixedbugs/bug148.go
+++ b/test/fixedbugs/bug148.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go && $L $F.$A && ! ./$A.out || echo BUG: should crash
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
@@ -8,6 +8,8 @@ package main
type T struct {a, b int};
+func println(x, y int) { }
+
func f(x interface{}) interface{} {
type T struct {a, b int};
@@ -24,16 +26,29 @@ func main() {
inner_T := f(nil);
f(inner_T);
+ shouldPanic(p1)
+}
+
+func p1() {
outer_T := T{5, 7};
f(outer_T);
}
+func shouldPanic(f func()) {
+ defer func() {
+ if recover() == nil {
+ panic("function should panic")
+ }
+ }()
+ f()
+}
+
/*
This prints:
2 3
5 7
-but it should crash: The type assertion on line 14 should fail
+but it should crash: The type assertion on line 18 should fail
for the 2nd call to f with outer_T.
*/
diff --git a/test/fixedbugs/bug149.go b/test/fixedbugs/bug149.go
index a40403b7d..78b687e97 100644
--- a/test/fixedbugs/bug149.go
+++ b/test/fixedbugs/bug149.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go || echo BUG: should compile
+// compile
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug150.go b/test/fixedbugs/bug150.go
index fc25444b6..b565ef73d 100644
--- a/test/fixedbugs/bug150.go
+++ b/test/fixedbugs/bug150.go
@@ -1,10 +1,10 @@
-// $G $D/$F.go || echo BUG: bug150
+// compile
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
-package main
+package bug150
type T int
func (t T) M()
diff --git a/test/fixedbugs/bug151.go b/test/fixedbugs/bug151.go
index 46546dfe1..d9f5e021c 100644
--- a/test/fixedbugs/bug151.go
+++ b/test/fixedbugs/bug151.go
@@ -1,10 +1,10 @@
-// $G $D/$F.go || echo BUG: bug151
+// compile
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
-package main
+package bug151
type S string
diff --git a/test/fixedbugs/bug1515.go b/test/fixedbugs/bug1515.go
index 740252516..a4baccda7 100644
--- a/test/fixedbugs/bug1515.go
+++ b/test/fixedbugs/bug1515.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2011 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug152.go b/test/fixedbugs/bug152.go
index 30c3cac91..45b9b3d53 100644
--- a/test/fixedbugs/bug152.go
+++ b/test/fixedbugs/bug152.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug154.go b/test/fixedbugs/bug154.go
index 4371cc5ce..a2cfd4acc 100644
--- a/test/fixedbugs/bug154.go
+++ b/test/fixedbugs/bug154.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out || echo BUG: should not panic
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug155.go b/test/fixedbugs/bug155.go
index 312c8e6a9..8872e978d 100644
--- a/test/fixedbugs/bug155.go
+++ b/test/fixedbugs/bug155.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go && $L $F.$A || echo BUG: bug155
+// build
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug156.go b/test/fixedbugs/bug156.go
index 0b77a72d9..f26658729 100644
--- a/test/fixedbugs/bug156.go
+++ b/test/fixedbugs/bug156.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go || echo BUG: bug156
+// compile
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug157.go b/test/fixedbugs/bug157.go
index 9bf68f7a4..1072d7df4 100644
--- a/test/fixedbugs/bug157.go
+++ b/test/fixedbugs/bug157.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go || echo BUG: should compile
+// compile
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug158.go b/test/fixedbugs/bug158.go
index cdf3195fe..496d7e0db 100644
--- a/test/fixedbugs/bug158.go
+++ b/test/fixedbugs/bug158.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go || echo BUG: should compile
+// compile
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug159.go b/test/fixedbugs/bug159.go
index 1aa64433a..92d534563 100644
--- a/test/fixedbugs/bug159.go
+++ b/test/fixedbugs/bug159.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out || echo BUG: bug159
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug161.go b/test/fixedbugs/bug161.go
index e5f25f746..aab58ee89 100644
--- a/test/fixedbugs/bug161.go
+++ b/test/fixedbugs/bug161.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go || echo BUG: should compile
+// compile
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug163.go b/test/fixedbugs/bug163.go
index 919298e6f..d69f6bef0 100644
--- a/test/fixedbugs/bug163.go
+++ b/test/fixedbugs/bug163.go
@@ -1,4 +1,4 @@
-// errchk $G $D/$F.go
+// errorcheck
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug164.go b/test/fixedbugs/bug164.go
index 746f631ae..888b495ee 100644
--- a/test/fixedbugs/bug164.go
+++ b/test/fixedbugs/bug164.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go
+// compile
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug165.go b/test/fixedbugs/bug165.go
index 8ce67a46d..f8d50af13 100644
--- a/test/fixedbugs/bug165.go
+++ b/test/fixedbugs/bug165.go
@@ -1,4 +1,4 @@
-// errchk $G $D/$F.go
+// errorcheck
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug167.go b/test/fixedbugs/bug167.go
index 33eb3cb1a..3a50e6ff0 100644
--- a/test/fixedbugs/bug167.go
+++ b/test/fixedbugs/bug167.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go && $L $F.$A || echo BUG: bug167
+// build
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug168.go b/test/fixedbugs/bug168.go
index e25eb56b0..53301fa81 100644
--- a/test/fixedbugs/bug168.go
+++ b/test/fixedbugs/bug168.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out || echo BUG: bug168
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug169.go b/test/fixedbugs/bug169.go
index c42727f38..f63c2f3e1 100644
--- a/test/fixedbugs/bug169.go
+++ b/test/fixedbugs/bug169.go
@@ -1,4 +1,4 @@
-// errchk $G $D/$F.go
+// errorcheck
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug170.go b/test/fixedbugs/bug170.go
index e7f1c5120..11ff5ff3c 100644
--- a/test/fixedbugs/bug170.go
+++ b/test/fixedbugs/bug170.go
@@ -1,4 +1,4 @@
-// errchk $G $D/$F.go
+// errorcheck
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug171.go b/test/fixedbugs/bug171.go
index 5357b2adc..49bbb3b89 100644
--- a/test/fixedbugs/bug171.go
+++ b/test/fixedbugs/bug171.go
@@ -1,4 +1,4 @@
-// errchk $G $D/$F.go
+// errorcheck
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug172.go b/test/fixedbugs/bug172.go
index 1837a1158..4dbe7930f 100644
--- a/test/fixedbugs/bug172.go
+++ b/test/fixedbugs/bug172.go
@@ -1,4 +1,4 @@
-// errchk $G $D/$F.go
+// errorcheck
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug173.go b/test/fixedbugs/bug173.go
index 898b8400b..6479bb253 100644
--- a/test/fixedbugs/bug173.go
+++ b/test/fixedbugs/bug173.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go || echo BUG: bug173
+// compile
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug174.go b/test/fixedbugs/bug174.go
index 7ff865513..448f63086 100644
--- a/test/fixedbugs/bug174.go
+++ b/test/fixedbugs/bug174.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go || echo BUG: bug174
+// compile
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug175.go b/test/fixedbugs/bug175.go
index a8f6e3ca4..5fca4b22b 100644
--- a/test/fixedbugs/bug175.go
+++ b/test/fixedbugs/bug175.go
@@ -1,4 +1,4 @@
-// errchk $G $D/$F.go
+// errorcheck
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
@@ -10,5 +10,5 @@ func f() (int, bool) { return 0, true }
func main() {
x, y := f(), 2; // ERROR "multi"
+ _, _ = x, y
}
-
diff --git a/test/fixedbugs/bug176.go b/test/fixedbugs/bug176.go
index 5820df308..82f8dba0a 100644
--- a/test/fixedbugs/bug176.go
+++ b/test/fixedbugs/bug176.go
@@ -1,4 +1,4 @@
-// errchk $G $D/$F.go
+// errorcheck
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug177.go b/test/fixedbugs/bug177.go
index a120ad0ab..9f2c1ea52 100644
--- a/test/fixedbugs/bug177.go
+++ b/test/fixedbugs/bug177.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug178.go b/test/fixedbugs/bug178.go
index a7ff09dae..2bae5a1c5 100644
--- a/test/fixedbugs/bug178.go
+++ b/test/fixedbugs/bug178.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug179.go b/test/fixedbugs/bug179.go
index 3347613d8..dea82fe0a 100644
--- a/test/fixedbugs/bug179.go
+++ b/test/fixedbugs/bug179.go
@@ -1,4 +1,4 @@
-// errchk $G -e $D/$F.go
+// errorcheck
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug180.go b/test/fixedbugs/bug180.go
index 96823fb3a..cfdcfab26 100644
--- a/test/fixedbugs/bug180.go
+++ b/test/fixedbugs/bug180.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug181.go b/test/fixedbugs/bug181.go
index f87bc9d4e..4827e9cf0 100644
--- a/test/fixedbugs/bug181.go
+++ b/test/fixedbugs/bug181.go
@@ -1,4 +1,4 @@
-// errchk $G $D/$F.go
+// errorcheck
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug182.go b/test/fixedbugs/bug182.go
index 81df2ca13..e02dc59f8 100644
--- a/test/fixedbugs/bug182.go
+++ b/test/fixedbugs/bug182.go
@@ -1,4 +1,4 @@
-// errchk $G $D/$F.go
+// errorcheck
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug183.go b/test/fixedbugs/bug183.go
index 7fd6e4942..dc9f5356e 100644
--- a/test/fixedbugs/bug183.go
+++ b/test/fixedbugs/bug183.go
@@ -1,4 +1,4 @@
-//errchk $G $D/$F.go
+// errorcheck
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug184.go b/test/fixedbugs/bug184.go
index 3cc984535..c084ea5cf 100644
--- a/test/fixedbugs/bug184.go
+++ b/test/fixedbugs/bug184.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug185.go b/test/fixedbugs/bug185.go
index acae174f4..890900600 100644
--- a/test/fixedbugs/bug185.go
+++ b/test/fixedbugs/bug185.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug186.go b/test/fixedbugs/bug186.go
index dde794a5d..5aefd7e5c 100644
--- a/test/fixedbugs/bug186.go
+++ b/test/fixedbugs/bug186.go
@@ -1,4 +1,4 @@
-// errchk $G $D/$F.go
+// errorcheck
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug187.go b/test/fixedbugs/bug187.go
index 66aa5f024..5c3c2bb1e 100644
--- a/test/fixedbugs/bug187.go
+++ b/test/fixedbugs/bug187.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug188.go b/test/fixedbugs/bug188.go
index e1cbce05d..550614789 100644
--- a/test/fixedbugs/bug188.go
+++ b/test/fixedbugs/bug188.go
@@ -1,4 +1,4 @@
-// errchk $G $D/$F.go
+// errorcheck
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug189.go b/test/fixedbugs/bug189.go
index ce338305c..9e412c66d 100644
--- a/test/fixedbugs/bug189.go
+++ b/test/fixedbugs/bug189.go
@@ -1,4 +1,4 @@
-// errchk $G $D/$F.go
+// errorcheck
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug190.go b/test/fixedbugs/bug190.go
index da0bfde0f..bb2d81cbb 100644
--- a/test/fixedbugs/bug190.go
+++ b/test/fixedbugs/bug190.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go || echo BUG: should compile
+// compile
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug192.go b/test/fixedbugs/bug192.go
index 282ed30d3..679aaed1f 100644
--- a/test/fixedbugs/bug192.go
+++ b/test/fixedbugs/bug192.go
@@ -1,4 +1,4 @@
-// errchk $G $D/$F.go
+// errorcheck
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug193.go b/test/fixedbugs/bug193.go
index 5ef02b1c1..64e06da89 100644
--- a/test/fixedbugs/bug193.go
+++ b/test/fixedbugs/bug193.go
@@ -1,4 +1,4 @@
-// errchk $G $D/$F.go
+// errorcheck
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug194.go b/test/fixedbugs/bug194.go
index dcd633dde..297652903 100644
--- a/test/fixedbugs/bug194.go
+++ b/test/fixedbugs/bug194.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out || echo BUG should compile and run
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug195.go b/test/fixedbugs/bug195.go
index 65ab02a03..85367cb88 100644
--- a/test/fixedbugs/bug195.go
+++ b/test/fixedbugs/bug195.go
@@ -1,4 +1,4 @@
-// errchk $G $D/$F.go
+// errorcheck
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
@@ -23,5 +23,5 @@ type I5 interface {
}
type I6 interface {
- I5 // GC_ERROR "interface"
+ I5 // ERROR "interface"
}
diff --git a/test/fixedbugs/bug196.go b/test/fixedbugs/bug196.go
index ea8ab0dc1..5255de189 100644
--- a/test/fixedbugs/bug196.go
+++ b/test/fixedbugs/bug196.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out || echo BUG: bug196
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug197.go b/test/fixedbugs/bug197.go
index c205c5bca..4a9f103ea 100644
--- a/test/fixedbugs/bug197.go
+++ b/test/fixedbugs/bug197.go
@@ -1,4 +1,4 @@
-// errchk $G $D/$F.go
+// errorcheck
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug198.go b/test/fixedbugs/bug198.go
index ea71fad58..73bb64688 100644
--- a/test/fixedbugs/bug198.go
+++ b/test/fixedbugs/bug198.go
@@ -1,4 +1,4 @@
-// errchk $G $D/$F.go
+// errorcheck
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug199.go b/test/fixedbugs/bug199.go
index 71226290f..f69f23b59 100644
--- a/test/fixedbugs/bug199.go
+++ b/test/fixedbugs/bug199.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug200.go b/test/fixedbugs/bug200.go
index 123f68728..da628faf5 100644
--- a/test/fixedbugs/bug200.go
+++ b/test/fixedbugs/bug200.go
@@ -1,4 +1,4 @@
-// errchk $G $D/$F.go
+// errorcheck
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
@@ -12,7 +12,7 @@ func main() {
// and worse, compiled the wrong code
// for one of them.
var x interface{};
- switch v := x.(type) {
+ switch x.(type) {
case func(int):
case func(f int): // ERROR "duplicate"
}
diff --git a/test/fixedbugs/bug201.go b/test/fixedbugs/bug201.go
index f7db62fc9..59248231a 100644
--- a/test/fixedbugs/bug201.go
+++ b/test/fixedbugs/bug201.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug202.go b/test/fixedbugs/bug202.go
index 2fc91b520..49871e3e0 100644
--- a/test/fixedbugs/bug202.go
+++ b/test/fixedbugs/bug202.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out || echo BUG should run
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug203.go b/test/fixedbugs/bug203.go
index bf86ee912..2fb084bd6 100644
--- a/test/fixedbugs/bug203.go
+++ b/test/fixedbugs/bug203.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug204.go b/test/fixedbugs/bug204.go
index d4534c27c..8810a5f92 100644
--- a/test/fixedbugs/bug204.go
+++ b/test/fixedbugs/bug204.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
@@ -7,18 +7,18 @@
package main
func main() {
- nchar := 0;
- a := []int { '日', '本', '語', 0xFFFD };
+ nchar := 0
+ a := []rune{'日', '本', '語', 0xFFFD}
for _, char := range "日本語\xc0" {
if nchar >= len(a) {
- println("BUG");
- break;
+ println("BUG")
+ break
}
if char != a[nchar] {
- println("expected", a[nchar], "got", char);
- println("BUG");
- break;
+ println("expected", a[nchar], "got", char)
+ println("BUG")
+ break
}
- nchar++;
+ nchar++
}
}
diff --git a/test/fixedbugs/bug205.go b/test/fixedbugs/bug205.go
index e12be72f9..de17cb698 100644
--- a/test/fixedbugs/bug205.go
+++ b/test/fixedbugs/bug205.go
@@ -1,4 +1,4 @@
-// errchk $G $D/$F.go
+// errorcheck
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug207.go b/test/fixedbugs/bug207.go
index 5810d6690..50923df1c 100644
--- a/test/fixedbugs/bug207.go
+++ b/test/fixedbugs/bug207.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug208.go b/test/fixedbugs/bug208.go
index 13b040084..09ec0afbe 100644
--- a/test/fixedbugs/bug208.go
+++ b/test/fixedbugs/bug208.go
@@ -1,4 +1,4 @@
-// errchk $G $D/$F.go
+// errorcheck
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug209.go b/test/fixedbugs/bug209.go
index ae6f10f60..52faf1fb9 100644
--- a/test/fixedbugs/bug209.go
+++ b/test/fixedbugs/bug209.go
@@ -1,4 +1,4 @@
-// errchk $G $D/$F.go
+// errorcheck
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug211.go b/test/fixedbugs/bug211.go
index 69aeeeeac..b15047927 100644
--- a/test/fixedbugs/bug211.go
+++ b/test/fixedbugs/bug211.go
@@ -1,4 +1,4 @@
-// errchk $G $D/$F.go
+// errorcheck
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug212.go b/test/fixedbugs/bug212.go
index 51df9b8ae..4e58b91ec 100644
--- a/test/fixedbugs/bug212.go
+++ b/test/fixedbugs/bug212.go
@@ -1,4 +1,4 @@
-// errchk $G $D/$F.go
+// errorcheck
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug213.go b/test/fixedbugs/bug213.go
index 07d9f9029..7f4786b52 100644
--- a/test/fixedbugs/bug213.go
+++ b/test/fixedbugs/bug213.go
@@ -1,4 +1,4 @@
-// errchk $G $D/$F.go
+// errorcheck
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
@@ -7,7 +7,7 @@
package main
func main() {
var v interface{} = 0;
- switch x := v.(type) {
+ switch v.(type) {
case int:
fallthrough; // ERROR "fallthrough"
default:
diff --git a/test/fixedbugs/bug214.go b/test/fixedbugs/bug214.go
index 502e69826..5420058c4 100644
--- a/test/fixedbugs/bug214.go
+++ b/test/fixedbugs/bug214.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go || echo BUG: bug214
+// compile
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug215.go b/test/fixedbugs/bug215.go
index 8f7fb2d3c..08ed662c6 100644
--- a/test/fixedbugs/bug215.go
+++ b/test/fixedbugs/bug215.go
@@ -1,4 +1,4 @@
-// errchk $G $D/$F.go
+// errorcheck
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug216.go b/test/fixedbugs/bug216.go
index 76f85464a..c83a522bf 100644
--- a/test/fixedbugs/bug216.go
+++ b/test/fixedbugs/bug216.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go || echo BUG: bug216
+// compile
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug217.go b/test/fixedbugs/bug217.go
index 98334c4ce..ec93c25d9 100644
--- a/test/fixedbugs/bug217.go
+++ b/test/fixedbugs/bug217.go
@@ -1,4 +1,4 @@
-// errchk $G $D/$F.go
+// errorcheck
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug218.go b/test/fixedbugs/bug218.go
index b2c9ede75..0e008db17 100644
--- a/test/fixedbugs/bug218.go
+++ b/test/fixedbugs/bug218.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go || echo BUG: bug218
+// compile
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug219.go b/test/fixedbugs/bug219.go
index 966d3fcf3..290c691ea 100644
--- a/test/fixedbugs/bug219.go
+++ b/test/fixedbugs/bug219.go
@@ -1,10 +1,10 @@
-// $G $D/$F.go || echo BUG: bug219
+// compile
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
-package main
+package bug219
func f(func()) int { return 0 }
diff --git a/test/fixedbugs/bug220.go b/test/fixedbugs/bug220.go
deleted file mode 100644
index ff027ddc2..000000000
--- a/test/fixedbugs/bug220.go
+++ /dev/null
@@ -1,14 +0,0 @@
-// $G $D/$F.go || echo BUG: bug220
-
-// Copyright 2009 The Go Authors. All rights reserved.
-// Use of this source code is governed by a BSD-style
-// license that can be found in the LICENSE file.
-
-package main
-
-func main() {
- m := make(map[int]map[uint]float64)
-
- m[0] = make(map[uint]float64), false // 6g used to reject this
- m[1] = nil
-}
diff --git a/test/fixedbugs/bug221.go b/test/fixedbugs/bug221.go
index b64583114..86fda2035 100644
--- a/test/fixedbugs/bug221.go
+++ b/test/fixedbugs/bug221.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug222.dir/chanbug.go b/test/fixedbugs/bug222.dir/chanbug.go
index 9194927b5..16920246e 100644
--- a/test/fixedbugs/bug222.dir/chanbug.go
+++ b/test/fixedbugs/bug222.dir/chanbug.go
@@ -1,3 +1,7 @@
+// Copyright 2009 The Go Authors. All rights reserved.
+// Use of this source code is governed by a BSD-style
+// license that can be found in the LICENSE file
+
package chanbug
var C chan<- (chan int)
var D chan<- func()
diff --git a/test/fixedbugs/bug222.dir/chanbug2.go b/test/fixedbugs/bug222.dir/chanbug2.go
index 73e16678e..109581dc3 100644
--- a/test/fixedbugs/bug222.dir/chanbug2.go
+++ b/test/fixedbugs/bug222.dir/chanbug2.go
@@ -1,2 +1,6 @@
+// Copyright 2009 The Go Authors. All rights reserved.
+// Use of this source code is governed by a BSD-style
+// license that can be found in the LICENSE file
+
package Bar
import _ "chanbug"
diff --git a/test/fixedbugs/bug223.go b/test/fixedbugs/bug223.go
index 80f9cae81..eccf574a1 100644
--- a/test/fixedbugs/bug223.go
+++ b/test/fixedbugs/bug223.go
@@ -1,4 +1,4 @@
-// (! $G $D/$F.go) | grep 'initialization loop' >/dev/null || echo BUG: bug223
+// errorcheck
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
@@ -18,4 +18,4 @@ func f() {
}
}
-var m = map[string]F{"f": f}
+var m = map[string]F{"f": f} // ERROR "initialization loop"
diff --git a/test/fixedbugs/bug224.go b/test/fixedbugs/bug224.go
index 11ee57ecf..d2fd67cf3 100644
--- a/test/fixedbugs/bug224.go
+++ b/test/fixedbugs/bug224.go
@@ -1,4 +1,4 @@
-// errchk $G $D/$F.go
+// errorcheck
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug225.go b/test/fixedbugs/bug225.go
index 8acf66c4e..1bda9ab4b 100644
--- a/test/fixedbugs/bug225.go
+++ b/test/fixedbugs/bug225.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug226.dir/x.go b/test/fixedbugs/bug226.dir/x.go
deleted file mode 100644
index 64d7a29e7..000000000
--- a/test/fixedbugs/bug226.dir/x.go
+++ /dev/null
@@ -1,9 +0,0 @@
-// Copyright 2009 The Go Authors. All rights reserved.
-// Use of this source code is governed by a BSD-style
-// license that can be found in the LICENSE file.
-
-package x
-
-type T struct { x, Y int }
-
-func (t T) M()
diff --git a/test/fixedbugs/bug226.dir/y.go b/test/fixedbugs/bug226.dir/y.go
deleted file mode 100644
index c66d592b7..000000000
--- a/test/fixedbugs/bug226.dir/y.go
+++ /dev/null
@@ -1,31 +0,0 @@
-// Copyright 2009 The Go Authors. All rights reserved.
-// Use of this source code is governed by a BSD-style
-// license that can be found in the LICENSE file.
-
-package y
-
-import "./x"
-
-func f() {
- ok := new(x.T);
- var ok1 x.T;
- ok2 := &ok1;
- ok3 := &x.T{};
- ok4 := &x.T{Y:2};
- _ = x.T{};
- _ = x.T{Y:2};
-
- ok1.M();
- bad1 := *ok; // ERROR "assignment.*T"
- bad2 := ok1; // ERROR "assignment.*T"
- *ok4 = ok1; // ERROR "assignment.*T"
- *ok4 = *ok2; // ERROR "assignment.*T"
- ok1 = *ok4; // ERROR "assignment.*T"
- _ = bad1;
- _ = bad2;
- _ = ok4;
- _ = ok3;
- _ = ok2;
- _ = ok1;
- _ = ok;
-}
diff --git a/test/fixedbugs/bug226.go b/test/fixedbugs/bug226.go
deleted file mode 100644
index 5457a64bc..000000000
--- a/test/fixedbugs/bug226.go
+++ /dev/null
@@ -1,7 +0,0 @@
-// $G $D/$F.dir/x.go && errchk $G $D/$F.dir/y.go
-
-// Copyright 2009 The Go Authors. All rights reserved.
-// Use of this source code is governed by a BSD-style
-// license that can be found in the LICENSE file.
-
-ignored
diff --git a/test/fixedbugs/bug227.go b/test/fixedbugs/bug227.go
index a60866044..ea8d02d10 100644
--- a/test/fixedbugs/bug227.go
+++ b/test/fixedbugs/bug227.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug228.go b/test/fixedbugs/bug228.go
index da335dbc0..3d23609dd 100644
--- a/test/fixedbugs/bug228.go
+++ b/test/fixedbugs/bug228.go
@@ -1,4 +1,4 @@
-// errchk $G -e $D/$F.go
+// errorcheck
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug229.go b/test/fixedbugs/bug229.go
index 6c9de9ba9..19776881d 100644
--- a/test/fixedbugs/bug229.go
+++ b/test/fixedbugs/bug229.go
@@ -1,4 +1,4 @@
-// errchk $G -e $D/$F.go
+// errorcheck
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
@@ -12,9 +12,9 @@ func main() {
var t testing.T
// make sure error mentions that
- // ch is unexported, not just "ch not found".
+ // name is unexported, not just "name not found".
- t.ch = nil // ERROR "unexported"
+ t.name = nil // ERROR "unexported"
println(testing.anyLowercaseName("asdf")) // ERROR "unexported" "undefined: testing.anyLowercaseName"
}
diff --git a/test/fixedbugs/bug230.go b/test/fixedbugs/bug230.go
index c7ad1a366..210acc430 100644
--- a/test/fixedbugs/bug230.go
+++ b/test/fixedbugs/bug230.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug231.go b/test/fixedbugs/bug231.go
index 9500e582b..a9d409b7d 100644
--- a/test/fixedbugs/bug231.go
+++ b/test/fixedbugs/bug231.go
@@ -1,4 +1,4 @@
-// errchk $G -e $D/$F.go
+// errorcheck
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug232.go b/test/fixedbugs/bug232.go
index 99bd02ff6..d18727e90 100644
--- a/test/fixedbugs/bug232.go
+++ b/test/fixedbugs/bug232.go
@@ -1,8 +1,8 @@
-// $G $D/$F.go
+// compile
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
-package main
+package bug232
type I interface { X(...int) }
diff --git a/test/fixedbugs/bug233.go b/test/fixedbugs/bug233.go
index 31bb673eb..63f8ee2e9 100644
--- a/test/fixedbugs/bug233.go
+++ b/test/fixedbugs/bug233.go
@@ -1,10 +1,10 @@
-// $G $D/$F.go
+// compile
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
-package main
+package bug233
import p "fmt"
var _ = p.Print
var fmt = 10
diff --git a/test/fixedbugs/bug234.go b/test/fixedbugs/bug234.go
index 562109a05..9f503f04a 100644
--- a/test/fixedbugs/bug234.go
+++ b/test/fixedbugs/bug234.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug235.go b/test/fixedbugs/bug235.go
index 8cecd9d04..d12d9e736 100644
--- a/test/fixedbugs/bug235.go
+++ b/test/fixedbugs/bug235.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go
+// compile
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
@@ -6,7 +6,7 @@
// used to crash the compiler
-package main
+package bug235
type T struct {
x [4]byte
diff --git a/test/fixedbugs/bug236.go b/test/fixedbugs/bug236.go
index 895f82a23..6c245565f 100644
--- a/test/fixedbugs/bug236.go
+++ b/test/fixedbugs/bug236.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug237.go b/test/fixedbugs/bug237.go
index 55cc86ace..58996cadc 100644
--- a/test/fixedbugs/bug237.go
+++ b/test/fixedbugs/bug237.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug238.go b/test/fixedbugs/bug238.go
index 4d5a905f0..cc47189e1 100644
--- a/test/fixedbugs/bug238.go
+++ b/test/fixedbugs/bug238.go
@@ -1,4 +1,4 @@
-// errchk $G -e $D/$F.go
+// errorcheck
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug239.go b/test/fixedbugs/bug239.go
index 32c3d7e1c..e4902527d 100644
--- a/test/fixedbugs/bug239.go
+++ b/test/fixedbugs/bug239.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go || echo BUG: bug239
+// compile
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug240.go b/test/fixedbugs/bug240.go
index 6cba9c8b1..478b5b2ea 100644
--- a/test/fixedbugs/bug240.go
+++ b/test/fixedbugs/bug240.go
@@ -1,4 +1,4 @@
-// errchk $G -e $D/$F.go
+// errorcheck
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug241.go b/test/fixedbugs/bug241.go
index 172b3742e..1f4440147 100644
--- a/test/fixedbugs/bug241.go
+++ b/test/fixedbugs/bug241.go
@@ -1,4 +1,4 @@
-// errchk $G $D/$F.go
+// errorcheck
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug242.go b/test/fixedbugs/bug242.go
index 839dccd37..4791ae485 100644
--- a/test/fixedbugs/bug242.go
+++ b/test/fixedbugs/bug242.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out || echo BUG: tuple evaluation order
+// run
// Copyright 2010 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
@@ -93,7 +93,8 @@ func main() {
m[13] = 'B'
// 13 14
- m[gint()] = gbyte(), false
+ delete(m, gint())
+ gbyte()
if _, present := m[13]; present {
println("bad map removal")
panic("fail")
diff --git a/test/fixedbugs/bug243.go b/test/fixedbugs/bug243.go
index 95514cfd6..4870c3614 100644
--- a/test/fixedbugs/bug243.go
+++ b/test/fixedbugs/bug243.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2010 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
@@ -6,7 +6,7 @@
package main
-import "os"
+import "errors"
// Issue 481: closures and var declarations
// with multiple variables assigned from one
@@ -22,7 +22,7 @@ func main() {
}
}()
- var conn, _ = Dial("tcp", "", listen.Addr().String())
+ var conn, _ = Dial("tcp", "", listen.Addr().Error())
_ = conn
}
@@ -37,8 +37,8 @@ func Listen(x, y string) (T, string) {
return global, y
}
-func (t T) Addr() os.Error {
- return os.NewError("stringer")
+func (t T) Addr() error {
+ return errors.New("stringer")
}
func (t T) Accept() (int, string) {
diff --git a/test/fixedbugs/bug244.go b/test/fixedbugs/bug244.go
index 915c3fcd0..29bf0d58b 100644
--- a/test/fixedbugs/bug244.go
+++ b/test/fixedbugs/bug244.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2010 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug245.go b/test/fixedbugs/bug245.go
index 6e5a8b344..c607a6dc3 100644
--- a/test/fixedbugs/bug245.go
+++ b/test/fixedbugs/bug245.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go || echo BUG: bug245
+// compile
// Copyright 2010 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug246.go b/test/fixedbugs/bug246.go
index 12041eb1d..e506f8c0d 100644
--- a/test/fixedbugs/bug246.go
+++ b/test/fixedbugs/bug246.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out || echo BUG: bug246
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug247.go b/test/fixedbugs/bug247.go
index 2f56b88d4..b6851e1bc 100644
--- a/test/fixedbugs/bug247.go
+++ b/test/fixedbugs/bug247.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out || echo BUG: bug247
+// run
// Copyright 2010 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug248.dir/bug0.go b/test/fixedbugs/bug248.dir/bug0.go
index 7fc7401c5..78433f504 100644
--- a/test/fixedbugs/bug248.dir/bug0.go
+++ b/test/fixedbugs/bug248.dir/bug0.go
@@ -1,3 +1,7 @@
+// Copyright 2010 The Go Authors. All rights reserved.
+// Use of this source code is governed by a BSD-style
+// license that can be found in the LICENSE file
+
package p
type T struct {
diff --git a/test/fixedbugs/bug248.dir/bug1.go b/test/fixedbugs/bug248.dir/bug1.go
index 7fc7401c5..78433f504 100644
--- a/test/fixedbugs/bug248.dir/bug1.go
+++ b/test/fixedbugs/bug248.dir/bug1.go
@@ -1,3 +1,7 @@
+// Copyright 2010 The Go Authors. All rights reserved.
+// Use of this source code is governed by a BSD-style
+// license that can be found in the LICENSE file
+
package p
type T struct {
diff --git a/test/fixedbugs/bug248.dir/bug2.go b/test/fixedbugs/bug248.dir/bug2.go
index b6c816a5c..ba547d64a 100644
--- a/test/fixedbugs/bug248.dir/bug2.go
+++ b/test/fixedbugs/bug248.dir/bug2.go
@@ -1,3 +1,7 @@
+// Copyright 2010 The Go Authors. All rights reserved.
+// Use of this source code is governed by a BSD-style
+// license that can be found in the LICENSE file
+
package main
import (
@@ -80,7 +84,7 @@ func main() {
case 2:
i = 3.14
}
- switch k := i.(type) {
+ switch i.(type) {
case p0.T:
if j != 0 {
println("type switch p0.T")
diff --git a/test/fixedbugs/bug248.dir/bug3.go b/test/fixedbugs/bug248.dir/bug3.go
index e5a244955..4a56c5cc8 100644
--- a/test/fixedbugs/bug248.dir/bug3.go
+++ b/test/fixedbugs/bug248.dir/bug3.go
@@ -1,3 +1,7 @@
+// Copyright 2010 The Go Authors. All rights reserved.
+// Use of this source code is governed by a BSD-style
+// license that can be found in the LICENSE file
+
package main
import (
diff --git a/test/fixedbugs/bug249.go b/test/fixedbugs/bug249.go
index c85708fd8..dc922455e 100644
--- a/test/fixedbugs/bug249.go
+++ b/test/fixedbugs/bug249.go
@@ -1,4 +1,4 @@
-// errchk $G $D/$F.go
+// errorcheck
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug250.go b/test/fixedbugs/bug250.go
index cd28642bf..5140f3e29 100644
--- a/test/fixedbugs/bug250.go
+++ b/test/fixedbugs/bug250.go
@@ -1,10 +1,10 @@
-// $G $D/$F.go || echo BUG: bug250
+// compile
// Copyright 2010 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
-package main
+package bug250
type I1 interface {
m() I2
diff --git a/test/fixedbugs/bug251.go b/test/fixedbugs/bug251.go
index c94ad2abe..43d9d526f 100644
--- a/test/fixedbugs/bug251.go
+++ b/test/fixedbugs/bug251.go
@@ -1,4 +1,4 @@
-// errchk $G $D/$F.go
+// errorcheck
// Copyright 2010 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
@@ -12,10 +12,10 @@ type I1 interface {
}
type I2 interface {
- I1 // GC_ERROR "loop|interface"
+ I1 // ERROR "loop|interface"
}
-var i1 I1 = i2 // GC_ERROR "missing m method|need type assertion"
+var i1 I1 = i2
var i2 I2
var i2a I2 = i1
diff --git a/test/fixedbugs/bug252.go b/test/fixedbugs/bug252.go
index a2c1dab9d..6f007fb77 100644
--- a/test/fixedbugs/bug252.go
+++ b/test/fixedbugs/bug252.go
@@ -1,4 +1,4 @@
-// errchk $G $D/$F.go
+// errorcheck
// Copyright 2010 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug253.go b/test/fixedbugs/bug253.go
index bb5b770f5..f6ab712ef 100644
--- a/test/fixedbugs/bug253.go
+++ b/test/fixedbugs/bug253.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out || echo BUG: bug253
+// run
// Copyright 2010 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug254.go b/test/fixedbugs/bug254.go
index c0c7f249e..9b1c81911 100644
--- a/test/fixedbugs/bug254.go
+++ b/test/fixedbugs/bug254.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out || echo BUG: bug254
+// run
// Copyright 2010 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug255.go b/test/fixedbugs/bug255.go
index 44427cfdb..dbd41cc6a 100644
--- a/test/fixedbugs/bug255.go
+++ b/test/fixedbugs/bug255.go
@@ -1,4 +1,4 @@
-// errchk $G -e $D/$F.go
+// errorcheck
// Copyright 2010 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug256.go b/test/fixedbugs/bug256.go
index 37fa5f5c8..0498a40d5 100644
--- a/test/fixedbugs/bug256.go
+++ b/test/fixedbugs/bug256.go
@@ -1,4 +1,4 @@
-// errchk $G -e $D/$F.go
+// errorcheck
// Copyright 2010 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug257.go b/test/fixedbugs/bug257.go
index 713c42481..003f3ff94 100644
--- a/test/fixedbugs/bug257.go
+++ b/test/fixedbugs/bug257.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out || echo BUG: bugxxx
+// run
// Copyright 2010 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
@@ -20047,11 +20047,10 @@ var gettysburg = " Four score and seven years ago our fathers brought forth on\
"\n" +
"Abraham Lincoln, November 19, 1863, Gettysburg, Pennsylvania\n"
-
func main() {
m := md5.New()
io.WriteString(m, data)
- hash := fmt.Sprintf("%x", m.Sum())
+ hash := fmt.Sprintf("%x", m.Sum(nil))
if hash != "525f06bc62a65017cd2217d7584e5920" {
println("BUG a", hash)
return
@@ -20059,7 +20058,7 @@ func main() {
m = md5.New()
io.WriteString(m, gettysburg)
- hash = fmt.Sprintf("%x", m.Sum())
+ hash = fmt.Sprintf("%x", m.Sum(nil))
if hash != "d7ec5d9d47a4d166091e8d9ebd7ea0aa" {
println("BUG gettysburg", hash)
println(len(gettysburg))
diff --git a/test/fixedbugs/bug258.go b/test/fixedbugs/bug258.go
index 8984df592..d362e5a69 100644
--- a/test/fixedbugs/bug258.go
+++ b/test/fixedbugs/bug258.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2010 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug259.go b/test/fixedbugs/bug259.go
index d148fb3a0..e4dcaeb2f 100644
--- a/test/fixedbugs/bug259.go
+++ b/test/fixedbugs/bug259.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2010 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug260.go b/test/fixedbugs/bug260.go
index 34757c70e..6211c4885 100644
--- a/test/fixedbugs/bug260.go
+++ b/test/fixedbugs/bug260.go
@@ -1,4 +1,8 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out || echo BUG: bug260 failed
+// run
+
+// Copyright 2010 The Go Authors. All rights reserved.
+// Use of this source code is governed by a BSD-style
+// license that can be found in the LICENSE file
// Test that structures pack densely, according to the alignment of the largest field.
@@ -24,8 +28,8 @@ func main() {
report := len(os.Args) > 1
status := 0
var b1 [10]T1
- a0, _ := strconv.Btoui64(fmt.Sprintf("%p", &b1[0])[2:], 16)
- a1, _ := strconv.Btoui64(fmt.Sprintf("%p", &b1[1])[2:], 16)
+ a0, _ := strconv.ParseUint(fmt.Sprintf("%p", &b1[0])[2:], 16, 64)
+ a1, _ := strconv.ParseUint(fmt.Sprintf("%p", &b1[1])[2:], 16, 64)
if a1 != a0+1 {
fmt.Println("FAIL")
if report {
@@ -34,8 +38,8 @@ func main() {
status = 1
}
var b2 [10]T2
- a0, _ = strconv.Btoui64(fmt.Sprintf("%p", &b2[0])[2:], 16)
- a1, _ = strconv.Btoui64(fmt.Sprintf("%p", &b2[1])[2:], 16)
+ a0, _ = strconv.ParseUint(fmt.Sprintf("%p", &b2[0])[2:], 16, 64)
+ a1, _ = strconv.ParseUint(fmt.Sprintf("%p", &b2[1])[2:], 16, 64)
if a1 != a0+2 {
if status == 0 {
fmt.Println("FAIL")
@@ -46,8 +50,8 @@ func main() {
}
}
var b4 [10]T4
- a0, _ = strconv.Btoui64(fmt.Sprintf("%p", &b4[0])[2:], 16)
- a1, _ = strconv.Btoui64(fmt.Sprintf("%p", &b4[1])[2:], 16)
+ a0, _ = strconv.ParseUint(fmt.Sprintf("%p", &b4[0])[2:], 16, 64)
+ a1, _ = strconv.ParseUint(fmt.Sprintf("%p", &b4[1])[2:], 16, 64)
if a1 != a0+4 {
if status == 0 {
fmt.Println("FAIL")
diff --git a/test/fixedbugs/bug261.go b/test/fixedbugs/bug261.go
index 8c3fda1e7..f7879b04c 100644
--- a/test/fixedbugs/bug261.go
+++ b/test/fixedbugs/bug261.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2010 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug262.go b/test/fixedbugs/bug262.go
index 66f580bd1..6cf248a18 100644
--- a/test/fixedbugs/bug262.go
+++ b/test/fixedbugs/bug262.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2010 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
@@ -7,7 +7,7 @@
package main
import (
- "os"
+ "errors"
"strconv"
)
@@ -18,9 +18,9 @@ func f() string {
return "abc"
}
-func g() *os.Error {
+func g() *error {
trace += "g"
- var x os.Error
+ var x error
return &x
}
@@ -35,7 +35,6 @@ func i() *int {
return &i
}
-
func main() {
m := make(map[string]int)
m[f()], *g() = strconv.Atoi(h())
@@ -43,9 +42,9 @@ func main() {
println("BUG", m["abc"], trace)
panic("fail")
}
- mm := make(map[string]os.Error)
+ mm := make(map[string]error)
trace = ""
- mm["abc"] = os.EINVAL
+ mm["abc"] = errors.New("invalid")
*i(), mm[f()] = strconv.Atoi(h())
if mm["abc"] != nil || trace != "ifh" {
println("BUG1", mm["abc"], trace)
diff --git a/test/fixedbugs/bug263.go b/test/fixedbugs/bug263.go
index cab986ad5..f1cf9010d 100644
--- a/test/fixedbugs/bug263.go
+++ b/test/fixedbugs/bug263.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2010 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug264.go b/test/fixedbugs/bug264.go
index 6d86c6fe5..fcf373cce 100644
--- a/test/fixedbugs/bug264.go
+++ b/test/fixedbugs/bug264.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out || echo BUG
+// run
// Copyright 2010 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug265.go b/test/fixedbugs/bug265.go
index 55f32ecec..7f06fced6 100644
--- a/test/fixedbugs/bug265.go
+++ b/test/fixedbugs/bug265.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out || echo BUG
+// run
// Copyright 2010 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug266.go b/test/fixedbugs/bug266.go
index 25c246f7d..d4da891d3 100644
--- a/test/fixedbugs/bug266.go
+++ b/test/fixedbugs/bug266.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out || echo BUG: bug266
+// run
// Copyright 2010 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug267.go b/test/fixedbugs/bug267.go
index 9646142f2..cf8bf841f 100644
--- a/test/fixedbugs/bug267.go
+++ b/test/fixedbugs/bug267.go
@@ -1,10 +1,10 @@
-// $G $D/$F.go || echo BUG
+// compile
// Copyright 2010 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
-package main
+package bug267
type T []int
diff --git a/test/fixedbugs/bug268.go b/test/fixedbugs/bug268.go
deleted file mode 100644
index a38d0545b..000000000
--- a/test/fixedbugs/bug268.go
+++ /dev/null
@@ -1,53 +0,0 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
-
-// Copyright 2010 The Go Authors. All rights reserved.
-// Use of this source code is governed by a BSD-style
-// license that can be found in the LICENSE file.
-
-// http://code.google.com/p/go/issues/detail?id=745
-
-package main
-
-type T1 struct {
- T2 *T2
-}
-
-type T2 struct {
- T3 *T3
-}
-
-type T3 struct {
- T4 []*T4
-}
-
-type T4 struct {
- X int
-}
-
-func f() *T1 {
- x := &T1{
- &T2{
- &T3{
- [1]*T4{
- &T4{5},
- }[0:],
- },
- },
- }
- return x
-}
-
-func g(x int) {
- if x == 0 {
- return
- }
- g(x-1)
-}
-
-func main() {
- x := f()
- g(100) // smash temporaries left over on stack
- if x.T2.T3.T4[0].X != 5 {
- println("BUG", x.T2.T3.T4[0].X)
- }
-}
diff --git a/test/fixedbugs/bug269.go b/test/fixedbugs/bug269.go
index 4cc0408c3..c13eb26ce 100644
--- a/test/fixedbugs/bug269.go
+++ b/test/fixedbugs/bug269.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2010 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug270.go b/test/fixedbugs/bug270.go
deleted file mode 100644
index a9cda7bd7..000000000
--- a/test/fixedbugs/bug270.go
+++ /dev/null
@@ -1,21 +0,0 @@
-// $G $D/$F.go
-
-// Copyright 2010 The Go Authors. All rights reserved.
-// Use of this source code is governed by a BSD-style
-// license that can be found in the LICENSE file.
-
-// http://code.google.com/p/go/issues/detail?id=746
-
-package main
-
-type I interface { F() }
-
-type T struct{}
-
-func (T) F() {}
-
-func main() {
- switch I(T{}).(type) {
- case interface{}:
- }
-}
diff --git a/test/fixedbugs/bug271.go b/test/fixedbugs/bug271.go
index ba93d93ed..88add7040 100644
--- a/test/fixedbugs/bug271.go
+++ b/test/fixedbugs/bug271.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2010 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug272.go b/test/fixedbugs/bug272.go
index 3b7c46674..c27f7ee44 100644
--- a/test/fixedbugs/bug272.go
+++ b/test/fixedbugs/bug272.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2010 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug273.go b/test/fixedbugs/bug273.go
index dd5aaa7b8..b35b17d2e 100644
--- a/test/fixedbugs/bug273.go
+++ b/test/fixedbugs/bug273.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2010 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug274.go b/test/fixedbugs/bug274.go
index 198544c3f..beb2d61ac 100644
--- a/test/fixedbugs/bug274.go
+++ b/test/fixedbugs/bug274.go
@@ -1,4 +1,4 @@
-// errchk $G $D/$F.go
+// errorcheck
// Copyright 2010 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug275.go b/test/fixedbugs/bug275.go
index 2bbc807c5..f5f6b14f0 100644
--- a/test/fixedbugs/bug275.go
+++ b/test/fixedbugs/bug275.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go || echo BUG should compile
+// compile
// Copyright 2010 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug276.go b/test/fixedbugs/bug276.go
index 844a6b238..dc2308ea6 100644
--- a/test/fixedbugs/bug276.go
+++ b/test/fixedbugs/bug276.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out || echo BUG code should run
+// run
// Copyright 2010 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug277.go b/test/fixedbugs/bug277.go
index 22b2908c9..207556493 100644
--- a/test/fixedbugs/bug277.go
+++ b/test/fixedbugs/bug277.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go || echo BUG should compile
+// compile
// Copyright 2010 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug278.go b/test/fixedbugs/bug278.go
index 3699b9a14..68a3d811c 100644
--- a/test/fixedbugs/bug278.go
+++ b/test/fixedbugs/bug278.go
@@ -1,4 +1,4 @@
-// errchk $G $D/$F.go
+// errorcheck
// Copyright 2010 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug279.go b/test/fixedbugs/bug279.go
index af8e056d9..e5ec5943c 100644
--- a/test/fixedbugs/bug279.go
+++ b/test/fixedbugs/bug279.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2010 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug280.go b/test/fixedbugs/bug280.go
index 869d44626..ba594a2c4 100644
--- a/test/fixedbugs/bug280.go
+++ b/test/fixedbugs/bug280.go
@@ -1,4 +1,4 @@
-// errchk $G $D/$F.go
+// errorcheck
// Copyright 2010 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug281.go b/test/fixedbugs/bug281.go
index 821b02825..24d6fdce8 100644
--- a/test/fixedbugs/bug281.go
+++ b/test/fixedbugs/bug281.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2010 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug283.go b/test/fixedbugs/bug283.go
index 45ee9082f..eefed0334 100644
--- a/test/fixedbugs/bug283.go
+++ b/test/fixedbugs/bug283.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go || echo BUG: should compile
+// compile
// Copyright 2010 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
@@ -7,7 +7,7 @@
// http://code.google.com/p/go/issues/detail?id=806
// triggered out of registers on 8g
-package main
+package bug283
type Point struct {
x int
diff --git a/test/fixedbugs/bug284.go b/test/fixedbugs/bug284.go
index bcf161e3d..68208085f 100644
--- a/test/fixedbugs/bug284.go
+++ b/test/fixedbugs/bug284.go
@@ -1,4 +1,4 @@
-// errchk $G -e $D/$F.go
+// errorcheck
// Copyright 2010 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug285.go b/test/fixedbugs/bug285.go
index 544d3487e..0a8a0f09e 100644
--- a/test/fixedbugs/bug285.go
+++ b/test/fixedbugs/bug285.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out || echo BUG: bug285
+// run
// Copyright 2010 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
@@ -45,20 +45,6 @@ func main() {
mp[p] = 42
mp[&T{7}] = 42
- type F func(x int)
- f := func(x int) {}
- mf := make(map[F]int)
- mf[nil] = 42
- mf[f] = 42
- mf[func(x int) {}] = 42
-
- type M map[int]int
- m := make(M)
- mm := make(map[M]int)
- mm[nil] = 42
- mm[m] = 42
- mm[make(M)] = 42
-
type C chan int
c := make(C)
mc := make(map[C]int)
diff --git a/test/fixedbugs/bug286.go b/test/fixedbugs/bug286.go
index 94423be81..44f05153f 100644
--- a/test/fixedbugs/bug286.go
+++ b/test/fixedbugs/bug286.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out || echo BUG: bug286 failed
+// run
// Copyright 2010 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
@@ -12,16 +12,14 @@ type I interface {
f()
}
-
var callee string
-var error bool
+var error_ bool
type T int
func (t *T) f() { callee = "f" }
func (i *T) g() { callee = "g" }
-
// test1 and test2 are the same except that in the interface J
// the entries are swapped. test2 and test3 are the same except
// that in test3 the interface J is declared outside the function.
@@ -36,11 +34,10 @@ func test1(x I) {
x.(J).f()
if callee != "f" {
println("test1 called", callee)
- error = true
+ error_ = true
}
}
-
func test2(x I) {
type J interface {
g()
@@ -49,11 +46,10 @@ func test2(x I) {
x.(J).f()
if callee != "f" {
println("test2 called", callee)
- error = true
+ error_ = true
}
}
-
type J interface {
g()
I
@@ -63,7 +59,7 @@ func test3(x I) {
x.(J).f()
if callee != "f" {
println("test3 called", callee)
- error = true
+ error_ = true
}
}
@@ -72,7 +68,7 @@ func main() {
test1(x)
test2(x)
test3(x)
- if error {
+ if error_ {
panic("wrong method called")
}
}
diff --git a/test/fixedbugs/bug287.go b/test/fixedbugs/bug287.go
index a4a08eedc..2ed81c593 100644
--- a/test/fixedbugs/bug287.go
+++ b/test/fixedbugs/bug287.go
@@ -1,4 +1,4 @@
-// errchk $G $D/$F.go
+// errorcheck
// Copyright 2010 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug288.go b/test/fixedbugs/bug288.go
index 0105159d1..d2461e6a9 100644
--- a/test/fixedbugs/bug288.go
+++ b/test/fixedbugs/bug288.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go
+// compile
// Copyright 2010 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug289.go b/test/fixedbugs/bug289.go
index f7180ff04..3c6b68767 100644
--- a/test/fixedbugs/bug289.go
+++ b/test/fixedbugs/bug289.go
@@ -1,4 +1,4 @@
-// errchk $G $D/$F.go
+// errorcheck
// Copyright 2010 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug290.go b/test/fixedbugs/bug290.go
index 80437c7f8..c8ff0bc45 100644
--- a/test/fixedbugs/bug290.go
+++ b/test/fixedbugs/bug290.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2010 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug291.go b/test/fixedbugs/bug291.go
index 09334c921..17a5483ef 100644
--- a/test/fixedbugs/bug291.go
+++ b/test/fixedbugs/bug291.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2010 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug292.go b/test/fixedbugs/bug292.go
index 05852cd46..07051dd3f 100644
--- a/test/fixedbugs/bug292.go
+++ b/test/fixedbugs/bug292.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2010 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug293.go b/test/fixedbugs/bug293.go
index ca9b71a3a..bf926f5a4 100644
--- a/test/fixedbugs/bug293.go
+++ b/test/fixedbugs/bug293.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2010 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug294.go b/test/fixedbugs/bug294.go
index 18f45931c..0f3e38098 100644
--- a/test/fixedbugs/bug294.go
+++ b/test/fixedbugs/bug294.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2010 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug295.go b/test/fixedbugs/bug295.go
index fec2351f3..e2e5206ca 100644
--- a/test/fixedbugs/bug295.go
+++ b/test/fixedbugs/bug295.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2010 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug296.go b/test/fixedbugs/bug296.go
index 46d8dbcfe..a7c4e0c46 100644
--- a/test/fixedbugs/bug296.go
+++ b/test/fixedbugs/bug296.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2010 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug297.go b/test/fixedbugs/bug297.go
index 8767cdfea..b5dfa8d87 100644
--- a/test/fixedbugs/bug297.go
+++ b/test/fixedbugs/bug297.go
@@ -1,4 +1,4 @@
-// errchk $G $D/$F.go
+// errorcheck
// Copyright 2010 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug298.go b/test/fixedbugs/bug298.go
index c16c3f98a..bd362ace2 100644
--- a/test/fixedbugs/bug298.go
+++ b/test/fixedbugs/bug298.go
@@ -1,4 +1,4 @@
-// errchk $G $D/$F.go
+// errorcheck
// Copyright 2010 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug299.go b/test/fixedbugs/bug299.go
index 1c7adb5f5..9646723bf 100644
--- a/test/fixedbugs/bug299.go
+++ b/test/fixedbugs/bug299.go
@@ -1,4 +1,4 @@
-// errchk $G $D/$F.go
+// errorcheck
// Copyright 2010 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug300.go b/test/fixedbugs/bug300.go
index 09ee3ab69..1ef43a0ad 100644
--- a/test/fixedbugs/bug300.go
+++ b/test/fixedbugs/bug300.go
@@ -1,4 +1,4 @@
-// errchk $G $D/$F.go
+// errorcheck
// Copyright 2010 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug301.go b/test/fixedbugs/bug301.go
index a58f4e13b..572668f19 100644
--- a/test/fixedbugs/bug301.go
+++ b/test/fixedbugs/bug301.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go || echo BUG: bug301.go
+// compile
// Copyright 2010 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug302.go b/test/fixedbugs/bug302.go
index e9edb94ac..1088b2f3c 100644
--- a/test/fixedbugs/bug302.go
+++ b/test/fixedbugs/bug302.go
@@ -1,4 +1,4 @@
-// $G $D/bug302.dir/p.go && gopack grc pp.a p.$A && $G $D/bug302.dir/main.go
+// $G $D/bug302.dir/p.go && pack grc pp.a p.$A && $G $D/bug302.dir/main.go
// Copyright 2010 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug303.go b/test/fixedbugs/bug303.go
index 3bd790f13..94ca07e70 100644
--- a/test/fixedbugs/bug303.go
+++ b/test/fixedbugs/bug303.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2010 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug304.go b/test/fixedbugs/bug304.go
index adcf08a35..ad71b20f3 100644
--- a/test/fixedbugs/bug304.go
+++ b/test/fixedbugs/bug304.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go
+// compile
// Copyright 2010 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug305.go b/test/fixedbugs/bug305.go
index 758fee269..d0a4b24b8 100644
--- a/test/fixedbugs/bug305.go
+++ b/test/fixedbugs/bug305.go
@@ -1,4 +1,4 @@
-// errchk $G $D/$F.go
+// errorcheck
// Copyright 2010 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug307.go b/test/fixedbugs/bug307.go
index 1b42c09ab..644512529 100644
--- a/test/fixedbugs/bug307.go
+++ b/test/fixedbugs/bug307.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go
+// compile
// Copyright 2010 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug308.go b/test/fixedbugs/bug308.go
index c2845f042..5bea5175b 100644
--- a/test/fixedbugs/bug308.go
+++ b/test/fixedbugs/bug308.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go
+// compile
// Copyright 2010 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug309.go b/test/fixedbugs/bug309.go
index 07bebae74..948ca5c79 100644
--- a/test/fixedbugs/bug309.go
+++ b/test/fixedbugs/bug309.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go
+// compile
// Copyright 2010 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
@@ -6,7 +6,7 @@
// issue 1016
-package main
+package bug309
func foo(t interface{}, c chan int) {
switch v := t.(type) {
@@ -15,5 +15,7 @@ func foo(t interface{}, c chan int) {
case <-c:
// bug was: internal compiler error: var without type, init: v
}
+ default:
+ _ = v
}
}
diff --git a/test/fixedbugs/bug310.go b/test/fixedbugs/bug310.go
deleted file mode 100644
index 191f3ed2b..000000000
--- a/test/fixedbugs/bug310.go
+++ /dev/null
@@ -1,20 +0,0 @@
-// errchk $G $D/$F.go
-
-// Copyright 2010 The Go Authors. All rights reserved.
-// Use of this source code is governed by a BSD-style
-// license that can be found in the LICENSE file.
-
-package p
-
-import (
- "bytes"
- "fmt"
-)
-
-type t int
-
-func main() {
- _ = t.bar // ERROR "no method"
- var b bytes.Buffer
- fmt.Print(b) // ERROR "implicit assignment"
-}
diff --git a/test/fixedbugs/bug311.go b/test/fixedbugs/bug311.go
index ed937a674..edcd97596 100644
--- a/test/fixedbugs/bug311.go
+++ b/test/fixedbugs/bug311.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2010 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug312.go b/test/fixedbugs/bug312.go
index 70888dd41..c7c17e101 100644
--- a/test/fixedbugs/bug312.go
+++ b/test/fixedbugs/bug312.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2010 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug314.go b/test/fixedbugs/bug314.go
index 95d81d795..6e26d14e1 100644
--- a/test/fixedbugs/bug314.go
+++ b/test/fixedbugs/bug314.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out || echo BUG: bug314
+// run
// Copyright 2010 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug315.go b/test/fixedbugs/bug315.go
index c59ef29e6..7b8a9e570 100644
--- a/test/fixedbugs/bug315.go
+++ b/test/fixedbugs/bug315.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go || echo BUG: bug315
+// compile
// Copyright 2010 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug316.go b/test/fixedbugs/bug316.go
index 2146408a1..e1374122d 100644
--- a/test/fixedbugs/bug316.go
+++ b/test/fixedbugs/bug316.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go || echo BUG: bug316
+// compile
// Copyright 2010 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug317.go b/test/fixedbugs/bug317.go
index 0cb26c29b..3ff4dc465 100644
--- a/test/fixedbugs/bug317.go
+++ b/test/fixedbugs/bug317.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out || echo BUG: bug317
+// run
// Copyright 2011 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug318.go b/test/fixedbugs/bug318.go
index 9c46a0426..93de2d847 100644
--- a/test/fixedbugs/bug318.go
+++ b/test/fixedbugs/bug318.go
@@ -1,4 +1,4 @@
-// errchk $G $D/$F.go
+// errorcheck
// Copyright 2011 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug319.go b/test/fixedbugs/bug319.go
index f60eee4fb..f8e959a31 100644
--- a/test/fixedbugs/bug319.go
+++ b/test/fixedbugs/bug319.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go
+// compile
// Copyright 2011 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug320.go b/test/fixedbugs/bug320.go
index 06d41f2ed..c2dd31b81 100644
--- a/test/fixedbugs/bug320.go
+++ b/test/fixedbugs/bug320.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2011 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug321.go b/test/fixedbugs/bug321.go
index d0595ff59..7d018271f 100644
--- a/test/fixedbugs/bug321.go
+++ b/test/fixedbugs/bug321.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out || echo BUG: bug321
+// run
// Copyright 2011 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug323.go b/test/fixedbugs/bug323.go
index 23e2be660..9730ae5c8 100644
--- a/test/fixedbugs/bug323.go
+++ b/test/fixedbugs/bug323.go
@@ -1,4 +1,4 @@
-// errchk $G $D/$F.go
+// errorcheck
// Copyright 2011 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug325.go b/test/fixedbugs/bug325.go
index b86740fff..6ccd0e3c8 100644
--- a/test/fixedbugs/bug325.go
+++ b/test/fixedbugs/bug325.go
@@ -1,4 +1,4 @@
-// errchk $G $D/$F.go
+// errorcheck
// Copyright 2011 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug326.go b/test/fixedbugs/bug326.go
index efdd0ef71..57f6471dc 100644
--- a/test/fixedbugs/bug326.go
+++ b/test/fixedbugs/bug326.go
@@ -1,4 +1,4 @@
-// errchk $G $D/$F.go
+// errorcheck
// Copyright 2011 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
@@ -6,36 +6,34 @@
package p
-import "os"
-
-func f() (_ int, err os.Error) {
+func f() (_ int, err error) {
return
}
-func g() (x int, _ os.Error) {
+func g() (x int, _ error) {
return
}
-func h() (_ int, _ os.Error) {
+func h() (_ int, _ error) {
return
}
-func i() (int, os.Error) {
- return // ERROR "not enough arguments to return"
+func i() (int, error) {
+ return // ERROR "not enough arguments to return"
}
-func f1() (_ int, err os.Error) {
+func f1() (_ int, err error) {
return 1, nil
}
-func g1() (x int, _ os.Error) {
+func g1() (x int, _ error) {
return 1, nil
}
-func h1() (_ int, _ os.Error) {
+func h1() (_ int, _ error) {
return 1, nil
}
-func ii() (int, os.Error) {
+func ii() (int, error) {
return 1, nil
}
diff --git a/test/fixedbugs/bug327.go b/test/fixedbugs/bug327.go
index 4ba5f6072..0598d95d6 100644
--- a/test/fixedbugs/bug327.go
+++ b/test/fixedbugs/bug327.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2011 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug328.go b/test/fixedbugs/bug328.go
index 64041f412..73ab46d45 100644
--- a/test/fixedbugs/bug328.go
+++ b/test/fixedbugs/bug328.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// cmpout
// Copyright 2011 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug328.out b/test/fixedbugs/bug328.out
new file mode 100644
index 000000000..9982566dc
--- /dev/null
+++ b/test/fixedbugs/bug328.out
@@ -0,0 +1 @@
+0x0
diff --git a/test/fixedbugs/bug329.go b/test/fixedbugs/bug329.go
index 0b7074d62..74fc78198 100644
--- a/test/fixedbugs/bug329.go
+++ b/test/fixedbugs/bug329.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2011 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug330.go b/test/fixedbugs/bug330.go
index cf1d6cc2d..ef6a0777f 100644
--- a/test/fixedbugs/bug330.go
+++ b/test/fixedbugs/bug330.go
@@ -1,4 +1,4 @@
-// errchk $G -e $D/$F.go
+// errorcheck
// Copyright 2011 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
@@ -8,6 +8,6 @@ package main
func main() {
x := ""
- x = +"hello" // ERROR "invalid operation.*string"
- x = +x // ERROR "invalid operation.*string"
+ x = +"hello" // ERROR "invalid operation.*string|expected numeric"
+ x = +x // ERROR "invalid operation.*string|expected numeric"
}
diff --git a/test/fixedbugs/bug331.go b/test/fixedbugs/bug331.go
index 28aee1da0..fac0e3628 100644
--- a/test/fixedbugs/bug331.go
+++ b/test/fixedbugs/bug331.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out || echo BUG: bug331
+// run
// Copyright 2011 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
@@ -6,22 +6,22 @@
package main
-import "os"
+import "io"
-func f() (_ string, x float64, err os.Error) {
+func f() (_ string, x float64, err error) {
return
}
-func g() (_ string, x float64, err os.Error) {
- return "hello", 3.14, os.EOF
+func g() (_ string, x float64, err error) {
+ return "hello", 3.14, io.EOF
}
-var _ func() (string, float64, os.Error) = f
-var _ func() (string, float64, os.Error) = g
+var _ func() (string, float64, error) = f
+var _ func() (string, float64, error) = g
func main() {
x, y, z := g()
- if x != "hello" || y != 3.14 || z != os.EOF {
+ if x != "hello" || y != 3.14 || z != io.EOF {
println("wrong", x, len(x), y, z)
}
}
diff --git a/test/fixedbugs/bug332.go b/test/fixedbugs/bug332.go
index be79286b8..702779ba6 100644
--- a/test/fixedbugs/bug332.go
+++ b/test/fixedbugs/bug332.go
@@ -1,4 +1,4 @@
-// errchk $G $D/$F.go
+// errorcheck
// Copyright 2011 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug333.go b/test/fixedbugs/bug333.go
index 515c1f3fa..bb690f0e5 100644
--- a/test/fixedbugs/bug333.go
+++ b/test/fixedbugs/bug333.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2011 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug334.go b/test/fixedbugs/bug334.go
index 870c9ae24..bd671696b 100644
--- a/test/fixedbugs/bug334.go
+++ b/test/fixedbugs/bug334.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go || echo BUG: bug334
+// compile
// Copyright 2011 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug336.go b/test/fixedbugs/bug336.go
index 8de36898f..fbf23207c 100644
--- a/test/fixedbugs/bug336.go
+++ b/test/fixedbugs/bug336.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2011 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug337.go b/test/fixedbugs/bug337.go
index 62e310e72..38dc665fa 100644
--- a/test/fixedbugs/bug337.go
+++ b/test/fixedbugs/bug337.go
@@ -1,4 +1,4 @@
-// errchk $G $D/$F.go
+// errorcheck
// Copyright 2011 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
@@ -14,6 +14,6 @@
package main
func main() {
- len("foo") // ERROR "len"
+ len("foo") // ERROR "len|value computed is not used"
}
diff --git a/test/fixedbugs/bug338.go b/test/fixedbugs/bug338.go
index c368a7fad..c2193fcc2 100644
--- a/test/fixedbugs/bug338.go
+++ b/test/fixedbugs/bug338.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go
+// compile
// Copyright 2011 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug339.go b/test/fixedbugs/bug339.go
index eac7c5ee6..59921d41c 100644
--- a/test/fixedbugs/bug339.go
+++ b/test/fixedbugs/bug339.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2011 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug340.go b/test/fixedbugs/bug340.go
index 461cc6cd4..d996ab64c 100644
--- a/test/fixedbugs/bug340.go
+++ b/test/fixedbugs/bug340.go
@@ -1,4 +1,4 @@
-// errchk $G $D/$F.go
+// errorcheck
// Copyright 2011 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
@@ -10,8 +10,8 @@ package main
func main() {
var x interface{}
- switch t := x.(type) { // ERROR "0 is not a type"
- case 0:
- t.x = 1 // ERROR "type interface \{ \}"
+ switch t := x.(type) {
+ case 0: // ERROR "type"
+ t.x = 1 // ERROR "type interface \{\}|reference to undefined field or method"
}
}
diff --git a/test/fixedbugs/bug341.go b/test/fixedbugs/bug341.go
index 8ee52e1ef..db1af3eaa 100644
--- a/test/fixedbugs/bug341.go
+++ b/test/fixedbugs/bug341.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out || echo BUG: bug341
+// run
// Copyright 2011 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug342.go b/test/fixedbugs/bug342.go
index 0852cdd34..5f1efbdfe 100644
--- a/test/fixedbugs/bug342.go
+++ b/test/fixedbugs/bug342.go
@@ -1,4 +1,4 @@
-// errchk $G $D/$F.go
+// errorcheck
// Copyright 2011 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug343.go b/test/fixedbugs/bug343.go
index efc87e3d7..82201088b 100644
--- a/test/fixedbugs/bug343.go
+++ b/test/fixedbugs/bug343.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out || echo BUG: bug343
+// run
// Copyright 2011 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug344.go b/test/fixedbugs/bug344.go
index d217b3bd3..4a92624c7 100644
--- a/test/fixedbugs/bug344.go
+++ b/test/fixedbugs/bug344.go
@@ -1,4 +1,4 @@
-// errchk $G -e $D/$F.go
+// errorcheck
// Copyright 2011 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
@@ -14,10 +14,10 @@ func main() {
i := 42
a := []*int{&i, &i, &i, &i}
x := a[0]
- goto start // ERROR "goto start jumps into block"
+ goto start // ERROR "jumps into block"
z := 1
_ = z
- for _, x = range a {
+ for _, x = range a { // GCCGO_ERROR "block"
start:
fmt.Sprint(*x)
}
diff --git a/test/fixedbugs/bug345.dir/main.go b/test/fixedbugs/bug345.dir/main.go
index 5bdc713f4..ddba8dad4 100644
--- a/test/fixedbugs/bug345.dir/main.go
+++ b/test/fixedbugs/bug345.dir/main.go
@@ -22,7 +22,7 @@ func main() {
// main.go:27: cannot use &x (type *"io".SectionReader) as type *"/Users/rsc/g/go/test/fixedbugs/bug345.dir/io".SectionReader in function argument
var w io.Writer
- bufio.NewWriter(w) // ERROR "test/io"
+ bufio.NewWriter(w) // ERROR "test/io|has incompatible type"
var x goio.SectionReader
- io.SR(&x) // ERROR "test/io"
+ io.SR(&x) // ERROR "test/io|has incompatible type"
}
diff --git a/test/fixedbugs/bug346.go b/test/fixedbugs/bug346.go
index 31284c31a..d9203aa43 100644
--- a/test/fixedbugs/bug346.go
+++ b/test/fixedbugs/bug346.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out || echo BUG: issue2056
+// run
// Copyright 2011 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug347.go b/test/fixedbugs/bug347.go
index 5532cee83..08edf0f4f 100644
--- a/test/fixedbugs/bug347.go
+++ b/test/fixedbugs/bug347.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2011 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug348.go b/test/fixedbugs/bug348.go
index 1a539aa3e..54a289a8d 100644
--- a/test/fixedbugs/bug348.go
+++ b/test/fixedbugs/bug348.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2011 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug349.go b/test/fixedbugs/bug349.go
index 07005973e..a3e6bd161 100644
--- a/test/fixedbugs/bug349.go
+++ b/test/fixedbugs/bug349.go
@@ -1,4 +1,4 @@
-// errchk $G $D/$F.go
+// errorcheck
// Copyright 2011 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
@@ -9,5 +9,5 @@
package main
func foo() (a, b, c int) {
- return 0, 1 2.01 // ERROR "unexpected literal 2.01"
+ return 0, 1 2.01 // ERROR "unexpected literal 2.01|expected ';' or '}' or newline|not enough arguments to return"
}
diff --git a/test/fixedbugs/bug350.go b/test/fixedbugs/bug350.go
index aac294901..5ce8996ff 100644
--- a/test/fixedbugs/bug350.go
+++ b/test/fixedbugs/bug350.go
@@ -1,4 +1,4 @@
-// errchk $G $D/$F.go
+// errorcheck
// Copyright 2011 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
@@ -8,8 +8,8 @@ package main
type T int
-func (T) m() {}
-func (T) m() {} // ERROR "T[.]m redeclared"
+func (T) m() {} // GCCGO_ERROR "previous"
+func (T) m() {} // ERROR "T[.]m redeclared|redefinition"
-func (*T) p() {}
-func (*T) p() {} // ERROR "[(][*]T[)][.]p redeclared"
+func (*T) p() {} // GCCGO_ERROR "previous"
+func (*T) p() {} // ERROR "[(][*]T[)][.]p redeclared|redefinition"
diff --git a/test/fixedbugs/bug351.go b/test/fixedbugs/bug351.go
index 2f631bbbb..4c5c7c327 100644
--- a/test/fixedbugs/bug351.go
+++ b/test/fixedbugs/bug351.go
@@ -1,4 +1,4 @@
-// errchk $G $D/$F.go
+// errorcheck
// Copyright 2011 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
@@ -9,5 +9,5 @@ package main
var x int
func main() {
- (x) := 0 // ERROR "non-name [(]x[)]"
+ (x) := 0 // ERROR "non-name [(]x[)]|non-name on left side"
}
diff --git a/test/fixedbugs/bug352.go b/test/fixedbugs/bug352.go
index 62fd006c4..1ae2d6139 100644
--- a/test/fixedbugs/bug352.go
+++ b/test/fixedbugs/bug352.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out || echo BUG: bug352
+// run
// Copyright 2011 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug353.go b/test/fixedbugs/bug353.go
index 46f5c36cb..2a532c491 100644
--- a/test/fixedbugs/bug353.go
+++ b/test/fixedbugs/bug353.go
@@ -1,4 +1,4 @@
-// errchk $G $D/$F.go
+// errorcheck
// Copyright 2011 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
@@ -13,7 +13,7 @@ import (
"os"
)
-func echo(fd io.ReadWriterCloser) { // ERROR "undefined: io.ReadWriterCloser"
+func echo(fd io.ReadWriterCloser) { // ERROR "undefined.*io.ReadWriterCloser"
var buf [1024]byte
for {
n, err := fd.Read(buf)
diff --git a/test/fixedbugs/bug354.go b/test/fixedbugs/bug354.go
index 1f6a6dc9f..1245d91f5 100644
--- a/test/fixedbugs/bug354.go
+++ b/test/fixedbugs/bug354.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go || echo BUG: bug354
+// compile
// Copyright 2011 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
@@ -7,14 +7,10 @@
// issue 2086
// was calling makeclosure twice on the closure
-package main
-
-import (
- "os"
-)
+package bug354
type Inner struct {
- F func() os.Error
+ F func() error
}
type Outer struct {
@@ -23,4 +19,4 @@ type Outer struct {
// calls makeclosure twice on same closure
-var Foo = Outer{[]Inner{Inner{func() os.Error{ return nil }}}}
+var Foo = Outer{[]Inner{Inner{func() error { return nil }}}}
diff --git a/test/fixedbugs/bug355.go b/test/fixedbugs/bug355.go
index a9cf0161b..fcf859b7f 100644
--- a/test/fixedbugs/bug355.go
+++ b/test/fixedbugs/bug355.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2011 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug356.go b/test/fixedbugs/bug356.go
index d21f0cfac..273c5b8ef 100644
--- a/test/fixedbugs/bug356.go
+++ b/test/fixedbugs/bug356.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out || echo BUG: bug344
+// run
// Copyright 2011 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug357.go b/test/fixedbugs/bug357.go
index 2220398d0..2ac64a80b 100644
--- a/test/fixedbugs/bug357.go
+++ b/test/fixedbugs/bug357.go
@@ -1,4 +1,4 @@
-// errchk $G $D/$F.go
+// errorcheck
// Copyright 2011 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
@@ -15,8 +15,9 @@ func bla1() bool {
func bla5() bool {
_ = 1
- false // ERROR "false not used"
+ false // ERROR "false not used|value computed is not used"
_ = 2
+ return false
}
func main() {
diff --git a/test/fixedbugs/bug358.go b/test/fixedbugs/bug358.go
index cc622c047..6a008484f 100644
--- a/test/fixedbugs/bug358.go
+++ b/test/fixedbugs/bug358.go
@@ -1,4 +1,4 @@
-// errchk $G $D/$F.go
+// errorcheck
// Copyright 2011 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
@@ -10,13 +10,13 @@
package main
import (
- "http"
- "io/ioutil"
+ "io/ioutil" // GCCGO_ERROR "imported and not used"
+ "net/http"
"os"
)
func makeHandler(fn func(http.ResponseWriter, *http.Request, string)) http.HandlerFunc {
- return func(w http.ResponseWriter, r *http.Request) // ERROR "syntax error"
+ return func(w http.ResponseWriter, r *http.Request) // ERROR "syntax error|invalid use of type"
}
type Page struct {
diff --git a/test/fixedbugs/bug359.go b/test/fixedbugs/bug359.go
deleted file mode 100644
index 7f34672f1..000000000
--- a/test/fixedbugs/bug359.go
+++ /dev/null
@@ -1,26 +0,0 @@
-// errchk $G $D/$F.go
-
-// Copyright 2011 The Go Authors. All rights reserved.
-// Use of this source code is governed by a BSD-style
-// license that can be found in the LICENSE file.
-
-// issue 1910
-// error on wrong line
-
-package main
-
-import "container/list"
-
-type Painting struct {
- fragments list.List // private
-}
-
-func (p Painting) Foo() {
- for e := p.fragments; e.Front() != nil; { // ERROR "unexported field"
- }
-}
-
-// from comment 4 of issue 1910
-type Foo interface {
- Run(a int) (a int) // ERROR "a redeclared"
-}
diff --git a/test/fixedbugs/bug361.go b/test/fixedbugs/bug361.go
index d2a64bcef..3e3b7c181 100644
--- a/test/fixedbugs/bug361.go
+++ b/test/fixedbugs/bug361.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go || echo BUG: bug360
+// compile
// Copyright 2011 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/fixedbugs/bug362.go b/test/fixedbugs/bug362.go
index 791209103..b888ccb44 100644
--- a/test/fixedbugs/bug362.go
+++ b/test/fixedbugs/bug362.go
@@ -1,4 +1,4 @@
-// errchk $G $D/$F.go
+// errorcheck
// Copyright 2011 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
@@ -10,7 +10,7 @@
package main
var (
- a = iota // ERROR "undefined: iota"
- b = iota // ERROR "undefined: iota"
- c = iota // ERROR "undefined: iota"
+ a = iota // ERROR "undefined: iota|iota is only defined in const"
+ b = iota // ERROR "undefined: iota|iota is only defined in const"
+ c = iota // ERROR "undefined: iota|iota is only defined in const"
)
diff --git a/test/fixedbugs/bug363.go b/test/fixedbugs/bug363.go
index 7e89749a0..615c66865 100644
--- a/test/fixedbugs/bug363.go
+++ b/test/fixedbugs/bug363.go
@@ -1,4 +1,4 @@
-// errchk $G $D/$F.go
+// errorcheck
// Copyright 2011 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
@@ -10,12 +10,12 @@ package main
func main() {
var i uint = 33
- var a = (1<<i) + 4.5 // ERROR "shift of type float64"
+ var a = (1<<i) + 4.5 // ERROR "shift of type float64|invalid.*shift"
println(a)
- var b = (1<<i) + 4.0 // ERROR "shift of type float64"
+ var b = (1<<i) + 4.0 // ERROR "shift of type float64|invalid.*shift"
println(b)
var c int64 = (1<<i) + 4.0 // ok - it's all int64
- println(b)
+ println(c)
}
diff --git a/test/fixedbugs/bug364.go b/test/fixedbugs/bug364.go
index a17453419..64120d164 100644
--- a/test/fixedbugs/bug364.go
+++ b/test/fixedbugs/bug364.go
@@ -1,3 +1,9 @@
+// run
+
+// Copyright 2011 The Go Authors. All rights reserved.
+// Use of this source code is governed by a BSD-style
+// license that can be found in the LICENSE file.
+
package main
import "fmt"
diff --git a/test/fixedbugs/bug365.go b/test/fixedbugs/bug365.go
index 7ec19b0c8..795323bb3 100644
--- a/test/fixedbugs/bug365.go
+++ b/test/fixedbugs/bug365.go
@@ -1,4 +1,4 @@
-// errchk $G $D/$F.go
+// errorcheck
// Copyright 2011 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
@@ -12,11 +12,11 @@
package main
type S struct {
- err os.Error // ERROR "undefined"
+ err foo.Bar // ERROR "undefined|expected package"
Num int
}
func main() {
s := S{}
- _ = s.Num // no error here please
+ _ = s.Num // no error here please
}
diff --git a/test/fixedbugs/bug366.go b/test/fixedbugs/bug366.go
new file mode 100644
index 000000000..33a1a5a7e
--- /dev/null
+++ b/test/fixedbugs/bug366.go
@@ -0,0 +1,37 @@
+// run
+
+// Copyright 2011 The Go Authors. All rights reserved.
+// Use of this source code is governed by a BSD-style
+// license that can be found in the LICENSE file.
+
+// Issue 2206. Incorrect sign extension of div arguments.
+
+package main
+
+func five(x int64) {
+ if x != 5 {
+ panic(x)
+ }
+}
+
+func main() {
+ // 5
+ five(int64(5 / (5 / 3)))
+
+ // 5
+ five(int64(byte(5) / (byte(5) / byte(3))))
+
+ // 5
+ var a, b byte = 5, 3
+ five(int64(a / (a / b)))
+
+ // integer divide by zero in golang.org sandbox
+ // 0 on windows/amd64
+ x := [3]byte{2, 3, 5}
+ five(int64(x[2] / (x[2] / x[1])))
+
+ // integer divide by zero in golang.org sandbox
+ // crash on windows/amd64
+ y := x[1:3]
+ five(int64(y[1] / (y[1] / y[0])))
+} \ No newline at end of file
diff --git a/test/fixedbugs/bug367.dir/main.go b/test/fixedbugs/bug367.dir/main.go
new file mode 100644
index 000000000..c278e4dd9
--- /dev/null
+++ b/test/fixedbugs/bug367.dir/main.go
@@ -0,0 +1,28 @@
+// Copyright 2011 The Go Authors. All rights reserved.
+// Use of this source code is governed by a BSD-style
+// license that can be found in the LICENSE file
+
+package main
+
+import (
+ "./p"
+)
+
+type T struct{ *p.S }
+type I interface {
+ get()
+}
+
+func main() {
+ var t T
+ p.F(t)
+ var x interface{} = t
+ _, ok := x.(I)
+ if ok {
+ panic("should not satisfy main.I")
+ }
+ _, ok = x.(p.I)
+ if !ok {
+ panic("should satisfy p.I")
+ }
+}
diff --git a/test/fixedbugs/bug367.dir/p.go b/test/fixedbugs/bug367.dir/p.go
new file mode 100644
index 000000000..2028f740c
--- /dev/null
+++ b/test/fixedbugs/bug367.dir/p.go
@@ -0,0 +1,19 @@
+// Copyright 2011 The Go Authors. All rights reserved.
+// Use of this source code is governed by a BSD-style
+// license that can be found in the LICENSE file
+
+package p
+
+type T struct{ x int }
+type S struct{}
+
+func (p *S) get() {
+}
+
+type I interface {
+ get()
+}
+
+func F(i I) {
+ i.get()
+}
diff --git a/test/fixedbugs/bug367.go b/test/fixedbugs/bug367.go
new file mode 100644
index 000000000..25d11a153
--- /dev/null
+++ b/test/fixedbugs/bug367.go
@@ -0,0 +1,7 @@
+// $G $D/$F.dir/p.go && $G $D/$F.dir/main.go && $L main.$A && ./$A.out || echo BUG: should not fail
+
+// Copyright 2011 The Go Authors. All rights reserved.
+// Use of this source code is governed by a BSD-style
+// license that can be found in the LICENSE file.
+
+package ignored
diff --git a/test/fixedbugs/bug368.go b/test/fixedbugs/bug368.go
new file mode 100644
index 000000000..c38cc7fad
--- /dev/null
+++ b/test/fixedbugs/bug368.go
@@ -0,0 +1,26 @@
+// run
+
+// Copyright 2011 The Go Authors. All rights reserved.
+// Use of this source code is governed by a BSD-style
+// license that can be found in the LICENSE file.
+
+package main
+
+// 5g bug used to set up the 0 for -f() before calling f,
+// and the call to f smashed the register.
+
+func f(n int) int {
+ s := 0
+ for i := 0; i < n; i++ {
+ s += i>>1
+ }
+ return s
+}
+
+func main() {
+ x := -f(100)
+ if x != -2450 {
+ println(x)
+ panic("broken")
+ }
+}
diff --git a/test/fixedbugs/bug369.dir/pkg.go b/test/fixedbugs/bug369.dir/pkg.go
new file mode 100644
index 000000000..cf5704192
--- /dev/null
+++ b/test/fixedbugs/bug369.dir/pkg.go
@@ -0,0 +1,15 @@
+// Copyright 2011 The Go Authors. All rights reserved.
+// Use of this source code is governed by a BSD-style
+// license that can be found in the LICENSE file.
+
+package pkg
+
+func NonASCII(b []byte, i int) int {
+ for i = 0; i < len(b); i++ {
+ if b[i] >= 0x80 {
+ break
+ }
+ }
+ return i
+}
+
diff --git a/test/fixedbugs/bug369.go b/test/fixedbugs/bug369.go
new file mode 100644
index 000000000..4d98e8508
--- /dev/null
+++ b/test/fixedbugs/bug369.go
@@ -0,0 +1,59 @@
+// $G -N -o slow.$A $D/bug369.dir/pkg.go &&
+// $G -o fast.$A $D/bug369.dir/pkg.go &&
+// run
+
+// Copyright 2011 The Go Authors. All rights reserved.
+// Use of this source code is governed by a BSD-style
+// license that can be found in the LICENSE file.
+
+// Test that compiling with optimization turned on produces faster code.
+
+package main
+
+import (
+ "flag"
+ "os"
+ "runtime"
+ "testing"
+
+ fast "./fast"
+ slow "./slow"
+)
+
+var buf = make([]byte, 1048576)
+
+func BenchmarkFastNonASCII(b *testing.B) {
+ for i := 0; i < b.N; i++ {
+ fast.NonASCII(buf, 0)
+ }
+}
+
+func BenchmarkSlowNonASCII(b *testing.B) {
+ for i := 0; i < b.N; i++ {
+ slow.NonASCII(buf, 0)
+ }
+}
+
+func main() {
+ os.Args = []string{os.Args[0], "-test.benchtime=0.1"}
+ flag.Parse()
+
+ rslow := testing.Benchmark(BenchmarkSlowNonASCII)
+ rfast := testing.Benchmark(BenchmarkFastNonASCII)
+ tslow := rslow.NsPerOp()
+ tfast := rfast.NsPerOp()
+
+ // Optimization should be good for at least 2x, but be forgiving.
+ // On the ARM simulator we see closer to 1.5x.
+ speedup := float64(tslow)/float64(tfast)
+ want := 1.8
+ if runtime.GOARCH == "arm" {
+ want = 1.3
+ }
+ if speedup < want {
+ // TODO(rsc): doesn't work on linux-amd64 or darwin-amd64 builders, nor on
+ // a Lenovo x200 (linux-amd64) laptop.
+ //println("fast:", tfast, "slow:", tslow, "speedup:", speedup, "want:", want)
+ //println("not fast enough")
+ }
+}
diff --git a/test/fixedbugs/bug370.go b/test/fixedbugs/bug370.go
new file mode 100644
index 000000000..246bc7c4e
--- /dev/null
+++ b/test/fixedbugs/bug370.go
@@ -0,0 +1,18 @@
+// run
+
+// Copyright 2011 The Go Authors. All rights reserved.
+// Use of this source code is governed by a BSD-style
+// license that can be found in the LICENSE file.
+
+package main
+
+// issue 2337
+// The program deadlocked.
+
+import "runtime"
+
+func main() {
+ runtime.GOMAXPROCS(2)
+ runtime.GC()
+ runtime.GOMAXPROCS(1)
+}
diff --git a/test/fixedbugs/bug371.go b/test/fixedbugs/bug371.go
new file mode 100644
index 000000000..6329e9635
--- /dev/null
+++ b/test/fixedbugs/bug371.go
@@ -0,0 +1,24 @@
+// errorcheck
+
+// Copyright 2011 The Go Authors. All rights reserved.
+// Use of this source code is governed by a BSD-style
+// license that can be found in the LICENSE file.
+
+// issue 2343
+
+package main
+
+type T struct {}
+
+func (t *T) pm() {}
+func (t T) m() {}
+
+func main() {
+ p := &T{}
+ p.pm()
+ p.m()
+
+ q := &p
+ q.m() // ERROR "requires explicit dereference"
+ q.pm()
+}
diff --git a/test/fixedbugs/bug372.go b/test/fixedbugs/bug372.go
new file mode 100644
index 000000000..34578565a
--- /dev/null
+++ b/test/fixedbugs/bug372.go
@@ -0,0 +1,28 @@
+// run
+
+// Copyright 2011 The Go Authors. All rights reserved.
+// Use of this source code is governed by a BSD-style
+// license that can be found in the LICENSE file.
+
+// Issue 2355
+package main
+
+type T struct {}
+func (T) m() string { return "T" }
+
+type TT struct {
+ T
+ m func() string
+}
+
+
+func ff() string { return "ff" }
+
+func main() {
+ var tt TT
+ tt.m = ff
+
+ if tt.m() != "ff" {
+ println(tt.m(), "!= \"ff\"")
+ }
+}
diff --git a/test/fixedbugs/bug373.go b/test/fixedbugs/bug373.go
new file mode 100644
index 000000000..e91f26d6e
--- /dev/null
+++ b/test/fixedbugs/bug373.go
@@ -0,0 +1,32 @@
+// errorcheck
+
+// Copyright 2011 The Go Authors. All rights reserved.
+// Use of this source code is governed by a BSD-style
+// license that can be found in the LICENSE file.
+
+// Issue 873, 2162
+
+package foo
+
+func f(x interface{}) {
+ switch t := x.(type) { // ERROR "declared and not used"
+ case int:
+ }
+}
+
+func g(x interface{}) {
+ switch t := x.(type) {
+ case int:
+ case float32:
+ println(t)
+ }
+}
+
+func h(x interface{}) {
+ switch t := x.(type) {
+ case int:
+ case float32:
+ default:
+ println(t)
+ }
+}
diff --git a/test/fixedbugs/bug374.go b/test/fixedbugs/bug374.go
new file mode 100644
index 000000000..4f0b721f2
--- /dev/null
+++ b/test/fixedbugs/bug374.go
@@ -0,0 +1,20 @@
+// errorcheck
+
+// Copyright 2011 The Go Authors. All rights reserved.
+// Use of this source code is governed by a BSD-style
+// license that can be found in the LICENSE file.
+
+// issue 1556
+package foo
+
+type I interface {
+ m() int
+}
+
+type T int
+
+var _ I = T(0) // GCCGO_ERROR "incompatible"
+
+func (T) m(buf []byte) (a int, b xxxx) { // ERROR "xxxx"
+ return 0, nil
+}
diff --git a/test/fixedbugs/bug375.go b/test/fixedbugs/bug375.go
new file mode 100644
index 000000000..cb159b0d6
--- /dev/null
+++ b/test/fixedbugs/bug375.go
@@ -0,0 +1,19 @@
+// run
+
+// Copyright 2011 The Go Authors. All rights reserved.
+// Use of this source code is governed by a BSD-style
+// license that can be found in the LICENSE file.
+
+// Issue 2423
+
+package main
+
+func main() {
+ var x interface{} = "hello"
+
+ switch x {
+ case "hello":
+ default:
+ println("FAIL")
+ }
+}
diff --git a/test/fixedbugs/bug376.go b/test/fixedbugs/bug376.go
new file mode 100644
index 000000000..5fbbc9cd4
--- /dev/null
+++ b/test/fixedbugs/bug376.go
@@ -0,0 +1,11 @@
+// errorcheck
+
+// Copyright 2011 The Go Authors. All rights reserved.
+// Use of this source code is governed by a BSD-style
+// license that can be found in the LICENSE file.
+
+// issue 1951
+package foo
+import "unsafe"
+var v = unsafe.Sizeof // ERROR "must be called"
+
diff --git a/test/fixedbugs/bug377.dir/one.go b/test/fixedbugs/bug377.dir/one.go
new file mode 100644
index 000000000..e29b813a4
--- /dev/null
+++ b/test/fixedbugs/bug377.dir/one.go
@@ -0,0 +1,10 @@
+// Copyright 2011 The Go Authors. All rights reserved.
+// Use of this source code is governed by a BSD-style
+// license that can be found in the LICENSE file
+
+package one
+
+func Foo() (n int64, _ *int) {
+ return 42, nil
+}
+
diff --git a/test/fixedbugs/bug377.dir/two.go b/test/fixedbugs/bug377.dir/two.go
new file mode 100644
index 000000000..2a10812d5
--- /dev/null
+++ b/test/fixedbugs/bug377.dir/two.go
@@ -0,0 +1,8 @@
+// Copyright 2011 The Go Authors. All rights reserved.
+// Use of this source code is governed by a BSD-style
+// license that can be found in the LICENSE file
+
+package two
+
+import _ "./one"
+
diff --git a/test/fixedbugs/bug377.go b/test/fixedbugs/bug377.go
new file mode 100644
index 000000000..e905e34d6
--- /dev/null
+++ b/test/fixedbugs/bug377.go
@@ -0,0 +1,9 @@
+// $G $D/$F.dir/one.go && $G $D/$F.dir/two.go
+
+// Copyright 2011 The Go Authors. All rights reserved.
+// Use of this source code is governed by a BSD-style
+// license that can be found in the LICENSE file.
+
+// Issue 1802
+
+package ignored
diff --git a/test/fixedbugs/bug378.go b/test/fixedbugs/bug378.go
new file mode 100644
index 000000000..f3346c648
--- /dev/null
+++ b/test/fixedbugs/bug378.go
@@ -0,0 +1,19 @@
+// run
+
+// Copyright 2011 The Go Authors. All rights reserved.
+// Use of this source code is governed by a BSD-style
+// license that can be found in the LICENSE file.
+
+// Issue 2497
+
+package main
+
+type Header struct{}
+func (h Header) Method() {}
+
+var _ interface{} = Header{}
+
+func main() {
+ type X Header
+ var _ interface{} = X{}
+}
diff --git a/test/fixedbugs/bug379.go b/test/fixedbugs/bug379.go
new file mode 100644
index 000000000..81e9c266e
--- /dev/null
+++ b/test/fixedbugs/bug379.go
@@ -0,0 +1,18 @@
+// errorcheck
+
+// Copyright 2011 The Go Authors. All rights reserved.
+// Use of this source code is governed by a BSD-style
+// license that can be found in the LICENSE file.
+
+// Issue 2452.
+
+// Check that the error messages says
+// bug378.go:17: 1 + 2 not used
+// and not
+// bug378.go:17: 1 not used
+
+package main
+
+func main() {
+ 1 + 2 // ERROR "1 \+ 2 not used|value computed is not used"
+}
diff --git a/test/fixedbugs/bug380.go b/test/fixedbugs/bug380.go
new file mode 100644
index 000000000..96e1edeca
--- /dev/null
+++ b/test/fixedbugs/bug380.go
@@ -0,0 +1,11 @@
+// compile
+
+// Copyright 2011 The Go Authors. All rights reserved.
+// Use of this source code is governed by a BSD-style
+// license that can be found in the LICENSE file.
+
+// Used to cause a typechecking loop error.
+
+package pkg
+type T map[int]string
+var q = &T{}
diff --git a/test/fixedbugs/bug381.go b/test/fixedbugs/bug381.go
new file mode 100644
index 000000000..0253e1446
--- /dev/null
+++ b/test/fixedbugs/bug381.go
@@ -0,0 +1,31 @@
+// errorcheck
+
+// Copyright 2011 The Go Authors. All rights reserved.
+// Use of this source code is governed by a BSD-style
+// license that can be found in the LICENSE file.
+
+// Issue 2276.
+
+// Check that the error messages says
+// bug381.go:29: unsafe.Alignof(0) not used
+// and not
+// bug381.go:29: 4 not used
+
+// Issue 2768: previously got
+// bug381.go:30: cannot use 3 (type time.Weekday) as type int in function argument
+// want
+// bug381.go:30: cannot use time.Wednesday (type time.Weekday) as type int in function argument
+
+package main
+
+import (
+ "time"
+ "unsafe"
+)
+
+func f(int)
+
+func main() {
+ unsafe.Alignof(0) // ERROR "unsafe\.Alignof|value computed is not used"
+ f(time.Wednesday) // ERROR "time.Wednesday|incompatible type"
+}
diff --git a/test/fixedbugs/bug382.dir/pkg.go b/test/fixedbugs/bug382.dir/pkg.go
new file mode 100644
index 000000000..f8d75d454
--- /dev/null
+++ b/test/fixedbugs/bug382.dir/pkg.go
@@ -0,0 +1,7 @@
+// Copyright 2011 The Go Authors. All rights reserved.
+// Use of this source code is governed by a BSD-style
+// license that can be found in the LICENSE file.
+
+package pkg
+type T struct {}
+var E T
diff --git a/test/fixedbugs/bug382.go b/test/fixedbugs/bug382.go
new file mode 100644
index 000000000..3f5d05cd5
--- /dev/null
+++ b/test/fixedbugs/bug382.go
@@ -0,0 +1,14 @@
+// $G $D/$F.dir/pkg.go && $G $D/$F.go || echo "Bug 382"
+
+// Copyright 2011 The Go Authors. All rights reserved.
+// Use of this source code is governed by a BSD-style
+// license that can be found in the LICENSE file
+
+// Issue 2529
+
+package main
+import "./pkg"
+
+var x = pkg.E
+
+var fo = struct {F pkg.T}{F: x}
diff --git a/test/fixedbugs/bug383.go b/test/fixedbugs/bug383.go
new file mode 100644
index 000000000..503779c37
--- /dev/null
+++ b/test/fixedbugs/bug383.go
@@ -0,0 +1,13 @@
+// errorcheck
+
+// Copyright 2011 The Go Authors. All rights reserved.
+// Use of this source code is governed by a BSD-style
+// license that can be found in the LICENSE file.
+
+// Issue 2520
+
+package main
+func main() {
+ if 2e9 { } // ERROR "2e.09|expected bool"
+ if 3.14+1i { } // ERROR "3.14 . 1i|expected bool"
+}
diff --git a/test/fixedbugs/bug384.go b/test/fixedbugs/bug384.go
new file mode 100644
index 000000000..0233c197c
--- /dev/null
+++ b/test/fixedbugs/bug384.go
@@ -0,0 +1,12 @@
+// errorcheck
+
+// Copyright 2011 The Go Authors. All rights reserved.
+// Use of this source code is governed by a BSD-style
+// license that can be found in the LICENSE file.
+
+// Issue 2500
+
+package foo
+
+// Check that we only get root cause message, no further complaints about r undefined
+func (r *indexWriter) foo() {} // ERROR "undefined.*indexWriter"
diff --git a/test/fixedbugs/bug385_32.go b/test/fixedbugs/bug385_32.go
new file mode 100644
index 000000000..b9ecbb4c1
--- /dev/null
+++ b/test/fixedbugs/bug385_32.go
@@ -0,0 +1,14 @@
+// [ $A == 6 ] || errchk $G -e $D/$F.go
+
+// Copyright 2011 The Go Authors. All rights reserved.
+// Use of this source code is governed by a BSD-style
+// license that can be found in the LICENSE file.
+
+// Issue 2444
+
+package main
+func main() {
+ var arr [1000200030]int // ERROR "type .* too large"
+ arr_bkup := arr
+ _ = arr_bkup
+} \ No newline at end of file
diff --git a/test/fixedbugs/bug385_64.go b/test/fixedbugs/bug385_64.go
new file mode 100644
index 000000000..7476b17d5
--- /dev/null
+++ b/test/fixedbugs/bug385_64.go
@@ -0,0 +1,15 @@
+// [ $A != 6 ] || errchk $G -e $D/$F.go
+
+// Copyright 2011 The Go Authors. All rights reserved.
+// Use of this source code is governed by a BSD-style
+// license that can be found in the LICENSE file.
+
+// Issue 2444
+
+package main
+func main() { // ERROR "stack frame too large"
+ var arr [1000200030]int
+ arr_bkup := arr
+ _ = arr_bkup
+}
+
diff --git a/test/fixedbugs/bug386.go b/test/fixedbugs/bug386.go
new file mode 100644
index 000000000..ec358bd36
--- /dev/null
+++ b/test/fixedbugs/bug386.go
@@ -0,0 +1,12 @@
+// errorcheck
+
+// Copyright 2011 The Go Authors. All rights reserved.
+// Use of this source code is governed by a BSD-style
+// license that can be found in the LICENSE file.
+
+// Issue 2451, 2452
+package foo
+
+func f() error { return 0 } // ERROR "cannot use 0 .type int.|has no methods"
+
+func g() error { return -1 } // ERROR "cannot use -1 .type int.|has no methods"
diff --git a/test/fixedbugs/bug387.go b/test/fixedbugs/bug387.go
new file mode 100644
index 000000000..59d5ef903
--- /dev/null
+++ b/test/fixedbugs/bug387.go
@@ -0,0 +1,30 @@
+// compile
+
+// Copyright 2011 The Go Authors. All rights reserved.
+// Use of this source code is governed by a BSD-style
+// license that can be found in the LICENSE file.
+
+// Issue 2549
+
+/* Used to die with
+missing typecheck: [7f5bf07b4438]
+
+. AS l(45)
+. . NAME-main.autotmp_0017 u(1) a(1) l(45) x(0+0) class(PAUTO)
+esc(N) tc(1) used(1) ARRAY-[2]string
+internal compiler error: missing typecheck
+*/
+package main
+
+import (
+ "fmt"
+ "path/filepath"
+)
+
+func main() {
+ switch _, err := filepath.Glob(filepath.Join(".", "vnc")); {
+ case err != nil:
+ fmt.Println(err)
+ }
+}
+
diff --git a/test/fixedbugs/bug388.go b/test/fixedbugs/bug388.go
new file mode 100644
index 000000000..d41f9ea54
--- /dev/null
+++ b/test/fixedbugs/bug388.go
@@ -0,0 +1,39 @@
+// errorcheck
+
+// Copyright 2011 The Go Authors. All rights reserved.
+// Use of this source code is governed by a BSD-style
+// license that can be found in the LICENSE file.
+
+// Issue 2231
+
+package main
+import "runtime"
+
+func foo(runtime.UintType, i int) { // ERROR "cannot declare name runtime.UintType|named/anonymous mix|undefined identifier"
+ println(i, runtime.UintType) // GCCGO_ERROR "undefined identifier"
+}
+
+func bar(i int) {
+ runtime.UintType := i // ERROR "cannot declare name runtime.UintType|non-name on left side|undefined identifier"
+ println(runtime.UintType) // GCCGO_ERROR "invalid use of type|undefined identifier"
+}
+
+func baz() {
+ main.i := 1 // ERROR "non-name main.i|non-name on left side"
+ println(main.i) // GCCGO_ERROR "no fields or methods"
+}
+
+func qux() {
+ var main.i // ERROR "unexpected [.]|expected type"
+ println(main.i)
+}
+
+func corge() {
+ var foo.i int // ERROR "unexpected [.]|expected type"
+ println(foo.i)
+}
+
+func main() {
+ foo(42,43)
+ bar(1969)
+}
diff --git a/test/fixedbugs/bug389.go b/test/fixedbugs/bug389.go
new file mode 100644
index 000000000..55a02e05c
--- /dev/null
+++ b/test/fixedbugs/bug389.go
@@ -0,0 +1,12 @@
+// errorcheck
+
+// Copyright 2011 The Go Authors. All rights reserved.
+// Use of this source code is governed by a BSD-style
+// license that can be found in the LICENSE file.
+
+// Issue 2563
+package foo
+
+func fn(a float32) {}
+
+var f func(arg int) = fn // ERROR "cannot use fn .type func.float32.. as type func.int. in assignment|different parameter types"
diff --git a/test/fixedbugs/bug390.go b/test/fixedbugs/bug390.go
new file mode 100644
index 000000000..7ce9e1370
--- /dev/null
+++ b/test/fixedbugs/bug390.go
@@ -0,0 +1,16 @@
+// errorcheck
+
+// Copyright 2011 The Go Authors. All rights reserved.
+// Use of this source code is governed by a BSD-style
+// license that can be found in the LICENSE file.
+
+// Issue 2627 -- unsafe.Pointer type isn't handled nicely in some errors
+
+package main
+
+import "unsafe"
+
+func main() {
+ var x *int
+ _ = unsafe.Pointer(x) - unsafe.Pointer(x) // ERROR "operator - not defined on unsafe.Pointer|expected integer, floating, or complex type"
+}
diff --git a/test/fixedbugs/bug391.go b/test/fixedbugs/bug391.go
new file mode 100644
index 000000000..07d129ddc
--- /dev/null
+++ b/test/fixedbugs/bug391.go
@@ -0,0 +1,14 @@
+// compile
+
+// Copyright 2011 The Go Authors. All rights reserved.
+// Use of this source code is governed by a BSD-style
+// license that can be found in the LICENSE file.
+
+// Issue 2576
+package bug
+
+type T struct { a int }
+
+func f(t T) {
+ switch _, _ = t.a, t.a; {}
+} \ No newline at end of file
diff --git a/test/fixedbugs/bug392.dir/one.go b/test/fixedbugs/bug392.dir/one.go
new file mode 100644
index 000000000..8242f2846
--- /dev/null
+++ b/test/fixedbugs/bug392.dir/one.go
@@ -0,0 +1,43 @@
+// Copyright 2012 The Go Authors. All rights reserved.
+// Use of this source code is governed by a BSD-style
+// license that can be found in the LICENSE file.
+
+// Functions that the inliner exported incorrectly.
+
+package one
+
+type T int
+
+// Issue 2678
+func F1(T *T) bool { return T == nil }
+
+// Issue 2682.
+func F2(c chan int) bool { return c == (<-chan int)(nil) }
+
+// Use of single named return value.
+func F3() (ret []int) { return append(ret, 1) }
+
+// Call of inlined method with blank receiver.
+func (_ *T) M() int { return 1 }
+func (t *T) MM() int { return t.M() }
+
+
+// One more like issue 2678
+type S struct { x, y int }
+type U []S
+
+func F4(S int) U { return U{{S,S}} }
+
+func F5() []*S {
+ return []*S{ {1,2}, { 3, 4} }
+}
+
+func F6(S int) *U {
+ return &U{{S,S}}
+}
+
+// Bug in the fix.
+
+type PB struct { x int }
+
+func (t *PB) Reset() { *t = PB{} }
diff --git a/test/fixedbugs/bug392.dir/three.go b/test/fixedbugs/bug392.dir/three.go
new file mode 100644
index 000000000..a6193bf91
--- /dev/null
+++ b/test/fixedbugs/bug392.dir/three.go
@@ -0,0 +1,13 @@
+// Copyright 2012 The Go Authors. All rights reserved.
+// Use of this source code is governed by a BSD-style
+// license that can be found in the LICENSE file.
+
+// Use the functions in one.go so that the inlined
+// forms get type-checked.
+
+package three
+
+import "./two"
+
+var x = two.F()
+var v = two.V
diff --git a/test/fixedbugs/bug392.dir/two.go b/test/fixedbugs/bug392.dir/two.go
new file mode 100644
index 000000000..a9033dbb0
--- /dev/null
+++ b/test/fixedbugs/bug392.dir/two.go
@@ -0,0 +1,25 @@
+// Copyright 2012 The Go Authors. All rights reserved.
+// Use of this source code is governed by a BSD-style
+// license that can be found in the LICENSE file.
+
+// Use the functions in one.go so that the inlined
+// forms get type-checked.
+
+package two
+
+import "./one"
+
+func use() {
+ one.F1(nil)
+ one.F2(nil)
+ one.F3()
+ one.F4(1)
+
+ var t *one.T
+ t.M()
+ t.MM()
+}
+
+var V = []one.PB{{}, {}}
+
+func F() *one.PB
diff --git a/test/fixedbugs/bug392.go b/test/fixedbugs/bug392.go
new file mode 100644
index 000000000..a7a4216c4
--- /dev/null
+++ b/test/fixedbugs/bug392.go
@@ -0,0 +1,7 @@
+// $G $D/$F.dir/one.go && $G $D/$F.dir/two.go && $G $D/$F.dir/three.go
+
+// Copyright 2011 The Go Authors. All rights reserved.
+// Use of this source code is governed by a BSD-style
+// license that can be found in the LICENSE file.
+
+package ignored
diff --git a/test/fixedbugs/bug393.go b/test/fixedbugs/bug393.go
new file mode 100644
index 000000000..f8a9c6578
--- /dev/null
+++ b/test/fixedbugs/bug393.go
@@ -0,0 +1,30 @@
+// compile
+
+// Copyright 2012 The Go Authors. All rights reserved.
+// Use of this source code is governed by a BSD-style
+// license that can be found in the LICENSE file.
+
+// issue 2672
+// was trying binary search with an interface type
+
+package bug393
+
+func f(x interface{}) int {
+ switch x {
+ case 1:
+ return 1
+ case 2:
+ return 2
+ case 3:
+ return 3
+ case 4:
+ return 4
+ case "5":
+ return 5
+ case "6":
+ return 6
+ default:
+ return 7
+ }
+ panic("switch")
+}
diff --git a/test/fixedbugs/bug394.go b/test/fixedbugs/bug394.go
new file mode 100644
index 000000000..2d77156c1
--- /dev/null
+++ b/test/fixedbugs/bug394.go
@@ -0,0 +1,10 @@
+// errorcheck
+
+// Copyright 2011 The Go Authors. All rights reserved.
+// Use of this source code is governed by a BSD-style
+// license that can be found in the LICENSE file.
+
+// Issue 2598
+package foo
+
+return nil // ERROR "non-declaration statement outside function body|expected declaration"
diff --git a/test/fixedbugs/bug396.dir/one.go b/test/fixedbugs/bug396.dir/one.go
new file mode 100644
index 000000000..7902a07d5
--- /dev/null
+++ b/test/fixedbugs/bug396.dir/one.go
@@ -0,0 +1,9 @@
+// Copyright 2012 The Go Authors. All rights reserved.
+// Use of this source code is governed by a BSD-style
+// license that can be found in the LICENSE file.
+
+package one
+
+type T struct { int }
+
+func New(i int) T { return T{i} }
diff --git a/test/fixedbugs/bug396.dir/two.go b/test/fixedbugs/bug396.dir/two.go
new file mode 100644
index 000000000..9b32508fd
--- /dev/null
+++ b/test/fixedbugs/bug396.dir/two.go
@@ -0,0 +1,14 @@
+// Copyright 2012 The Go Authors. All rights reserved.
+// Use of this source code is governed by a BSD-style
+// license that can be found in the LICENSE file.
+
+// Use the functions in one.go so that the inlined
+// forms get type-checked.
+
+package two
+
+import "./one"
+
+func use() {
+ _ = one.New(1)
+} \ No newline at end of file
diff --git a/test/fixedbugs/bug396.go b/test/fixedbugs/bug396.go
new file mode 100644
index 000000000..50af6006f
--- /dev/null
+++ b/test/fixedbugs/bug396.go
@@ -0,0 +1,7 @@
+// $G $D/$F.dir/one.go && $G $D/$F.dir/two.go
+
+// Copyright 2011 The Go Authors. All rights reserved.
+// Use of this source code is governed by a BSD-style
+// license that can be found in the LICENSE file.
+
+package ignored
diff --git a/test/fixedbugs/bug397.go b/test/fixedbugs/bug397.go
new file mode 100644
index 000000000..56cc7cdd4
--- /dev/null
+++ b/test/fixedbugs/bug397.go
@@ -0,0 +1,13 @@
+// errorcheck
+
+// Copyright 2011 The Go Authors. All rights reserved.
+// Use of this source code is governed by a BSD-style
+// license that can be found in the LICENSE file.
+
+package main
+
+// Issue 2623
+var m = map[string]int {
+ "abc":1,
+ 1:2, // ERROR "cannot use 1.*as type string in map key|incompatible type"
+}
diff --git a/test/fixedbugs/bug398.go b/test/fixedbugs/bug398.go
new file mode 100644
index 000000000..1dd3fa421
--- /dev/null
+++ b/test/fixedbugs/bug398.go
@@ -0,0 +1,24 @@
+// compile
+
+// Copyright 2012 The Go Authors. All rights reserved.
+// Use of this source code is governed by a BSD-style
+// license that can be found in the LICENSE file.
+
+// Used to crash compiler in interface type equality check.
+
+package p
+
+type I1 interface {
+ F() interface{I1}
+}
+
+type I2 interface {
+ F() interface{I2}
+}
+
+var v1 I1
+var v2 I2
+
+func f() bool {
+ return v1 == v2
+}
diff --git a/test/fixedbugs/bug399.go b/test/fixedbugs/bug399.go
new file mode 100644
index 000000000..94852c9ee
--- /dev/null
+++ b/test/fixedbugs/bug399.go
@@ -0,0 +1,15 @@
+// compile
+
+// Copyright 2011 The Go Authors. All rights reserved.
+// Use of this source code is governed by a BSD-style
+// license that can be found in the LICENSE file.
+
+// Issue 2674
+
+package main
+const dow = "\000\003"
+
+func main() {
+ println(int(dow[1]))
+}
+
diff --git a/test/fixedbugs/bug401.go b/test/fixedbugs/bug401.go
new file mode 100644
index 000000000..5589b5b1b
--- /dev/null
+++ b/test/fixedbugs/bug401.go
@@ -0,0 +1,46 @@
+// run
+
+// Copyright 2011 The Go Authors. All rights reserved.
+// Use of this source code is governed by a BSD-style
+// license that can be found in the LICENSE file.
+
+// Issue 2582
+package main
+
+type T struct{}
+
+func (T) cplx() complex128 {
+ for false {
+ } // avoid inlining
+ return complex(1, 0)
+}
+
+func (T) cplx2() complex128 {
+ return complex(0, 1)
+}
+
+type I interface {
+ cplx() complex128
+}
+
+func main() {
+
+ var t T
+
+ if v := real(t.cplx()); v != 1 {
+ panic("not-inlined complex call failed")
+ }
+ _ = imag(t.cplx())
+
+ _ = real(t.cplx2())
+ if v := imag(t.cplx2()); v != 1 {
+ panic("potentially inlined complex call failed")
+ }
+
+ var i I
+ i = t
+ if v := real(i.cplx()); v != 1 {
+ panic("potentially inlined complex call failed")
+ }
+ _ = imag(i.cplx())
+}
diff --git a/test/fixedbugs/bug402.go b/test/fixedbugs/bug402.go
new file mode 100644
index 000000000..db3f3da44
--- /dev/null
+++ b/test/fixedbugs/bug402.go
@@ -0,0 +1,31 @@
+// run
+
+// Copyright 2012 The Go Authors. All rights reserved.
+// Use of this source code is governed by a BSD-style
+// license that can be found in the LICENSE file.
+
+package main
+
+import "fmt"
+
+var a = []int64{
+ 0.0005 * 1e9,
+ 0.001 * 1e9,
+ 0.005 * 1e9,
+ 0.01 * 1e9,
+ 0.05 * 1e9,
+ 0.1 * 1e9,
+ 0.5 * 1e9,
+ 1 * 1e9,
+ 5 * 1e9,
+}
+
+func main() {
+ s := ""
+ for _, v := range a {
+ s += fmt.Sprint(v) + " "
+ }
+ if s != "500000 1000000 5000000 10000000 50000000 100000000 500000000 1000000000 5000000000 " {
+ panic(s)
+ }
+}
diff --git a/test/fixedbugs/bug403.go b/test/fixedbugs/bug403.go
new file mode 100644
index 000000000..ed7b49aea
--- /dev/null
+++ b/test/fixedbugs/bug403.go
@@ -0,0 +1,23 @@
+// compile
+
+// Copyright 2012 The Go Authors. All rights reserved.
+// Use of this source code is governed by a BSD-style
+// license that can be found in the LICENSE file.
+
+// Crashed gccgo.
+
+package p
+
+type S struct {
+ f interface{}
+}
+
+func F(p *S) bool {
+ v := p.f
+ switch a := v.(type) {
+ case nil:
+ _ = a
+ return true
+ }
+ return true
+}
diff --git a/test/fixedbugs/bug404.dir/one.go b/test/fixedbugs/bug404.dir/one.go
new file mode 100644
index 000000000..2024eb007
--- /dev/null
+++ b/test/fixedbugs/bug404.dir/one.go
@@ -0,0 +1,19 @@
+// Copyright 2012 The Go Authors. All rights reserved.
+// Use of this source code is governed by a BSD-style
+// license that can be found in the LICENSE file.
+
+package one
+
+type T1 int
+type T2 []T1
+type T3 T2
+
+func F1(T2) {
+}
+
+func (p *T1) M1() T3 {
+ return nil
+}
+
+func (p T3) M2() {
+}
diff --git a/test/fixedbugs/bug404.dir/two.go b/test/fixedbugs/bug404.dir/two.go
new file mode 100644
index 000000000..162eae712
--- /dev/null
+++ b/test/fixedbugs/bug404.dir/two.go
@@ -0,0 +1,12 @@
+// Copyright 2012 The Go Authors. All rights reserved.
+// Use of this source code is governed by a BSD-style
+// license that can be found in the LICENSE file.
+
+// The gccgo compiler would fail on the import statement.
+// two.go:10:13: error: use of undefined type ‘one.T2’
+
+package two
+
+import "./one"
+
+var V one.T3
diff --git a/test/fixedbugs/bug404.go b/test/fixedbugs/bug404.go
new file mode 100644
index 000000000..ac9e575bb
--- /dev/null
+++ b/test/fixedbugs/bug404.go
@@ -0,0 +1,7 @@
+// $G $D/$F.dir/one.go && $G $D/$F.dir/two.go
+
+// Copyright 2012 The Go Authors. All rights reserved.
+// Use of this source code is governed by a BSD-style
+// license that can be found in the LICENSE file.
+
+package ignored
diff --git a/test/fixedbugs/bug405.go b/test/fixedbugs/bug405.go
new file mode 100644
index 000000000..e8ecc4d03
--- /dev/null
+++ b/test/fixedbugs/bug405.go
@@ -0,0 +1,24 @@
+// run
+
+// Copyright 2012 The Go Authors. All rights reserved.
+// Use of this source code is governed by a BSD-style
+// license that can be found in the LICENSE file.
+
+// Test using _ receiver. Failed with gccgo.
+
+package main
+
+type S struct {}
+
+func (_ S) F(i int) int {
+ return i
+}
+
+func main() {
+ s := S{}
+ const c = 123
+ i := s.F(c)
+ if i != c {
+ panic(i)
+ }
+}
diff --git a/test/fixedbugs/bug406.go b/test/fixedbugs/bug406.go
new file mode 100644
index 000000000..c6f8534c9
--- /dev/null
+++ b/test/fixedbugs/bug406.go
@@ -0,0 +1,25 @@
+// run
+
+// Copyright 2012 The Go Authors. All rights reserved.
+// Use of this source code is governed by a BSD-style
+// license that can be found in the LICENSE file.
+
+// Issue 2821
+package main
+
+type matrix struct {
+ e []int
+}
+
+func (a matrix) equal() bool {
+ for _ = range a.e {
+ }
+ return true
+}
+
+func main() {
+ var a matrix
+ var i interface{}
+ i = true && a.equal()
+ _ = i
+}
diff --git a/test/fixedbugs/bug407.dir/one.go b/test/fixedbugs/bug407.dir/one.go
new file mode 100644
index 000000000..a91d90433
--- /dev/null
+++ b/test/fixedbugs/bug407.dir/one.go
@@ -0,0 +1,20 @@
+// Copyright 2012 The Go Authors. All rights reserved.
+// Use of this source code is governed by a BSD-style
+// license that can be found in the LICENSE file.
+
+package one
+
+// Issue 2877
+type T struct {
+ f func(t *T, arg int)
+ g func(t T, arg int)
+}
+
+func (t *T) foo(arg int) {}
+func (t T) goo(arg int) {}
+
+func (t *T) F() { t.f = (*T).foo }
+func (t *T) G() { t.g = T.goo }
+
+
+
diff --git a/test/fixedbugs/bug407.dir/two.go b/test/fixedbugs/bug407.dir/two.go
new file mode 100644
index 000000000..67e1852ea
--- /dev/null
+++ b/test/fixedbugs/bug407.dir/two.go
@@ -0,0 +1,15 @@
+// Copyright 2012 The Go Authors. All rights reserved.
+// Use of this source code is governed by a BSD-style
+// license that can be found in the LICENSE file.
+
+// Use the functions in one.go so that the inlined
+// forms get type-checked.
+
+package two
+
+import "./one"
+
+func use() {
+ var r one.T
+ r.F()
+}
diff --git a/test/fixedbugs/bug407.go b/test/fixedbugs/bug407.go
new file mode 100644
index 000000000..50af6006f
--- /dev/null
+++ b/test/fixedbugs/bug407.go
@@ -0,0 +1,7 @@
+// $G $D/$F.dir/one.go && $G $D/$F.dir/two.go
+
+// Copyright 2011 The Go Authors. All rights reserved.
+// Use of this source code is governed by a BSD-style
+// license that can be found in the LICENSE file.
+
+package ignored
diff --git a/test/fixedbugs/bug409.go b/test/fixedbugs/bug409.go
new file mode 100644
index 000000000..1dca43b7a
--- /dev/null
+++ b/test/fixedbugs/bug409.go
@@ -0,0 +1,20 @@
+// cmpout
+
+// Copyright 2012 The Go Authors. All rights reserved.
+// Use of this source code is governed by a BSD-style
+// license that can be found in the LICENSE file.
+
+// Multiple inlined calls to a function that causes
+// redundant address loads.
+
+package main
+
+func F(v [2]float64) [2]float64 {
+ return [2]float64{v[0], v[1]}
+}
+
+func main() {
+ a := F([2]float64{1, 2})
+ b := F([2]float64{3, 4})
+ println(a[0], a[1], b[0], b[1])
+}
diff --git a/test/fixedbugs/bug409.out b/test/fixedbugs/bug409.out
new file mode 100644
index 000000000..3cb40ed59
--- /dev/null
+++ b/test/fixedbugs/bug409.out
@@ -0,0 +1 @@
++1.000000e+000 +2.000000e+000 +3.000000e+000 +4.000000e+000
diff --git a/test/fixedbugs/bug410.go b/test/fixedbugs/bug410.go
new file mode 100644
index 000000000..35ecbfc05
--- /dev/null
+++ b/test/fixedbugs/bug410.go
@@ -0,0 +1,24 @@
+// compile
+
+// Copyright 2012 The Go Authors. All rights reserved.
+// Use of this source code is governed by a BSD-style
+// license that can be found in the LICENSE file.
+
+// Used to run 6g out of registers. Issue 2669.
+
+package p
+
+type y struct {
+ num int
+}
+
+func zzz () {
+ k := make([]byte, 10)
+ arr := make ([]*y, 0)
+ for s := range arr {
+ x := make([]byte, 10)
+ for i := 0; i < 100 ; i++ {
+ x[i] ^= k[i-arr[s].num%0]
+ }
+ }
+}
diff --git a/test/fixedbugs/bug411.go b/test/fixedbugs/bug411.go
new file mode 100644
index 000000000..3b90db88d
--- /dev/null
+++ b/test/fixedbugs/bug411.go
@@ -0,0 +1,19 @@
+// compile
+
+// Copyright 2012 The Go Authors. All rights reserved.
+// Use of this source code is governed by a BSD-style
+// license that can be found in the LICENSE file.
+
+// Issue 2588. Used to trigger internal compiler error on 8g,
+// because the compiler tried to registerize the int64 being
+// used as a memory operand of a int64->float64 move.
+
+package p
+
+func f1(a int64) {
+ f2(float64(a), float64(a))
+}
+
+func f2(a,b float64) {
+}
+
diff --git a/test/fixedbugs/bug412.go b/test/fixedbugs/bug412.go
new file mode 100644
index 000000000..9148b68e7
--- /dev/null
+++ b/test/fixedbugs/bug412.go
@@ -0,0 +1,16 @@
+// errorcheck
+
+// Copyright 2012 The Go Authors. All rights reserved.
+// Use of this source code is governed by a BSD-style
+// license that can be found in the LICENSE file.
+
+package p
+
+type t struct {
+ x int // ERROR "duplicate field x"
+ x int
+}
+
+func f(t *t) int {
+ return t.x // ERROR "ambiguous selector t.x"
+}
diff --git a/test/fixedbugs/bug413.go b/test/fixedbugs/bug413.go
new file mode 100644
index 000000000..41270d906
--- /dev/null
+++ b/test/fixedbugs/bug413.go
@@ -0,0 +1,11 @@
+// errorcheck
+
+// Copyright 2012 The Go Authors. All rights reserved.
+// Use of this source code is governed by a BSD-style
+// license that can be found in the LICENSE file.
+
+package p
+
+func f(i int) int { return i }
+
+var i = func() int {a := f(i); return a}() // ERROR "initialization loop" \ No newline at end of file
diff --git a/test/fixedbugs/bug414.dir/main.go b/test/fixedbugs/bug414.dir/main.go
new file mode 100644
index 000000000..52001233c
--- /dev/null
+++ b/test/fixedbugs/bug414.dir/main.go
@@ -0,0 +1,18 @@
+// Copyright 2012 The Go Authors. All rights reserved.
+// Use of this source code is governed by a BSD-style
+// license that can be found in the LICENSE file.
+
+ package main
+
+ import "./p1"
+
+ type MyObject struct {
+ p1.Fer
+ }
+
+ func main() {
+ var b p1.Fer = &p1.Object{}
+ p1.PrintFer(b)
+ var c p1.Fer = &MyObject{b}
+ p1.PrintFer(c)
+ }
diff --git a/test/fixedbugs/bug414.dir/p1.go b/test/fixedbugs/bug414.dir/p1.go
new file mode 100644
index 000000000..7768818bf
--- /dev/null
+++ b/test/fixedbugs/bug414.dir/p1.go
@@ -0,0 +1,21 @@
+// Copyright 2012 The Go Authors. All rights reserved.
+// Use of this source code is governed by a BSD-style
+// license that can be found in the LICENSE file.
+
+ package p1
+
+ import "fmt"
+
+ type Fer interface {
+ f() string
+ }
+
+ type Object struct {}
+
+ func (this *Object) f() string {
+ return "Object.f"
+ }
+
+ func PrintFer(fer Fer) {
+ fmt.Sprintln(fer.f())
+ }
diff --git a/test/fixedbugs/bug414.go b/test/fixedbugs/bug414.go
new file mode 100644
index 000000000..8824b1a1e
--- /dev/null
+++ b/test/fixedbugs/bug414.go
@@ -0,0 +1,7 @@
+// $G $D/$F.dir/p1.go && $G $D/$F.dir/main.go && $L main.$A && ./$A.out
+
+// Copyright 2012 The Go Authors. All rights reserved.
+// Use of this source code is governed by a BSD-style
+// license that can be found in the LICENSE file.
+
+package ignored
diff --git a/test/fixedbugs/bug415.dir/main.go b/test/fixedbugs/bug415.dir/main.go
new file mode 100644
index 000000000..b894453fc
--- /dev/null
+++ b/test/fixedbugs/bug415.dir/main.go
@@ -0,0 +1,9 @@
+// Copyright 2012 The Go Authors. All rights reserved.
+// Use of this source code is governed by a BSD-style
+// license that can be found in the LICENSE file.
+
+package main
+import "./p"
+func main() {}
+var _ p.A
+
diff --git a/test/fixedbugs/bug415.dir/p.go b/test/fixedbugs/bug415.dir/p.go
new file mode 100644
index 000000000..b4152d63a
--- /dev/null
+++ b/test/fixedbugs/bug415.dir/p.go
@@ -0,0 +1,14 @@
+// Copyright 2012 The Go Authors. All rights reserved.
+// Use of this source code is governed by a BSD-style
+// license that can be found in the LICENSE file.
+
+package p
+
+type A struct {
+ s struct{int}
+}
+
+func (a *A) f() {
+ a.s = struct{int}{0}
+}
+
diff --git a/test/fixedbugs/bug415.go b/test/fixedbugs/bug415.go
new file mode 100644
index 000000000..fbf034218
--- /dev/null
+++ b/test/fixedbugs/bug415.go
@@ -0,0 +1,9 @@
+// $G $D/$F.dir/p.go && $G $D/$F.dir/main.go
+
+// Copyright 2012 The Go Authors. All rights reserved.
+// Use of this source code is governed by a BSD-style
+// license that can be found in the LICENSE file.
+
+// Issue 2716. Export metadata error made main.go not compile.
+
+package ignored
diff --git a/test/fixedbugs/bug416.go b/test/fixedbugs/bug416.go
new file mode 100644
index 000000000..c12853842
--- /dev/null
+++ b/test/fixedbugs/bug416.go
@@ -0,0 +1,13 @@
+// errorcheck
+
+// Copyright 2012 The Go Authors. All rights reserved.
+// Use of this source code is governed by a BSD-style
+// license that can be found in the LICENSE file.
+
+package p
+
+type T struct {
+ X int
+}
+
+func (t *T) X() {} // ERROR "type T has both field and method named X"
diff --git a/test/fixedbugs/bug417.go b/test/fixedbugs/bug417.go
new file mode 100644
index 000000000..a9acb4238
--- /dev/null
+++ b/test/fixedbugs/bug417.go
@@ -0,0 +1,32 @@
+// compile
+
+// Copyright 2009 The Go Authors. All rights reserved.
+// Use of this source code is governed by a BSD-style
+// license that can be found in the LICENSE file.
+
+// Some indirect uses of types crashed gccgo, because it assumed that
+// the size of the type was known before it had been computed.
+
+package p
+
+type S1 struct {
+ p *[1]S3
+ s [][1]S3
+ m map[int][1]S3
+ c chan [1]S3
+ i interface { f([1]S3) [1]S3 }
+ f func([1]S3) [1]S3
+}
+
+type S2 struct {
+ p *struct { F S3 }
+ s []struct { F S3 }
+ m map[int]struct { F S3 }
+ c chan struct { F S3 }
+ i interface { f(struct { F S3 }) struct { F S3 } }
+ f func(struct { F S3 } ) struct { F S3 }
+}
+
+type S3 struct {
+ I int
+}
diff --git a/test/fixedbugs/bug418.go b/test/fixedbugs/bug418.go
new file mode 100644
index 000000000..64d86b340
--- /dev/null
+++ b/test/fixedbugs/bug418.go
@@ -0,0 +1,22 @@
+// errorcheck
+
+// Copyright 2012 The Go Authors. All rights reserved.
+// Use of this source code is governed by a BSD-style
+// license that can be found in the LICENSE file.
+
+// Issue 3044.
+// Multiple valued expressions in return lists.
+
+package p
+
+func Two() (a, b int)
+
+// F used to compile.
+func F() (x interface{}, y int) {
+ return Two(), 0 // ERROR "single-value context"
+}
+
+// Recursive used to trigger an internal compiler error.
+func Recursive() (x interface{}, y int) {
+ return Recursive(), 0 // ERROR "single-value context"
+}
diff --git a/test/fixedbugs/bug419.go b/test/fixedbugs/bug419.go
new file mode 100644
index 000000000..cfab404eb
--- /dev/null
+++ b/test/fixedbugs/bug419.go
@@ -0,0 +1,17 @@
+// compile
+
+// Copyright 2012 The Go Authors. All rights reserved.
+// Use of this source code is governed by a BSD-style
+// license that can be found in the LICENSE file.
+
+// Issue 1811.
+// gccgo failed to compile this.
+
+package p
+
+type E interface{}
+
+type I interface {
+ E
+ E
+}
diff --git a/test/fixedbugs/bug420.go b/test/fixedbugs/bug420.go
new file mode 100644
index 000000000..02b4349d8
--- /dev/null
+++ b/test/fixedbugs/bug420.go
@@ -0,0 +1,14 @@
+// compile
+
+// Copyright 2012 The Go Authors. All rights reserved.
+// Use of this source code is governed by a BSD-style
+// license that can be found in the LICENSE file.
+
+// Issue 1757.
+// gccgo failed to compile this.
+
+package main
+
+func main() {
+ (_) = 0
+}
diff --git a/test/fixedbugs/bug421.go b/test/fixedbugs/bug421.go
new file mode 100644
index 000000000..1fe02375a
--- /dev/null
+++ b/test/fixedbugs/bug421.go
@@ -0,0 +1,17 @@
+// errorcheck
+
+// Copyright 2012 The Go Authors. All rights reserved.
+// Use of this source code is governed by a BSD-style
+// license that can be found in the LICENSE file.
+
+// Issue 1927.
+// gccgo failed to issue the first error below.
+
+package main
+
+func main() {
+ println(int(1) == uint(1)) // ERROR "types"
+ var x int = 1
+ var y uint = 1
+ println(x == y) // ERROR "types"
+}
diff --git a/test/fixedbugs/bug422.go b/test/fixedbugs/bug422.go
new file mode 100644
index 000000000..6865fe4b6
--- /dev/null
+++ b/test/fixedbugs/bug422.go
@@ -0,0 +1,11 @@
+// compile
+
+// Copyright 2012 The Go Authors. All rights reserved.
+// Use of this source code is governed by a BSD-style
+// license that can be found in the LICENSE file.
+
+// gccgo crashed compiling this file.
+
+package p
+
+var V = "a" > "b"
diff --git a/test/fixedbugs/bug423.go b/test/fixedbugs/bug423.go
new file mode 100644
index 000000000..726891245
--- /dev/null
+++ b/test/fixedbugs/bug423.go
@@ -0,0 +1,277 @@
+// run
+
+// Copyright 2012 The Go Authors. All rights reserved.
+// Use of this source code is governed by a BSD-style
+// license that can be found in the LICENSE file.
+
+// gc used to overflow a counter when a variable was
+// mentioned 256 times, and generate stack corruption.
+
+package main
+
+func main() {
+ F(1)
+}
+
+func F(arg int) {
+ var X interface{}
+ _ = X // used once
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0 // used 32 times
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0 // used 64 times
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0 // used 96 times
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0 // used 128 times
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0 // used 200 times
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0
+ X = 0 // used 256 times
+ if arg != 1 {
+ panic("argument was changed")
+ }
+}
diff --git a/test/fixedbugs/bug424.dir/lib.go b/test/fixedbugs/bug424.dir/lib.go
new file mode 100644
index 000000000..97054da3a
--- /dev/null
+++ b/test/fixedbugs/bug424.dir/lib.go
@@ -0,0 +1,16 @@
+// Copyright 2012 The Go Authors. All rights reserved.
+// Use of this source code is governed by a BSD-style
+// license that can be found in the LICENSE file.
+
+package lib
+
+type I interface {
+ m() string
+}
+
+type T struct{}
+
+// m is not accessible from outside this package.
+func (t *T) m() string {
+ return "lib.T.m"
+}
diff --git a/test/fixedbugs/bug424.go b/test/fixedbugs/bug424.go
new file mode 100644
index 000000000..42cff54d4
--- /dev/null
+++ b/test/fixedbugs/bug424.go
@@ -0,0 +1,99 @@
+// $G $D/$F.dir/lib.go && $G $D/$F.go && $L $F.$A && ./$A.out
+
+// Copyright 2012 The Go Authors. All rights reserved.
+// Use of this source code is governed by a BSD-style
+// license that can be found in the LICENSE file.
+
+// Tests that method calls through an interface always
+// call the locally defined method localT.m independent
+// at which embedding level it is and in which order
+// embedding is done.
+
+package main
+
+import "./lib"
+import "reflect"
+import "fmt"
+
+type localI interface {
+ m() string
+}
+
+type localT struct{}
+
+func (t *localT) m() string {
+ return "main.localT.m"
+}
+
+type myT1 struct {
+ localT
+}
+
+type myT2 struct {
+ localT
+ lib.T
+}
+
+type myT3 struct {
+ lib.T
+ localT
+}
+
+func main() {
+ var i localI
+
+ i = new(localT)
+ if i.m() != "main.localT.m" {
+ println("BUG: localT:", i.m(), "called")
+ }
+
+ i = new(myT1)
+ if i.m() != "main.localT.m" {
+ println("BUG: myT1:", i.m(), "called")
+ }
+
+ i = new(myT2)
+ if i.m() != "main.localT.m" {
+ println("BUG: myT2:", i.m(), "called")
+ }
+
+ t3 := new(myT3)
+ if t3.m() != "main.localT.m" {
+ println("BUG: t3:", t3.m(), "called")
+ }
+
+ i = new(myT3)
+ if i.m() != "main.localT.m" {
+ t := reflect.TypeOf(i)
+ n := t.NumMethod()
+ for j := 0; j < n; j++ {
+ m := t.Method(j)
+ fmt.Printf("#%d: %s.%s %s\n", j, m.PkgPath, m.Name, m.Type)
+ }
+ println("BUG: myT3:", i.m(), "called")
+ }
+
+ var t4 struct {
+ localT
+ lib.T
+ }
+ if t4.m() != "main.localT.m" {
+ println("BUG: t4:", t4.m(), "called")
+ }
+ i = &t4
+ if i.m() != "main.localT.m" {
+ println("BUG: myT4:", i.m(), "called")
+ }
+
+ var t5 struct {
+ lib.T
+ localT
+ }
+ if t5.m() != "main.localT.m" {
+ println("BUG: t5:", t5.m(), "called")
+ }
+ i = &t5
+ if i.m() != "main.localT.m" {
+ println("BUG: myT5:", i.m(), "called")
+ }
+}
diff --git a/test/fixedbugs/bug425.go b/test/fixedbugs/bug425.go
new file mode 100644
index 000000000..5546bd96b
--- /dev/null
+++ b/test/fixedbugs/bug425.go
@@ -0,0 +1,17 @@
+// compile
+
+// Copyright 2012 The Go Authors. All rights reserved.
+// Use of this source code is governed by a BSD-style
+// license that can be found in the LICENSE file.
+
+// http://code.google.com/p/go/issues/detail?id=3119
+
+package main
+
+import "fmt"
+
+func main() {
+ s := "hello"
+ fmt.Println(s == "")
+ fmt.Println(s + "world" == "world")
+}
diff --git a/test/fixedbugs/bug426.go b/test/fixedbugs/bug426.go
new file mode 100644
index 000000000..a1af3cf99
--- /dev/null
+++ b/test/fixedbugs/bug426.go
@@ -0,0 +1,15 @@
+// compile
+
+// Copyright 2012 The Go Authors. All rights reserved.
+// Use of this source code is governed by a BSD-style
+// license that can be found in the LICENSE file.
+
+// gccgo crashed compiling this.
+
+package p
+
+type T *T
+
+func f(t T) {
+ println(t, *t)
+}
diff --git a/test/fixedbugs/bug427.go b/test/fixedbugs/bug427.go
new file mode 100644
index 000000000..1239e7a33
--- /dev/null
+++ b/test/fixedbugs/bug427.go
@@ -0,0 +1,39 @@
+// compile
+
+// Copyright 2012 The Go Authors. All rights reserved.
+// Use of this source code is governed by a BSD-style
+// license that can be found in the LICENSE file.
+
+// http://code.google.com/p/go/issues/detail?id=3351
+
+package main
+
+// struct with four fields of basic type
+type S struct {a, b, c, d int}
+
+// struct with five fields of basic type
+type T struct {a, b, c, d, e int}
+
+// array with four elements
+type A [4]int
+
+// array with five elements
+type B [5]int
+
+func main() {
+ var i interface{}
+
+ var s1, s2 S
+ i = s1 == s2
+
+ var t1, t2 T
+ i = t1 == t2
+
+ var a1, a2 A
+ i = a1 == a2
+
+ var b1, b2 B
+ i = b1 == b2
+
+ _ = i
+}
diff --git a/test/fixedbugs/bug428.go b/test/fixedbugs/bug428.go
new file mode 100644
index 000000000..298c45518
--- /dev/null
+++ b/test/fixedbugs/bug428.go
@@ -0,0 +1,19 @@
+// run
+
+// Copyright 2012 The Go Authors. All rights reserved.
+// Use of this source code is governed by a BSD-style
+// license that can be found in the LICENSE file.
+
+// Test that when the compiler expands append inline it does not
+// overwrite a value before it needs it (issue 3369).
+
+package main
+
+func main() {
+ s := make([]byte, 5, 6)
+ copy(s, "12346")
+ s = append(s[:len(s)-1], '5', s[len(s)-1])
+ if string(s) != "123456" {
+ panic(s)
+ }
+}
diff --git a/test/fixedbugs/bug429.go b/test/fixedbugs/bug429.go
new file mode 100644
index 000000000..c1bd1d4bb
--- /dev/null
+++ b/test/fixedbugs/bug429.go
@@ -0,0 +1,13 @@
+// $G $D/$F.go && $L $F.$A && ! ./$A.out || echo BUG: bug429
+
+// Copyright 2012 The Go Authors. All rights reserved.
+// Use of this source code is governed by a BSD-style
+// license that can be found in the LICENSE file.
+
+// Should print deadlock message, not hang.
+
+package main
+
+func main() {
+ select {}
+}
diff --git a/test/float_lit.go b/test/float_lit.go
index 7b91d88e5..2912c3749 100644
--- a/test/float_lit.go
+++ b/test/float_lit.go
@@ -1,9 +1,11 @@
-// $G $F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
+// Test floating-point literal syntax.
+
package main
var bad bool
diff --git a/test/floatcmp.go b/test/floatcmp.go
index f51cbc277..f9f59a937 100644
--- a/test/floatcmp.go
+++ b/test/floatcmp.go
@@ -1,9 +1,11 @@
-// $G $F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
+// Test floating-point comparison involving NaN.
+
package main
import "math"
diff --git a/test/for.go b/test/for.go
index 36ad15709..8a5009065 100644
--- a/test/for.go
+++ b/test/for.go
@@ -1,9 +1,11 @@
-// $G $F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
+// Test for loops.
+
package main
func assertequal(is, shouldbe int, msg string) {
diff --git a/test/func.go b/test/func.go
index e8ed928bc..246cb56fd 100644
--- a/test/func.go
+++ b/test/func.go
@@ -1,9 +1,10 @@
-// $G $F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
+// Test simple functions.
package main
diff --git a/test/func1.go b/test/func1.go
index 056ff9877..c89f7ff2e 100644
--- a/test/func1.go
+++ b/test/func1.go
@@ -1,14 +1,15 @@
-// errchk $G $F.go
+// errorcheck
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
-// does not compile and should not compile
+// Test that result parameters are in the same scope as regular parameters.
+// Does not compile.
package main
-func f1(a int) (int, float32) { // BUG (not caught by compiler): multiple return values must have names
+func f1(a int) (int, float32) {
return 7, 7.0
}
diff --git a/test/func2.go b/test/func2.go
index 5a6d7d0e1..b5966a91f 100644
--- a/test/func2.go
+++ b/test/func2.go
@@ -1,11 +1,13 @@
-// $G $F.go || echo BUG: should compile
+// compile
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
+// Test function signatures.
+// Compiled but not run.
+
package main
-import os "os"
type t1 int
type t2 int
@@ -23,7 +25,7 @@ func f8(os int) int
func f9(os int) int {
return os
}
-func f10(err os.Error) os.Error {
+func f10(err error) error {
return err
}
func f11(t1 string) string {
diff --git a/test/func3.go b/test/func3.go
index 110b0ef1c..6be3bf018 100644
--- a/test/func3.go
+++ b/test/func3.go
@@ -1,9 +1,12 @@
-// errchk $G $F.go
+// errorcheck
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
+// Verify that illegal function signatures are detected.
+// Does not compile.
+
package main
type t1 int
diff --git a/test/func4.go b/test/func4.go
index 69ce56a19..85f1e4b81 100644
--- a/test/func4.go
+++ b/test/func4.go
@@ -1,9 +1,12 @@
-// errchk $G $D/$F.go
+// errorcheck
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
+// Verify that it is illegal to take the address of a function.
+// Does not compile.
+
package main
var notmain func()
@@ -11,4 +14,5 @@ var notmain func()
func main() {
var x = &main // ERROR "address of|invalid"
main = notmain // ERROR "assign to|invalid"
+ _ = x
}
diff --git a/test/func5.go b/test/func5.go
index e27825c2b..2e058be7e 100644
--- a/test/func5.go
+++ b/test/func5.go
@@ -1,9 +1,11 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
+// Test functions and goroutines.
+
package main
func caller(f func(int, int) int, a, b int, c chan int) {
diff --git a/test/func6.go b/test/func6.go
index 1356b6aa8..456cb49f0 100644
--- a/test/func6.go
+++ b/test/func6.go
@@ -1,9 +1,11 @@
-// $G $D/$F.go
+// run
// Copyright 2011 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
+// Test closures in if conditions.
+
package main
func main() {
diff --git a/test/func7.go b/test/func7.go
index e38b008cc..6f6766f29 100644
--- a/test/func7.go
+++ b/test/func7.go
@@ -1,9 +1,11 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2011 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
+// Test evaluation order in if condition.
+
package main
var calledf = false
diff --git a/test/func8.go b/test/func8.go
new file mode 100644
index 000000000..7defe265b
--- /dev/null
+++ b/test/func8.go
@@ -0,0 +1,49 @@
+// run
+
+// Copyright 2011 The Go Authors. All rights reserved.
+// Use of this source code is governed by a BSD-style
+// license that can be found in the LICENSE file.
+
+// Test evaluation order.
+
+package main
+
+var calledf int
+
+func f() int {
+ calledf++
+ return 0
+}
+
+func g() int {
+ return calledf
+}
+
+var xy string
+
+func x() bool {
+ for false {
+ } // no inlining
+ xy += "x"
+ return false
+}
+
+func y() string {
+ for false {
+ } // no inlining
+ xy += "y"
+ return "abc"
+}
+
+func main() {
+ if f() == g() {
+ println("wrong f,g order")
+ }
+
+ if x() == (y() == "abc") {
+ panic("wrong compare")
+ }
+ if xy != "xy" {
+ println("wrong x,y order")
+ }
+}
diff --git a/test/gc.go b/test/gc.go
index 3aab8fac9..6688f9fbd 100644
--- a/test/gc.go
+++ b/test/gc.go
@@ -1,9 +1,11 @@
-// $G $F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
+// Simple test of the garbage collector.
+
package main
import "runtime"
diff --git a/test/gc1.go b/test/gc1.go
index 84034e7ce..6049ea14e 100644
--- a/test/gc1.go
+++ b/test/gc1.go
@@ -1,9 +1,11 @@
-// $G $F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
+// A simple test of the garbage collector.
+
package main
func main() {
diff --git a/test/gc2.go b/test/gc2.go
index c54d807df..de52a4fbf 100644
--- a/test/gc2.go
+++ b/test/gc2.go
@@ -1,10 +1,10 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2011 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
-// Check that buffered channels are garbage collected properly.
+// Test that buffered channels are garbage collected properly.
// An interesting case because they have finalizers and used to
// have self loops that kept them from being collected.
// (Cyclic data with finalizers is never finalized, nor collected.)
@@ -19,7 +19,9 @@ import (
func main() {
const N = 10000
- st := runtime.MemStats
+ st := new(runtime.MemStats)
+ memstats := new(runtime.MemStats)
+ runtime.ReadMemStats(st)
for i := 0; i < N; i++ {
c := make(chan int, 10)
_ = c
@@ -33,8 +35,8 @@ func main() {
}
}
- runtime.UpdateMemStats()
- obj := runtime.MemStats.HeapObjects - st.HeapObjects
+ runtime.ReadMemStats(memstats)
+ obj := memstats.HeapObjects - st.HeapObjects
if obj > N/5 {
fmt.Println("too many objects left:", obj)
os.Exit(1)
diff --git a/test/golden.out b/test/golden.out
index 1618ef68e..376af8e53 100644
--- a/test/golden.out
+++ b/test/golden.out
@@ -1,168 +1,24 @@
== ./
-=========== ./cmp2.go
-panic: runtime error: comparing uncomparable type []int
-
-
-=========== ./cmp3.go
-panic: runtime error: comparing uncomparable type []int
-
-
-=========== ./cmp4.go
-panic: runtime error: hash of unhashable type []int
-
-
-=========== ./cmp5.go
-panic: runtime error: hash of unhashable type []int
-
-
-=========== ./deferprint.go
-printing: 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20
-42 true false true +1.500000e+000 world 0x0 [0/0]0x0 0x0 0x0 255
-
-=========== ./goprint.go
-42 true false true +1.500000e+000 world 0x0 [0/0]0x0 0x0 0x0 255
-
-=========== ./helloworld.go
-hello, world
-
-=========== ./peano.go
-0! = 1
-1! = 1
-2! = 2
-3! = 6
-4! = 24
-5! = 120
-6! = 720
-7! = 5040
-8! = 40320
-9! = 362880
-
-=========== ./printbig.go
--9223372036854775808
-9223372036854775807
-
-=========== ./sigchld.go
-survived SIGCHLD
-
-=========== ./sinit.go
-FAIL
-
-=========== ./turing.go
-Hello World!
-
== ken/
-=========== ken/cplx0.go
-(+5.000000e+000+6.000000e+000i)
-(+5.000000e+000+6.000000e+000i)
-(+5.000000e+000+6.000000e+000i)
-(+5.000000e+000+6.000000e+000i)
-
-=========== ken/cplx3.go
-(+1.292308e+000-1.384615e-001i)
-(+1.292308e+000-1.384615e-001i)
-
-=========== ken/cplx4.go
-c = (-5.000000-6.000000i)
-c = (5.000000+6.000000i)
-c = (5.000000+6.000000i)
-c = (5.000000+6.000000i)
-c = (5+6i)
-c = (13+7i)
-
-=========== ken/cplx5.go
-(+5.000000e+000-5.000000e+000i)
-(+5.000000e+000-5.000000e+000i)
-(+5.000000e+000-5.000000e+000i)
-(+5.000000e+000-5.000000e+000i)
-(+5.000000e+000-5.000000e+000i)
-(+5.000000e+000-5.000000e+000i)
-(+5.000000e+000-5.000000e+000i)
-
-=========== ken/intervar.go
- print 1 bio 2 file 3 -- abc
-
-=========== ken/label.go
-100
-
-=========== ken/rob1.go
-9876543210
-
-=========== ken/rob2.go
-(defn foo (add 12 34))
-
-=========== ken/simpprint.go
-hello world
-
-=========== ken/simpswitch.go
-0out01out12out2aout34out4fiveout56out6aout78out89out9
-
-=========== ken/string.go
-abcxyz-abcxyz-abcxyz-abcxyz-abcxyz-abcxyz-abcxyz
-
== chan/
-=========== chan/doubleselect.go
-PASS
-
-=========== chan/nonblock.go
-PASS
-
== interface/
-=========== interface/fail.go
-panic: interface conversion: *main.S is not main.I: missing method Foo
-
-
-=========== interface/returntype.go
-panic: interface conversion: *main.S is not main.I2: missing method Name
-
-
-== nilptr/
-
== syntax/
== dwarf/
-== fixedbugs/
-
-=========== fixedbugs/bug027.go
-hi
-0 44444
-1 3333
-2 222
-3 11
-4 0
-0 44444
-1 3333
-2 222
-3 11
-4 0
-
-=========== fixedbugs/bug067.go
-ok
-
-=========== fixedbugs/bug070.go
-outer loop top k 0
-inner loop top i 0
-do break
-broke
-
-=========== fixedbugs/bug093.go
-M
-
-=========== fixedbugs/bug113.go
-panic: interface conversion: interface is int, not int32
-
-
-=========== fixedbugs/bug148.go
-2 3
-panic: interface conversion: interface is main.T, not main.T
+== safe/
+== fixedbugs/
-=========== fixedbugs/bug328.go
-0x0
+=========== fixedbugs/bug429.go
+throw: all goroutines are asleep - deadlock!
== bugs/
+
+=========== bugs/bug395.go
+bug395 is broken
diff --git a/test/goprint.go b/test/goprint.go
index c0e34c750..2f0d3c390 100644
--- a/test/goprint.go
+++ b/test/goprint.go
@@ -1,9 +1,11 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// cmpout
// Copyright 2011 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
+// Test that println can be the target of a go statement.
+
package main
import "time"
diff --git a/test/goprint.out b/test/goprint.out
new file mode 100644
index 000000000..da3919ed6
--- /dev/null
+++ b/test/goprint.out
@@ -0,0 +1 @@
+42 true false true +1.500000e+000 world 0x0 [0/0]0x0 0x0 0x0 255
diff --git a/test/goto.go b/test/goto.go
index 0a50938dc..ca477b3d0 100644
--- a/test/goto.go
+++ b/test/goto.go
@@ -1,9 +1,12 @@
-// errchk $G -e $D/$F.go
+// errorcheck
// Copyright 2011 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
+// Verify goto semantics.
+// Does not compile.
+//
// Each test is in a separate function just so that if the
// compiler stops processing after one error, we don't
// lose other ones.
@@ -36,8 +39,8 @@ L:
// goto across declaration not okay
func _() {
- goto L // ERROR "goto L jumps over declaration of x at LINE+1"
- x := 1
+ goto L // ERROR "goto L jumps over declaration of x at LINE+1|goto jumps over declaration"
+ x := 1 // GCCGO_ERROR "defined here"
_ = x
L:
}
@@ -54,12 +57,12 @@ L:
// goto across declaration after inner scope not okay
func _() {
- goto L // ERROR "goto L jumps over declaration of x at LINE+5"
+ goto L // ERROR "goto L jumps over declaration of x at LINE+5|goto jumps over declaration"
{
x := 1
_ = x
}
- x := 1
+ x := 1 // GCCGO_ERROR "defined here"
_ = x
L:
}
@@ -74,8 +77,8 @@ L:
// error shows first offending variable
func _() {
- goto L // ERROR "goto L jumps over declaration of x at LINE+1"
- x := 1
+ goto L // ERROR "goto L jumps over declaration of x at LINE+1|goto jumps over declaration"
+ x := 1 // GCCGO_ERROR "defined here"
_ = x
y := 1
_ = y
@@ -84,8 +87,8 @@ L:
// goto not okay even if code path is dead
func _() {
- goto L // ERROR "goto L jumps over declaration of x at LINE+1"
- x := 1
+ goto L // ERROR "goto L jumps over declaration of x at LINE+1|goto jumps over declaration"
+ x := 1 // GCCGO_ERROR "defined here"
_ = x
y := 1
_ = y
@@ -111,26 +114,26 @@ L:
// goto into inner block not okay
func _() {
- goto L // ERROR "goto L jumps into block starting at LINE+1"
- {
+ goto L // ERROR "goto L jumps into block starting at LINE+1|goto jumps into block"
+ { // GCCGO_ERROR "block starts here"
L:
}
}
// goto backward into inner block still not okay
func _() {
- {
+ { // GCCGO_ERROR "block starts here"
L:
}
- goto L // ERROR "goto L jumps into block starting at LINE-3"
+ goto L // ERROR "goto L jumps into block starting at LINE-3|goto jumps into block"
}
// error shows first (outermost) offending block
func _() {
- goto L // ERROR "goto L jumps into block starting at LINE+1"
+ goto L // ERROR "goto L jumps into block starting at LINE+1|goto jumps into block"
{
{
- {
+ { // GCCGO_ERROR "block starts here"
L:
}
}
@@ -139,10 +142,10 @@ func _() {
// error prefers block diagnostic over declaration diagnostic
func _() {
- goto L // ERROR "goto L jumps into block starting at LINE+3"
+ goto L // ERROR "goto L jumps into block starting at LINE+3|goto jumps into block"
x := 1
_ = x
- {
+ { // GCCGO_ERROR "block starts here"
L:
}
}
@@ -176,56 +179,56 @@ L:
}
func _() {
- goto L // ERROR "goto L jumps into block starting at LINE+1"
- if true {
+ goto L // ERROR "goto L jumps into block starting at LINE+1|goto jumps into block"
+ if true { // GCCGO_ERROR "block starts here"
L:
}
}
func _() {
- goto L // ERROR "goto L jumps into block starting at LINE+1"
- if true {
+ goto L // ERROR "goto L jumps into block starting at LINE+1|goto jumps into block"
+ if true { // GCCGO_ERROR "block starts here"
L:
} else {
}
}
func _() {
- goto L // ERROR "goto L jumps into block starting at LINE+1"
+ goto L // ERROR "goto L jumps into block starting at LINE+1|goto jumps into block"
if true {
- } else {
+ } else { // GCCGO_ERROR "block starts here"
L:
}
}
func _() {
- if false {
+ if false { // GCCGO_ERROR "block starts here"
L:
} else {
- goto L // ERROR "goto L jumps into block starting at LINE-3"
+ goto L // ERROR "goto L jumps into block starting at LINE-3|goto jumps into block"
}
}
func _() {
if true {
- goto L // ERROR "goto L jumps into block starting at LINE+1"
- } else {
+ goto L // ERROR "goto L jumps into block starting at LINE+1|goto jumps into block"
+ } else { // GCCGO_ERROR "block starts here"
L:
}
}
func _() {
if true {
- goto L // ERROR "goto L jumps into block starting at LINE+1"
- } else if false {
+ goto L // ERROR "goto L jumps into block starting at LINE+1|goto jumps into block"
+ } else if false { // GCCGO_ERROR "block starts here"
L:
}
}
func _() {
if true {
- goto L // ERROR "goto L jumps into block starting at LINE+1"
- } else if false {
+ goto L // ERROR "goto L jumps into block starting at LINE+1|goto jumps into block"
+ } else if false { // GCCGO_ERROR "block starts here"
L:
} else {
}
@@ -238,9 +241,9 @@ func _() {
// really is LINE+1 (like in the previous test),
// even though it looks like it might be LINE+3 instead.
if true {
- goto L // ERROR "goto L jumps into block starting at LINE+1"
+ goto L // ERROR "goto L jumps into block starting at LINE+1|goto jumps into block"
} else if false {
- } else {
+ } else { // GCCGO_ERROR "block starts here"
L:
}
}
@@ -259,10 +262,10 @@ func _() {
func _() {
// Still not okay.
- if true {
+ if true { //// GCCGO_ERROR "block starts here"
L:
} else
- goto L //// ERROR "goto L jumps into block starting at LINE-3"
+ goto L //// ERROR "goto L jumps into block starting at LINE-3|goto jumps into block"
}
*/
@@ -284,61 +287,61 @@ func _() {
}
func _() {
- for {
+ for { // GCCGO_ERROR "block starts here"
L:
}
- goto L // ERROR "goto L jumps into block starting at LINE-3"
+ goto L // ERROR "goto L jumps into block starting at LINE-3|goto jumps into block"
}
func _() {
- for {
+ for { // GCCGO_ERROR "block starts here"
goto L
L1:
}
L:
- goto L1 // ERROR "goto L1 jumps into block starting at LINE-5"
+ goto L1 // ERROR "goto L1 jumps into block starting at LINE-5|goto jumps into block"
}
func _() {
- for i < n {
+ for i < n { // GCCGO_ERROR "block starts here"
L:
}
- goto L // ERROR "goto L jumps into block starting at LINE-3"
+ goto L // ERROR "goto L jumps into block starting at LINE-3|goto jumps into block"
}
func _() {
- for i = 0; i < n; i++ {
+ for i = 0; i < n; i++ { // GCCGO_ERROR "block starts here"
L:
}
- goto L // ERROR "goto L jumps into block starting at LINE-3"
+ goto L // ERROR "goto L jumps into block starting at LINE-3|goto jumps into block"
}
func _() {
- for i = range x {
+ for i = range x { // GCCGO_ERROR "block starts here"
L:
}
- goto L // ERROR "goto L jumps into block starting at LINE-3"
+ goto L // ERROR "goto L jumps into block starting at LINE-3|goto jumps into block"
}
func _() {
- for i = range c {
+ for i = range c { // GCCGO_ERROR "block starts here"
L:
}
- goto L // ERROR "goto L jumps into block starting at LINE-3"
+ goto L // ERROR "goto L jumps into block starting at LINE-3|goto jumps into block"
}
func _() {
- for i = range m {
+ for i = range m { // GCCGO_ERROR "block starts here"
L:
}
- goto L // ERROR "goto L jumps into block starting at LINE-3"
+ goto L // ERROR "goto L jumps into block starting at LINE-3|goto jumps into block"
}
func _() {
- for i = range s {
+ for i = range s { // GCCGO_ERROR "block starts here"
L:
}
- goto L // ERROR "goto L jumps into block starting at LINE-3"
+ goto L // ERROR "goto L jumps into block starting at LINE-3|goto jumps into block"
}
// switch
@@ -392,48 +395,48 @@ func _() {
}
func _() {
- goto L // ERROR "goto L jumps into block starting at LINE+1"
+ goto L // ERROR "goto L jumps into block starting at LINE+1|goto jumps into block"
switch i {
case 0:
- L:
+ L: // GCCGO_ERROR "block starts here"
}
}
func _() {
- goto L // ERROR "goto L jumps into block starting at LINE+1"
+ goto L // ERROR "goto L jumps into block starting at LINE+1|goto jumps into block"
switch i {
case 0:
- L:
+ L: // GCCGO_ERROR "block starts here"
;
default:
}
}
func _() {
- goto L // ERROR "goto L jumps into block starting at LINE+1"
+ goto L // ERROR "goto L jumps into block starting at LINE+1|goto jumps into block"
switch i {
case 0:
default:
- L:
+ L: // GCCGO_ERROR "block starts here"
}
}
func _() {
switch i {
default:
- goto L // ERROR "goto L jumps into block starting at LINE+1"
+ goto L // ERROR "goto L jumps into block starting at LINE+1|goto jumps into block"
case 0:
- L:
+ L: // GCCGO_ERROR "block starts here"
}
}
func _() {
switch i {
case 0:
- L:
+ L: // GCCGO_ERROR "block starts here"
;
default:
- goto L // ERROR "goto L jumps into block starting at LINE-4"
+ goto L // ERROR "goto L jumps into block starting at LINE-4|goto jumps into block"
}
}
@@ -489,47 +492,47 @@ func _() {
}
func _() {
- goto L // ERROR "goto L jumps into block starting at LINE+2"
+ goto L // ERROR "goto L jumps into block starting at LINE+2|goto jumps into block"
select {
case c <- 1:
- L:
+ L: // GCCGO_ERROR "block starts here"
}
}
func _() {
- goto L // ERROR "goto L jumps into block starting at LINE+2"
+ goto L // ERROR "goto L jumps into block starting at LINE+2|goto jumps into block"
select {
case c <- 1:
- L:
+ L: // GCCGO_ERROR "block starts here"
;
default:
}
}
func _() {
- goto L // ERROR "goto L jumps into block starting at LINE+3"
+ goto L // ERROR "goto L jumps into block starting at LINE+3|goto jumps into block"
select {
case <-c:
default:
- L:
+ L: // GCCGO_ERROR "block starts here"
}
}
func _() {
select {
default:
- goto L // ERROR "goto L jumps into block starting at LINE+1"
+ goto L // ERROR "goto L jumps into block starting at LINE+1|goto jumps into block"
case <-c:
- L:
+ L: // GCCGO_ERROR "block starts here"
}
}
func _() {
select {
case <-c:
- L:
+ L: // GCCGO_ERROR "block starts here"
;
default:
- goto L // ERROR "goto L jumps into block starting at LINE-4"
+ goto L // ERROR "goto L jumps into block starting at LINE-4|goto jumps into block"
}
}
diff --git a/test/hashmap.go b/test/hashmap.go
deleted file mode 100755
index 0a4d7ab61..000000000
--- a/test/hashmap.go
+++ /dev/null
@@ -1,181 +0,0 @@
-// $G $F.go && $L $F.$A && ./$A.out
-
-// Copyright 2009 The Go Authors. All rights reserved.
-// Use of this source code is governed by a BSD-style
-// license that can be found in the LICENSE file.
-
-package main
-
-// ----------------------------------------------------------------------------
-// Helper functions
-
-func ASSERT(p bool) {
- if !p {
- // panic 0
- }
-}
-
-
-// ----------------------------------------------------------------------------
-// Implementation of the HashMap
-
-type KeyType interface {
- Hash() uint32
- Match(other KeyType) bool
-}
-
-
-type ValueType interface {
- // empty interface
-}
-
-
-type Entry struct {
- key KeyType
- value ValueType
-}
-
-
-type Array [1024]Entry
-
-type HashMap struct {
- map_ *Array
- log2_capacity_ uint32
- occupancy_ uint32
-}
-
-
-func (m *HashMap) capacity() uint32 {
- return 1 << m.log2_capacity_
-}
-
-
-func (m *HashMap) Clear() {
- // Mark all entries as empty.
- var i uint32 = m.capacity() - 1
- for i > 0 {
- m.map_[i].key = nil
- i = i - 1
- }
- m.occupancy_ = 0
-}
-
-
-func (m *HashMap) Initialize (initial_log2_capacity uint32) {
- m.log2_capacity_ = initial_log2_capacity
- m.map_ = new(Array)
- m.Clear()
-}
-
-
-func (m *HashMap) Probe (key KeyType) *Entry {
- ASSERT(key != nil)
-
- var i uint32 = key.Hash() % m.capacity()
- ASSERT(0 <= i && i < m.capacity())
-
- ASSERT(m.occupancy_ < m.capacity()) // guarantees loop termination
- for m.map_[i].key != nil && !m.map_[i].key.Match(key) {
- i++
- if i >= m.capacity() {
- i = 0
- }
- }
-
- return &m.map_[i]
-}
-
-
-func (m *HashMap) Lookup (key KeyType, insert bool) *Entry {
- // Find a matching entry.
- var p *Entry = m.Probe(key)
- if p.key != nil {
- return p
- }
-
- // No entry found; insert one if necessary.
- if insert {
- p.key = key
- p.value = nil
- m.occupancy_++
-
- // Grow the map if we reached >= 80% occupancy.
- if m.occupancy_ + m.occupancy_/4 >= m.capacity() {
- m.Resize()
- p = m.Probe(key)
- }
-
- return p
- }
-
- // No entry found and none inserted.
- return nil
-}
-
-
-func (m *HashMap) Resize() {
- var hmap *Array = m.map_
- var n uint32 = m.occupancy_
-
- // Allocate a new map of twice the current size.
- m.Initialize(m.log2_capacity_ << 1)
-
- // Rehash all current entries.
- var i uint32 = 0
- for n > 0 {
- if hmap[i].key != nil {
- m.Lookup(hmap[i].key, true).value = hmap[i].value
- n = n - 1
- }
- i++
- }
-}
-
-
-// ----------------------------------------------------------------------------
-// Test code
-
-type Number struct {
- x uint32
-}
-
-
-func (n *Number) Hash() uint32 {
- return n.x * 23
-}
-
-
-func (n *Number) Match(other KeyType) bool {
- // var y *Number = other
- // return n.x == y.x
- return false
-}
-
-
-func MakeNumber (x uint32) *Number {
- var n *Number = new(Number)
- n.x = x
- return n
-}
-
-
-func main() {
- // func (n int) int { return n + 1; }(1)
-
- //print "HashMap - gri 2/8/2008\n"
-
- var hmap *HashMap = new(HashMap)
- hmap.Initialize(0)
-
- var x1 *Number = MakeNumber(1001)
- var x2 *Number = MakeNumber(2002)
- var x3 *Number = MakeNumber(3003)
- _, _, _ = x1, x2, x3
-
- // this doesn't work I think...
- //hmap.Lookup(x1, true)
- //hmap.Lookup(x2, true)
- //hmap.Lookup(x3, true)
-
- //print "done\n"
-}
diff --git a/test/helloworld.go b/test/helloworld.go
index e55a74bbd..5025ec9bb 100644
--- a/test/helloworld.go
+++ b/test/helloworld.go
@@ -1,9 +1,11 @@
-// $G $F.go && $L $F.$A && ./$A.out
+// cmpout
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
+// Test that we can do page 1 of the C book.
+
package main
func main() {
diff --git a/test/helloworld.out b/test/helloworld.out
new file mode 100644
index 000000000..4b5fa6370
--- /dev/null
+++ b/test/helloworld.out
@@ -0,0 +1 @@
+hello, world
diff --git a/test/if.go b/test/if.go
index 18a6715d7..25cc14164 100644
--- a/test/if.go
+++ b/test/if.go
@@ -1,9 +1,11 @@
-// $G $F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
+// Test if statements in various forms.
+
package main
func assertequal(is, shouldbe int, msg string) {
diff --git a/test/import.go b/test/import.go
index 96330340d..d135cd284 100644
--- a/test/import.go
+++ b/test/import.go
@@ -1,11 +1,11 @@
-// $G $D/$F.go
+// compile
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
-// check that when import gives multiple names
-// to a type, they're still all the same type
+// Test that when import gives multiple names
+// to a single type, they still all refer to the same type.
package main
@@ -13,13 +13,12 @@ import _os_ "os"
import "os"
import . "os"
-func f(e os.Error)
+func f(e *os.File)
func main() {
- var _e_ _os_.Error
- var dot Error
+ var _e_ *_os_.File
+ var dot *File
f(_e_)
f(dot)
}
-
diff --git a/test/import1.go b/test/import1.go
index ebd704ef9..56b29d58c 100644
--- a/test/import1.go
+++ b/test/import1.go
@@ -1,10 +1,11 @@
-// errchk $G -e $D/$F.go
+// errorcheck
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
-// check for import conflicts
+// Verify that import conflicts are detected by the compiler.
+// Does not compile.
package main
diff --git a/test/import2.go b/test/import2.go
index 0efc285fa..5c275f34b 100644
--- a/test/import2.go
+++ b/test/import2.go
@@ -1,9 +1,12 @@
-// true # used by import3
+// skip # used by import3
// Copyright 2010 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
+// Various declarations of exported variables and functions.
+// Imported by import3.go.
+
package p
var C1 chan <- chan int = (chan<- (chan int))(nil)
diff --git a/test/import3.go b/test/import3.go
index e4900b93d..274fcfe42 100644
--- a/test/import3.go
+++ b/test/import3.go
@@ -4,7 +4,7 @@
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
-// Check that all the types from import2.go made it
+// Test that all the types from import2.go made it
// intact and with the same meaning, by assigning to or using them.
package main
diff --git a/test/import4.go b/test/import4.go
index 1ae1d0e4a..cbfebf7e1 100644
--- a/test/import4.go
+++ b/test/import4.go
@@ -4,9 +4,11 @@
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
-package main
+// Verify that various kinds of "imported and not used"
+// errors are caught by the compiler.
+// Does not compile.
-// various kinds of imported and not used
+package main
// standard
import "fmt" // ERROR "imported and not used.*fmt"
diff --git a/test/import5.go b/test/import5.go
new file mode 100644
index 000000000..6480acff9
--- /dev/null
+++ b/test/import5.go
@@ -0,0 +1,55 @@
+// errorcheck
+
+// Copyright 2009 The Go Authors. All rights reserved.
+// Use of this source code is governed by a BSD-style
+// license that can be found in the LICENSE file.
+
+// Verify that invalid imports are rejected by the compiler.
+// Does not compile.
+
+package main
+
+// Correct import paths.
+import _ "fmt"
+import _ `time`
+import _ "m\x61th"
+import _ "go/parser"
+
+// Correct import paths, but the packages don't exist.
+// Don't test.
+//import "a.b"
+//import "greek/αβ"
+
+// Import paths must be strings.
+import 42 // ERROR "import statement"
+import 'a' // ERROR "import statement"
+import 3.14 // ERROR "import statement"
+import 0.25i // ERROR "import statement"
+
+// Each of these pairs tests both `` vs "" strings
+// and also use of invalid characters spelled out as
+// escape sequences and written directly.
+// For example `"\x00"` tests import "\x00"
+// while "`\x00`" tests import `<actual-NUL-byte>`.
+import "" // ERROR "import path"
+import `` // ERROR "import path"
+import "\x00" // ERROR "import path"
+import `\x00` // ERROR "import path"
+import "\x7f" // ERROR "import path"
+import `\x7f` // ERROR "import path"
+import "a!" // ERROR "import path"
+import `a!` // ERROR "import path"
+import "a b" // ERROR "import path"
+import `a b` // ERROR "import path"
+import "a\\b" // ERROR "import path"
+import `a\\b` // ERROR "import path"
+import "\"`a`\"" // ERROR "import path"
+import `\"a\"` // ERROR "import path"
+import "\x80\x80" // ERROR "import path"
+import `\x80\x80` // ERROR "import path"
+import "\xFFFD" // ERROR "import path"
+import `\xFFFD` // ERROR "import path"
+
+// Invalid local imports.
+import "/foo" // ERROR "import path cannot be absolute path"
+import "c:/foo" // ERROR "import path contains invalid character"
diff --git a/test/index.go b/test/index.go
index 38aa33dd3..eb0c45495 100644
--- a/test/index.go
+++ b/test/index.go
@@ -9,6 +9,7 @@
// license that can be found in the LICENSE file.
// Generate test of index and slice bounds checks.
+// The output is compiled and run.
package main
diff --git a/test/indirect.go b/test/indirect.go
index cfddde9ce..bb20f3009 100644
--- a/test/indirect.go
+++ b/test/indirect.go
@@ -1,9 +1,11 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out || echo BUG indirect
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
+// Test various safe uses of indirection.
+
package main
var m0 map[string]int
diff --git a/test/indirect1.go b/test/indirect1.go
index 0fd5c19d4..51da4cc7c 100644
--- a/test/indirect1.go
+++ b/test/indirect1.go
@@ -1,9 +1,12 @@
-// errchk $G -e $D/$F.go
+// errorcheck
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
+// Verify that illegal uses of indirection are caught by the compiler.
+// Does not compile.
+
package main
var m0 map[string]int
@@ -65,4 +68,5 @@ func f() {
cap(b2)+ // ERROR "illegal|invalid|must be"
cap(b3)+
cap(b4) // ERROR "illegal|invalid|must be"
+ _ = x
}
diff --git a/test/init.go b/test/init.go
index 74c2d5c26..f4689443c 100644
--- a/test/init.go
+++ b/test/init.go
@@ -1,9 +1,12 @@
-// errchk $G -e $D/$F.go
+// errorcheck
// Copyright 2011 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
+// Verify that erroneous use of init is detected.
+// Does not compile.
+
package main
import "runtime"
diff --git a/test/init1.go b/test/init1.go
new file mode 100644
index 000000000..a888ad744
--- /dev/null
+++ b/test/init1.go
@@ -0,0 +1,44 @@
+// run
+
+// Copyright 2011 The Go Authors. All rights reserved.
+// Use of this source code is governed by a BSD-style
+// license that can be found in the LICENSE file.
+
+// Test that goroutines and garbage collection run during init.
+
+package main
+
+import "runtime"
+
+var x []byte
+
+func init() {
+ c := make(chan int)
+ go send(c)
+ <-c
+
+ const chunk = 1 << 20
+ memstats := new(runtime.MemStats)
+ runtime.ReadMemStats(memstats)
+ sys := memstats.Sys
+ b := make([]byte, chunk)
+ for i := range b {
+ b[i] = byte(i%10 + '0')
+ }
+ s := string(b)
+ for i := 0; i < 1000; i++ {
+ x = []byte(s)
+ }
+ runtime.ReadMemStats(memstats)
+ sys1 := memstats.Sys
+ if sys1-sys > chunk*50 {
+ println("allocated 1000 chunks of", chunk, "and used ", sys1-sys, "memory")
+ }
+}
+
+func send(c chan int) {
+ c <- 1
+}
+
+func main() {
+}
diff --git a/test/initcomma.go b/test/initcomma.go
index 195d4575f..a54fce428 100644
--- a/test/initcomma.go
+++ b/test/initcomma.go
@@ -1,15 +1,17 @@
-// $G $F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
+// Test trailing commas. DO NOT gofmt THIS FILE.
+
package main
-var a = []int{1, 2}
-var b = [5]int{1, 2, 3}
-var c = []int{1}
-var d = [...]int{1, 2, 3}
+var a = []int{1, 2, }
+var b = [5]int{1, 2, 3, }
+var c = []int{1, }
+var d = [...]int{1, 2, 3, }
func main() {
if len(a) != 2 {
diff --git a/test/initialize.go b/test/initialize.go
index 6dd7d67dc..1307e0209 100644
--- a/test/initialize.go
+++ b/test/initialize.go
@@ -1,9 +1,11 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
+// Test initialization of package-level variables.
+
package main
import "fmt"
diff --git a/test/initializerr.go b/test/initializerr.go
index e7f8b0e92..48908c347 100644
--- a/test/initializerr.go
+++ b/test/initializerr.go
@@ -1,9 +1,12 @@
-// errchk $G -e $D/$F.go
+// errorcheck
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
+// Verify that erroneous initialization expressions are caught by the compiler
+// Does not compile.
+
package main
type S struct {
diff --git a/test/initsyscall.go b/test/initsyscall.go
deleted file mode 100644
index b5e5812b6..000000000
--- a/test/initsyscall.go
+++ /dev/null
@@ -1,27 +0,0 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
-
-// Copyright 2009 The Go Authors. All rights reserved.
-// Use of this source code is governed by a BSD-style
-// license that can be found in the LICENSE file.
-
-// This used to crash because the scheduler
-// tried to kick off a new scheduling thread for f
-// when time.Nanoseconds went into the system call.
-// It's not okay to schedule new goroutines
-// until main has started.
-
-package main
-
-import "time"
-
-func f() {
-}
-
-func init() {
- go f()
- time.Nanoseconds()
-}
-
-func main() {
-}
-
diff --git a/test/int_lit.go b/test/int_lit.go
index 2644e17b5..78deaea13 100644
--- a/test/int_lit.go
+++ b/test/int_lit.go
@@ -1,9 +1,11 @@
-// $G $F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
+// Test integer literal syntax.
+
package main
import "os"
diff --git a/test/intcvt.go b/test/intcvt.go
index 407bcfd9b..3920528a4 100644
--- a/test/intcvt.go
+++ b/test/intcvt.go
@@ -1,9 +1,11 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
+// Test implicit and explicit conversions of constants.
+
package main
const (
diff --git a/test/interface/bigdata.go b/test/interface/bigdata.go
index 44f6ab127..0f2e9a990 100644
--- a/test/interface/bigdata.go
+++ b/test/interface/bigdata.go
@@ -1,11 +1,10 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
-// check that big vs small, pointer vs not
-// interface methods work.
+// Test big vs. small, pointer vs. value interface methods.
package main
diff --git a/test/interface/convert.go b/test/interface/convert.go
index 7f429f703..eb6fd1d55 100644
--- a/test/interface/convert.go
+++ b/test/interface/convert.go
@@ -1,11 +1,10 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
-// Check uses of all the different interface
-// conversion runtime functions.
+// Test all the different interface conversion runtime functions.
package main
diff --git a/test/interface/convert1.go b/test/interface/convert1.go
index 658b1a92f..4a3ec8a37 100644
--- a/test/interface/convert1.go
+++ b/test/interface/convert1.go
@@ -1,11 +1,10 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
-// Check that static interface conversion of
-// interface value nil succeeds.
+// Test static interface conversion of interface value nil.
package main
diff --git a/test/interface/convert2.go b/test/interface/convert2.go
index 658b1a92f..4a3ec8a37 100644
--- a/test/interface/convert2.go
+++ b/test/interface/convert2.go
@@ -1,11 +1,10 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
-// Check that static interface conversion of
-// interface value nil succeeds.
+// Test static interface conversion of interface value nil.
package main
diff --git a/test/interface/embed.go b/test/interface/embed.go
index 2fddee190..5c52ac023 100644
--- a/test/interface/embed.go
+++ b/test/interface/embed.go
@@ -1,10 +1,10 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
-// Check methods derived from embedded interface values.
+// Test methods derived from embedded interface values.
package main
diff --git a/test/interface/embed0.go b/test/interface/embed0.go
index bbd81e760..e2ee20ade 100644
--- a/test/interface/embed0.go
+++ b/test/interface/embed0.go
@@ -1,10 +1,10 @@
-// true # used by embed1.go
+// skip # used by embed1.go
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
-// Check that embedded interface types can have local methods.
+// Test that embedded interface types can have local methods.
package p
diff --git a/test/interface/embed1.go b/test/interface/embed1.go
index 24e50471f..ee502a162 100644
--- a/test/interface/embed1.go
+++ b/test/interface/embed1.go
@@ -4,7 +4,7 @@
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
-// Check that embedded interface types can have local methods.
+// Test that embedded interface types can have local methods.
package main
diff --git a/test/interface/embed2.go b/test/interface/embed2.go
index c18a1fece..1636db78e 100644
--- a/test/interface/embed2.go
+++ b/test/interface/embed2.go
@@ -1,10 +1,10 @@
-// errchk $G -e $D/$F.go
+// errorcheck
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
-// Check methods derived from embedded interface and *interface values.
+// Test methods derived from embedded interface and *interface values.
package main
diff --git a/test/interface/explicit.go b/test/interface/explicit.go
index daae59b36..d19480a68 100644
--- a/test/interface/explicit.go
+++ b/test/interface/explicit.go
@@ -1,10 +1,11 @@
-// errchk $G -e $D/$F.go
+// errorcheck
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
-// Static error messages about interface conversions.
+// Verify compiler messages about erroneous static interface conversions.
+// Does not compile.
package main
diff --git a/test/interface/fail.go b/test/interface/fail.go
index 3e741d3f9..72b854dc0 100644
--- a/test/interface/fail.go
+++ b/test/interface/fail.go
@@ -1,10 +1,10 @@
-// $G $D/$F.go && $L $F.$A && ! ./$A.out
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
-// Check that interface conversion fails when method is missing.
+// Test that interface conversion fails when method is missing.
package main
@@ -13,6 +13,10 @@ type I interface {
}
func main() {
+ shouldPanic(p1)
+}
+
+func p1() {
var s *S
var i I
var e interface {}
@@ -21,6 +25,14 @@ func main() {
_ = i
}
-// hide S down here to avoid static warning
type S struct {
}
+
+func shouldPanic(f func()) {
+ defer func() {
+ if recover() == nil {
+ panic("function should panic")
+ }
+ }()
+ f()
+}
diff --git a/test/interface/fake.go b/test/interface/fake.go
index ddb832542..861a64084 100644
--- a/test/interface/fake.go
+++ b/test/interface/fake.go
@@ -1,10 +1,10 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
-// Interface comparisons using types hidden
+// Test interface comparisons using types hidden
// inside reflected-on structs.
package main
diff --git a/test/interface/noeq.go b/test/interface/noeq.go
new file mode 100644
index 000000000..1c5166ede
--- /dev/null
+++ b/test/interface/noeq.go
@@ -0,0 +1,40 @@
+// run
+
+// Copyright 2011 The Go Authors. All rights reserved.
+// Use of this source code is governed by a BSD-style
+// license that can be found in the LICENSE file.
+
+// Test run-time error detection for interface values containing types
+// that cannot be compared for equality.
+
+package main
+
+func main() {
+ cmp(1)
+
+ var (
+ m map[int]int
+ s struct{ x []int }
+ f func()
+ )
+ noCmp(m)
+ noCmp(s)
+ noCmp(f)
+}
+
+func cmp(x interface{}) bool {
+ return x == x
+}
+
+func noCmp(x interface{}) {
+ shouldPanic(func() { cmp(x) })
+}
+
+func shouldPanic(f func()) {
+ defer func() {
+ if recover() == nil {
+ panic("function should panic")
+ }
+ }()
+ f()
+}
diff --git a/test/interface/pointer.go b/test/interface/pointer.go
index fe4d8e3ef..292705066 100644
--- a/test/interface/pointer.go
+++ b/test/interface/pointer.go
@@ -1,10 +1,11 @@
-// errchk $G $D/$F.go
+// errorcheck
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
-// Check that interface{M()} = *interface{M()} produces a compiler error.
+// Test that interface{M()} = *interface{M()} produces a compiler error.
+// Does not compile.
package main
@@ -33,5 +34,5 @@ func main() {
print("call addinst\n")
var x Inst = AddInst(new(Start)) // ERROR "pointer to interface"
print("return from addinst\n")
- var y *Inst = new(Start) // ERROR "pointer to interface"
+ var y *Inst = new(Start) // ERROR "pointer to interface|incompatible type"
}
diff --git a/test/interface/private.go b/test/interface/private.go
index 37890c923..14dfc1ae5 100644
--- a/test/interface/private.go
+++ b/test/interface/private.go
@@ -4,6 +4,9 @@
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
+// Test that unexported methods are not visible outside the package.
+// Does not compile.
+
package main
import "./private1"
diff --git a/test/interface/private1.go b/test/interface/private1.go
index 3173fbef4..3281c38be 100644
--- a/test/interface/private1.go
+++ b/test/interface/private1.go
@@ -1,9 +1,11 @@
-// true # used by private.go
+// skip # used by private.go
// Copyright 2011 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
+// Imported by private.go, which should not be able to see the private method.
+
package p
type Exported interface {
diff --git a/test/interface/receiver.go b/test/interface/receiver.go
index f53daf8da..4511ab3b4 100644
--- a/test/interface/receiver.go
+++ b/test/interface/receiver.go
@@ -1,11 +1,11 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
-// Implicit methods for embedded types.
-// Mixed pointer and non-pointer receivers.
+// Test Implicit methods for embedded types and
+// mixed pointer and non-pointer receivers.
package main
diff --git a/test/interface/receiver1.go b/test/interface/receiver1.go
index 51312d000..2b7ccdc1a 100644
--- a/test/interface/receiver1.go
+++ b/test/interface/receiver1.go
@@ -1,10 +1,11 @@
-// errchk $G $D/$F.go
+// errorcheck
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
-// Error messages about missing implicit methods.
+// Verify compiler complains about missing implicit methods.
+// Does not compile.
package main
diff --git a/test/interface/recursive.go b/test/interface/recursive.go
index 1eb56e976..fcc88331e 100644
--- a/test/interface/recursive.go
+++ b/test/interface/recursive.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go || echo BUG: should compile
+// compile
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
@@ -6,7 +6,7 @@
// Check mutually recursive interfaces
-package main
+package recursive
type I1 interface {
foo() I2
diff --git a/test/interface/recursive1.go b/test/interface/recursive1.go
new file mode 100644
index 000000000..cc3cdc37f
--- /dev/null
+++ b/test/interface/recursive1.go
@@ -0,0 +1,17 @@
+// skip # used by recursive2
+
+// Copyright 2012 The Go Authors. All rights reserved.
+// Use of this source code is governed by a BSD-style
+// license that can be found in the LICENSE file.
+
+// Mutually recursive type definitions imported and used by recursive1.go.
+
+package p
+
+type I1 interface {
+ F() I2
+}
+
+type I2 interface {
+ I1
+}
diff --git a/test/interface/recursive2.go b/test/interface/recursive2.go
new file mode 100644
index 000000000..5129ceb02
--- /dev/null
+++ b/test/interface/recursive2.go
@@ -0,0 +1,22 @@
+// $G $D/recursive1.go && $G $D/$F.go
+
+// Copyright 2012 The Go Authors. All rights reserved.
+// Use of this source code is governed by a BSD-style
+// license that can be found in the LICENSE file.
+
+// Test that the mutually recursive types in recursive1.go made it
+// intact and with the same meaning, by assigning to or using them.
+
+package main
+
+import "./recursive1"
+
+func main() {
+ var i1 p.I1
+ var i2 p.I2
+ i1 = i2
+ i2 = i1
+ i1 = i2.F()
+ i2 = i1.F()
+ _, _ = i1, i2
+}
diff --git a/test/interface/returntype.go b/test/interface/returntype.go
index c526b3b0e..4d86f3918 100644
--- a/test/interface/returntype.go
+++ b/test/interface/returntype.go
@@ -1,10 +1,10 @@
-// $G $D/$F.go && $L $F.$A && (! ./$A.out || echo BUG: should not succeed)
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
-// Check methods with different return types.
+// Test interface methods with different return types are distinct.
package main
@@ -18,8 +18,21 @@ type I1 interface { Name() int8 }
type I2 interface { Name() int64 }
func main() {
+ shouldPanic(p1)
+}
+
+func p1() {
var i1 I1
var s *S
i1 = s
print(i1.(I2).Name())
}
+
+func shouldPanic(f func()) {
+ defer func() {
+ if recover() == nil {
+ panic("function should panic")
+ }
+ }()
+ f()
+}
diff --git a/test/interface/struct.go b/test/interface/struct.go
index 40b7f4f91..f60819ca8 100644
--- a/test/interface/struct.go
+++ b/test/interface/struct.go
@@ -1,10 +1,10 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out || echo BUG interface6
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
-// Interface values containing structures.
+// Test interface values containing structures.
package main
diff --git a/test/iota.go b/test/iota.go
index c40ca1f38..7187dbe33 100644
--- a/test/iota.go
+++ b/test/iota.go
@@ -1,9 +1,11 @@
-// $G $F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
+// Test iota.
+
package main
func assert(cond bool, msg string) {
diff --git a/test/ken/array.go b/test/ken/array.go
index 40209f5da..9412e3502 100644
--- a/test/ken/array.go
+++ b/test/ken/array.go
@@ -1,9 +1,11 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
+// Test arrays and slices.
+
package main
func setpd(a []int) {
@@ -68,6 +70,9 @@ func testpdpd() {
a = a[5:25]
res(sumpd(a), 5, 25)
+
+ a = a[30:95]
+ res(sumpd(a), 35, 100)
}
// call ptr fixed with ptr fixed
diff --git a/test/ken/chan.go b/test/ken/chan.go
index ef75b044d..36b18f80e 100644
--- a/test/ken/chan.go
+++ b/test/ken/chan.go
@@ -1,9 +1,11 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
+// Test communication operations including select.
+
package main
import "os"
diff --git a/test/ken/chan1.go b/test/ken/chan1.go
index e5fc033f3..cbd21a3d6 100644
--- a/test/ken/chan1.go
+++ b/test/ken/chan1.go
@@ -1,9 +1,11 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
+// Test communication with multiple simultaneous goroutines.
+
package main
import "runtime"
diff --git a/test/ken/complit.go b/test/ken/complit.go
index da0a84a04..bc50bbe22 100644
--- a/test/ken/complit.go
+++ b/test/ken/complit.go
@@ -1,9 +1,11 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
+// Test composite literals.
+
package main
type M map[int]int
diff --git a/test/ken/convert.go b/test/ken/convert.go
index 3780ec886..33acbd8cd 100644
--- a/test/ken/convert.go
+++ b/test/ken/convert.go
@@ -1,10 +1,11 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2010 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
-// near-exhaustive test of converting numbers between types.
+// Test, near-exhaustive, of converting numbers between types.
+// No complex numbers though.
package main
diff --git a/test/ken/cplx0.go b/test/ken/cplx0.go
index ba1fa196f..665e52a5f 100644
--- a/test/ken/cplx0.go
+++ b/test/ken/cplx0.go
@@ -1,9 +1,11 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// cmpout
// Copyright 2010 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
+// Test trivial, bootstrap-level complex numbers, including printing.
+
package main
const (
diff --git a/test/ken/cplx0.out b/test/ken/cplx0.out
new file mode 100644
index 000000000..7627c28df
--- /dev/null
+++ b/test/ken/cplx0.out
@@ -0,0 +1,4 @@
+(+5.000000e+000+6.000000e+000i)
+(+5.000000e+000+6.000000e+000i)
+(+5.000000e+000+6.000000e+000i)
+(+5.000000e+000+6.000000e+000i)
diff --git a/test/ken/cplx1.go b/test/ken/cplx1.go
index 8ec7d40f5..78240a563 100644
--- a/test/ken/cplx1.go
+++ b/test/ken/cplx1.go
@@ -1,9 +1,11 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2010 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
+// Test simple arithmetic and assignment for complex numbers.
+
package main
const (
diff --git a/test/ken/cplx2.go b/test/ken/cplx2.go
index b36e93ecd..eb1da7b8c 100644
--- a/test/ken/cplx2.go
+++ b/test/ken/cplx2.go
@@ -1,9 +1,11 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2010 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
+// Test arithmetic on complex numbers, including multiplication and division.
+
package main
const (
@@ -105,4 +107,16 @@ func main() {
println("opcode x", ce, Ce)
panic("fail")
}
+
+ r32 := real(complex64(ce))
+ if r32 != float32(real(Ce)) {
+ println("real(complex64(ce))", r32, real(Ce))
+ panic("fail")
+ }
+
+ r64 := real(complex128(ce))
+ if r64 != real(Ce) {
+ println("real(complex128(ce))", r64, real(Ce))
+ panic("fail")
+ }
}
diff --git a/test/ken/cplx3.go b/test/ken/cplx3.go
index fa6ff1d52..be0b8646a 100644
--- a/test/ken/cplx3.go
+++ b/test/ken/cplx3.go
@@ -1,9 +1,11 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2010 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
+// Test composition, decomposition, and reflection on complex numbers.
+
package main
import "unsafe"
@@ -19,10 +21,29 @@ const (
func main() {
c0 := C1
c0 = (c0 + c0 + c0) / (c0 + c0 + 3i)
- println(c0)
+ r, i := real(c0), imag(c0)
+ d := r - 1.292308
+ if d < 0 {
+ d = - d
+ }
+ if d > 1e-6 {
+ println(r, "!= 1.292308")
+ panic(0)
+ }
+ d = i + 0.1384615
+ if d < 0 {
+ d = - d
+ }
+ if d > 1e-6 {
+ println(i, "!= -0.1384615")
+ panic(0)
+ }
c := *(*complex128)(unsafe.Pointer(&c0))
- println(c)
+ if c != c0 {
+ println(c, "!=", c)
+ panic(0)
+ }
var a interface{}
switch c := reflect.ValueOf(a); c.Kind() {
diff --git a/test/ken/cplx4.go b/test/ken/cplx4.go
index 8524e47ae..97d5d16f4 100644
--- a/test/ken/cplx4.go
+++ b/test/ken/cplx4.go
@@ -1,9 +1,12 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2010 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
+// Test complex numbers,including fmt support.
+// Used to crash.
+
package main
import "fmt"
@@ -15,30 +18,44 @@ const (
C1 = R + I // ADD(5,6)
)
-func doprint(c complex128) { fmt.Printf("c = %f\n", c) }
+func want(s, w string) {
+ if s != w {
+ panic(s + " != " + w)
+ }
+}
+
+func doprint(c complex128, w string) {
+ s := fmt.Sprintf("%f", c)
+ want(s, w)
+}
func main() {
// constants
- fmt.Printf("c = %f\n", -C1)
- doprint(C1)
+ s := fmt.Sprintf("%f", -C1)
+ want(s, "(-5.000000-6.000000i)")
+ doprint(C1, "(5.000000+6.000000i)")
// variables
c1 := C1
- fmt.Printf("c = %f\n", c1)
- doprint(c1)
+ s = fmt.Sprintf("%f", c1)
+ want(s, "(5.000000+6.000000i)")
+ doprint(c1, "(5.000000+6.000000i)")
// 128
c2 := complex128(C1)
- fmt.Printf("c = %G\n", c2)
+ s = fmt.Sprintf("%G", c2)
+ want(s, "(5+6i)")
// real, imag, complex
c3 := complex(real(c2)+3, imag(c2)-5) + c2
- fmt.Printf("c = %G\n", c3)
+ s = fmt.Sprintf("%G", c3)
+ want(s, "(13+7i)")
// compiler used to crash on nested divide
c4 := complex(real(c3/2), imag(c3/2))
if c4 != c3/2 {
fmt.Printf("BUG: c3 = %G != c4 = %G\n", c3, c4)
+ panic(0)
}
}
diff --git a/test/ken/cplx5.go b/test/ken/cplx5.go
index d425a7c4c..4e8f4433d 100644
--- a/test/ken/cplx5.go
+++ b/test/ken/cplx5.go
@@ -1,9 +1,11 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2010 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
+// Test compound types made of complex numbers.
+
package main
var a [12]complex128
@@ -19,36 +21,52 @@ func main() {
for i := 0; i < len(a); i++ {
a[i] = complex(float64(i), float64(-i))
}
- println(a[5])
+ if a[5] != 5-5i {
+ panic(a[5])
+ }
// slice of complex128
s = make([]complex128, len(a))
for i := 0; i < len(s); i++ {
s[i] = a[i]
}
- println(s[5])
+ if s[5] != 5-5i {
+ panic(s[5])
+ }
// chan
c = make(chan complex128)
go chantest(c)
- println(<-c)
+ vc := <-c
+ if vc != 5-5i {
+ panic(vc)
+ }
// pointer of complex128
v := a[5]
pv := &v
- println(*pv)
+ if *pv != 5-5i {
+ panic(*pv)
+ }
// field of complex128
f.c = a[5]
- println(f.c)
+ if f.c != 5-5i {
+ panic(f.c)
+ }
// map of complex128
m = make(map[complex128]complex128)
for i := 0; i < len(s); i++ {
m[-a[i]] = a[i]
}
- println(m[5i-5])
- println(m[complex(-5, 5)])
+ if m[5i-5] != 5-5i {
+ panic(m[5i-5])
+ }
+ vm := m[complex(-5, 5)]
+ if vm != 5-5i {
+ panic(vm)
+ }
}
func chantest(c chan complex128) { c <- a[5] }
diff --git a/test/ken/divconst.go b/test/ken/divconst.go
index c3b9092cd..670e07417 100644
--- a/test/ken/divconst.go
+++ b/test/ken/divconst.go
@@ -1,12 +1,14 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
+// Test integer division by constants.
+
package main
-import "rand"
+import "math/rand"
const Count = 1e5
diff --git a/test/ken/divmod.go b/test/ken/divmod.go
index dc44ea245..f1bd56ec6 100644
--- a/test/ken/divmod.go
+++ b/test/ken/divmod.go
@@ -1,9 +1,11 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
+// Test integer division and modulus.
+
package main
const (
diff --git a/test/ken/embed.go b/test/ken/embed.go
index 9805e479b..9b35c56ac 100644
--- a/test/ken/embed.go
+++ b/test/ken/embed.go
@@ -1,9 +1,11 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
+// Test embedded fields of structs, including methods.
+
package main
diff --git a/test/ken/for.go b/test/ken/for.go
index 176ecd749..db35548db 100644
--- a/test/ken/for.go
+++ b/test/ken/for.go
@@ -1,9 +1,10 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
+// Test simple for loop.
package main
diff --git a/test/ken/interbasic.go b/test/ken/interbasic.go
index 9bb50886a..d8fbb95a3 100644
--- a/test/ken/interbasic.go
+++ b/test/ken/interbasic.go
@@ -1,9 +1,11 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
+// Test interfaces on basic types.
+
package main
type myint int
diff --git a/test/ken/interfun.go b/test/ken/interfun.go
index 94bc7eaad..9432181df 100644
--- a/test/ken/interfun.go
+++ b/test/ken/interfun.go
@@ -1,9 +1,11 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
+// Test interfaces and methods.
+
package main
type S struct {
diff --git a/test/ken/intervar.go b/test/ken/intervar.go
index c2aaaa870..8a2fca0d4 100644
--- a/test/ken/intervar.go
+++ b/test/ken/intervar.go
@@ -1,13 +1,15 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
+// Test interface assignment.
+
package main
type Iputs interface {
- puts (s string);
+ puts (s string) string;
}
// ---------
@@ -17,9 +19,9 @@ type Print struct {
put Iputs;
}
-func (p *Print) dop() {
- print(" print ", p.whoami);
- p.put.puts("abc");
+func (p *Print) dop() string {
+ r := " print " + string(p.whoami + '0')
+ return r + p.put.puts("abc");
}
// ---------
@@ -29,9 +31,9 @@ type Bio struct {
put Iputs;
}
-func (b *Bio) puts(s string) {
- print(" bio ", b.whoami);
- b.put.puts(s);
+func (b *Bio) puts(s string) string {
+ r := " bio " + string(b.whoami + '0')
+ return r + b.put.puts(s);
}
// ---------
@@ -41,8 +43,8 @@ type File struct {
put Iputs;
}
-func (f *File) puts(s string) {
- print(" file ", f.whoami, " -- ", s);
+func (f *File) puts(s string) string {
+ return " file " + string(f.whoami + '0') + " -- " + s
}
func
@@ -59,6 +61,9 @@ main() {
f.whoami = 3;
- p.dop();
- print("\n");
+ r := p.dop();
+ expected := " print 1 bio 2 file 3 -- abc"
+ if r != expected {
+ panic(r + " != " + expected)
+ }
}
diff --git a/test/ken/label.go b/test/ken/label.go
index 770f33e39..fcb3e611d 100644
--- a/test/ken/label.go
+++ b/test/ken/label.go
@@ -1,36 +1,34 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
+// Test goto and labels.
package main
-func
-main() {
- i := 0;
+func main() {
+ i := 0
if false {
- goto gogoloop;
+ goto gogoloop
}
if false {
- goto gogoloop;
+ goto gogoloop
}
if false {
- goto gogoloop;
+ goto gogoloop
}
- goto gogoloop;
+ goto gogoloop
-// backward declared
+ // backward declared
loop:
- i = i+1;
+ i = i + 1
if i < 100 {
- goto loop;
+ goto loop
}
- print(i);
- print("\n");
- return;
+ return
gogoloop:
- goto loop;
+ goto loop
}
diff --git a/test/ken/litfun.go b/test/ken/litfun.go
index bac2bc17c..e241d4edb 100644
--- a/test/ken/litfun.go
+++ b/test/ken/litfun.go
@@ -1,9 +1,10 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
+// Test simple function literals.
package main
diff --git a/test/ken/mfunc.go b/test/ken/mfunc.go
index ae0bc0c58..ef2499194 100644
--- a/test/ken/mfunc.go
+++ b/test/ken/mfunc.go
@@ -1,9 +1,11 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
+// Test simple multi-argument multi-valued function.
+
package main
func
diff --git a/test/ken/modconst.go b/test/ken/modconst.go
index acb8831ef..d88cf1003 100644
--- a/test/ken/modconst.go
+++ b/test/ken/modconst.go
@@ -1,12 +1,14 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
+// Test integer modulus by contstants.
+
package main
-import "rand"
+import "math/rand"
const Count = 1e5
diff --git a/test/ken/ptrfun.go b/test/ken/ptrfun.go
index 6739ba33a..af806cfd9 100644
--- a/test/ken/ptrfun.go
+++ b/test/ken/ptrfun.go
@@ -1,9 +1,10 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
+// Test method invocation with pointer receivers and function-valued fields.
package main
diff --git a/test/ken/ptrvar.go b/test/ken/ptrvar.go
index e2ddde629..d78170c9d 100644
--- a/test/ken/ptrvar.go
+++ b/test/ken/ptrvar.go
@@ -1,9 +1,10 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
+// Test pointers and the . (selector) operator on structs.
package main
diff --git a/test/ken/range.go b/test/ken/range.go
index 9535fd497..89c14e5c3 100644
--- a/test/ken/range.go
+++ b/test/ken/range.go
@@ -1,9 +1,11 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
+// Test 'for range' on arrays, slices, and maps.
+
package main
const size = 16
diff --git a/test/ken/rob1.go b/test/ken/rob1.go
index 03350662a..3042a671b 100644
--- a/test/ken/rob1.go
+++ b/test/ken/rob1.go
@@ -1,67 +1,72 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
+// Test general operation using a list implementation.
+
package main
type Item interface {
- Print();
+ Print() string
}
type ListItem struct {
- item Item;
- next *ListItem;
+ item Item
+ next *ListItem
}
type List struct {
- head *ListItem;
+ head *ListItem
}
func (list *List) Init() {
- list.head = nil;
+ list.head = nil
}
func (list *List) Insert(i Item) {
- item := new(ListItem);
- item.item = i;
- item.next = list.head;
- list.head = item;
+ item := new(ListItem)
+ item.item = i
+ item.next = list.head
+ list.head = item
}
-func (list *List) Print() {
- i := list.head;
+func (list *List) Print() string {
+ r := ""
+ i := list.head
for i != nil {
- i.item.Print();
- i = i.next;
+ r += i.item.Print()
+ i = i.next
}
+ return r
}
// Something to put in a list
type Integer struct {
- val int;
+ val int
}
func (this *Integer) Init(i int) *Integer {
- this.val = i;
- return this;
+ this.val = i
+ return this
}
-func (this *Integer) Print() {
- print(this.val);
+func (this *Integer) Print() string {
+ return string(this.val + '0')
}
-func
-main() {
- list := new(List);
- list.Init();
+func main() {
+ list := new(List)
+ list.Init()
for i := 0; i < 10; i = i + 1 {
- integer := new(Integer);
- integer.Init(i);
- list.Insert(integer);
+ integer := new(Integer)
+ integer.Init(i)
+ list.Insert(integer)
}
- list.Print();
- print("\n");
+ r := list.Print()
+ if r != "9876543210" {
+ panic(r)
+ }
}
diff --git a/test/ken/rob2.go b/test/ken/rob2.go
index af63e4d9f..4b4410ee8 100644
--- a/test/ken/rob2.go
+++ b/test/ken/rob2.go
@@ -1,272 +1,280 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
+// Test general operation using s-list.
+// First Go program ever run (although not in this exact form).
package main
-const nilchar = 0;
+import "fmt"
+
+const nilchar = 0
type Atom struct {
- str string;
- integer int;
- next *Slist; /* in hash bucket */
+ str string
+ integer int
+ next *Slist /* in hash bucket */
}
type List struct {
- car *Slist;
- cdr*Slist;
+ car *Slist
+ cdr *Slist
}
type Slist struct {
- isatom bool;
- isstring bool;
+ isatom bool
+ isstring bool
//union {
- atom Atom;
- list List;
+ atom Atom
+ list List
//} u;
}
func (this *Slist) Car() *Slist {
- return this.list.car;
+ return this.list.car
}
func (this *Slist) Cdr() *Slist {
- return this.list.cdr;
+ return this.list.cdr
}
func (this *Slist) String() string {
- return this.atom.str;
+ return this.atom.str
}
func (this *Slist) Integer() int {
- return this.atom.integer;
+ return this.atom.integer
}
func (slist *Slist) Free() {
if slist == nil {
- return;
+ return
}
if slist.isatom {
-// free(slist.String());
+ // free(slist.String());
} else {
- slist.Car().Free();
- slist.Cdr().Free();
+ slist.Car().Free()
+ slist.Cdr().Free()
}
-// free(slist);
+ // free(slist);
}
//Slist* atom(byte *s, int i);
-var token int;
-var peekc int = -1;
-var lineno int32 = 1;
+var token int
+var peekc int = -1
+var lineno int32 = 1
-var input string;
-var inputindex int = 0;
-var tokenbuf [100]byte;
-var tokenlen int = 0;
+var input string
+var inputindex int = 0
+var tokenbuf [100]byte
+var tokenlen int = 0
-const EOF int = -1;
+const EOF int = -1
func main() {
- var list *Slist;
+ var list *Slist
- OpenFile();
- for ;; {
- list = Parse();
+ OpenFile()
+ for {
+ list = Parse()
if list == nil {
- break;
+ break
+ }
+ r := list.Print()
+ list.Free()
+ if r != "(defn foo (add 12 34))" {
+ panic(r)
}
- list.Print();
- list.Free();
- break;
+ break
}
}
-func (slist *Slist) PrintOne(doparen bool) {
+func (slist *Slist) PrintOne(doparen bool) string {
if slist == nil {
- return;
+ return ""
}
+ var r string
if slist.isatom {
if slist.isstring {
- print(slist.String());
+ r = slist.String()
} else {
- print(slist.Integer());
+ r = fmt.Sprintf("%v", slist.Integer())
}
} else {
if doparen {
- print("(" );
+ r += "("
}
- slist.Car().PrintOne(true);
+ r += slist.Car().PrintOne(true)
if slist.Cdr() != nil {
- print(" ");
- slist.Cdr().PrintOne(false);
+ r += " "
+ r += slist.Cdr().PrintOne(false)
}
if doparen {
- print(")");
+ r += ")"
}
}
+ return r
}
-func (slist *Slist) Print() {
- slist.PrintOne(true);
- print("\n");
+func (slist *Slist) Print() string {
+ return slist.PrintOne(true)
}
func Get() int {
- var c int;
+ var c int
if peekc >= 0 {
- c = peekc;
- peekc = -1;
+ c = peekc
+ peekc = -1
} else {
- c = int(input[inputindex]);
- inputindex++;
+ c = int(input[inputindex])
+ inputindex++
if c == '\n' {
- lineno = lineno + 1;
+ lineno = lineno + 1
}
if c == nilchar {
- inputindex = inputindex - 1;
- c = EOF;
+ inputindex = inputindex - 1
+ c = EOF
}
}
- return c;
+ return c
}
func WhiteSpace(c int) bool {
- return c == ' ' || c == '\t' || c == '\r' || c == '\n';
+ return c == ' ' || c == '\t' || c == '\r' || c == '\n'
}
func NextToken() {
- var i, c int;
+ var i, c int
- tokenbuf[0] = nilchar; // clear previous token
- c = Get();
+ tokenbuf[0] = nilchar // clear previous token
+ c = Get()
for WhiteSpace(c) {
- c = Get();
+ c = Get()
}
switch c {
case EOF:
- token = EOF;
+ token = EOF
case '(', ')':
- token = c;
- break;
+ token = c
+ break
default:
- for i = 0; i < 100 - 1; { // sizeof tokenbuf - 1
- tokenbuf[i] = byte(c);
- i = i + 1;
- c = Get();
+ for i = 0; i < 100-1; { // sizeof tokenbuf - 1
+ tokenbuf[i] = byte(c)
+ i = i + 1
+ c = Get()
if c == EOF {
- break;
+ break
}
if WhiteSpace(c) || c == ')' {
- peekc = c;
- break;
+ peekc = c
+ break
}
}
- if i >= 100 - 1 { // sizeof tokenbuf - 1
- panic("atom too long\n");
+ if i >= 100-1 { // sizeof tokenbuf - 1
+ panic("atom too long\n")
}
- tokenlen = i;
- tokenbuf[i] = nilchar;
+ tokenlen = i
+ tokenbuf[i] = nilchar
if '0' <= tokenbuf[0] && tokenbuf[0] <= '9' {
- token = '0';
+ token = '0'
} else {
- token = 'A';
+ token = 'A'
}
}
}
func Expect(c int) {
if token != c {
- print("parse error: expected ", c, "\n");
- panic("parse");
+ print("parse error: expected ", c, "\n")
+ panic("parse")
}
- NextToken();
+ NextToken()
}
// Parse a non-parenthesized list up to a closing paren or EOF
func ParseList() *Slist {
- var slist, retval *Slist;
-
- slist = new(Slist);
- slist.list.car = nil;
- slist.list.cdr = nil;
- slist.isatom = false;
- slist.isstring = false;
-
- retval = slist;
- for ;; {
- slist.list.car = Parse();
- if token == ')' || token == EOF { // empty cdr
- break;
+ var slist, retval *Slist
+
+ slist = new(Slist)
+ slist.list.car = nil
+ slist.list.cdr = nil
+ slist.isatom = false
+ slist.isstring = false
+
+ retval = slist
+ for {
+ slist.list.car = Parse()
+ if token == ')' || token == EOF { // empty cdr
+ break
}
- slist.list.cdr = new(Slist);
- slist = slist.list.cdr;
+ slist.list.cdr = new(Slist)
+ slist = slist.list.cdr
}
- return retval;
+ return retval
}
-func atom(i int) *Slist { // BUG: uses tokenbuf; should take argument)
- var slist *Slist;
+func atom(i int) *Slist { // BUG: uses tokenbuf; should take argument)
+ var slist *Slist
- slist = new(Slist);
+ slist = new(Slist)
if token == '0' {
- slist.atom.integer = i;
- slist.isstring = false;
+ slist.atom.integer = i
+ slist.isstring = false
} else {
- slist.atom.str = string(tokenbuf[0:tokenlen]);
- slist.isstring = true;
+ slist.atom.str = string(tokenbuf[0:tokenlen])
+ slist.isstring = true
}
- slist.isatom = true;
- return slist;
+ slist.isatom = true
+ return slist
}
-func atoi() int { // BUG: uses tokenbuf; should take argument)
- var v int = 0;
+func atoi() int { // BUG: uses tokenbuf; should take argument)
+ var v int = 0
for i := 0; i < tokenlen && '0' <= tokenbuf[i] && tokenbuf[i] <= '9'; i = i + 1 {
- v = 10 * v + int(tokenbuf[i] - '0');
+ v = 10*v + int(tokenbuf[i]-'0')
}
- return v;
+ return v
}
func Parse() *Slist {
- var slist *Slist;
+ var slist *Slist
if token == EOF || token == ')' {
- return nil;
+ return nil
}
if token == '(' {
- NextToken();
- slist = ParseList();
- Expect(')');
- return slist;
+ NextToken()
+ slist = ParseList()
+ Expect(')')
+ return slist
} else {
// Atom
switch token {
case EOF:
- return nil;
+ return nil
case '0':
- slist = atom(atoi());
+ slist = atom(atoi())
case '"', 'A':
- slist = atom(0);
+ slist = atom(0)
default:
- slist = nil;
- print("unknown token: ", token, "\n");
+ slist = nil
+ print("unknown token: ", token, "\n")
}
- NextToken();
- return slist;
+ NextToken()
+ return slist
}
- return nil;
+ return nil
}
func OpenFile() {
- input = "(defn foo (add 12 34))\n\x00";
- inputindex = 0;
- peekc = -1; // BUG
- NextToken();
+ input = "(defn foo (add 12 34))\n\x00"
+ inputindex = 0
+ peekc = -1 // BUG
+ NextToken()
}
diff --git a/test/ken/robfor.go b/test/ken/robfor.go
index 05188a472..c6a420b39 100644
--- a/test/ken/robfor.go
+++ b/test/ken/robfor.go
@@ -1,9 +1,11 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
+// Test for loops of many forms.
+
package main
func assertequal(is, shouldbe int, msg string) {
diff --git a/test/ken/robfunc.go b/test/ken/robfunc.go
index 6b3d4b2e4..885267e30 100644
--- a/test/ken/robfunc.go
+++ b/test/ken/robfunc.go
@@ -1,9 +1,11 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
+// Test functions of many signatures.
+
package main
func assertequal(is, shouldbe int, msg string) {
diff --git a/test/ken/shift.go b/test/ken/shift.go
index 157a07aec..af8789615 100644
--- a/test/ken/shift.go
+++ b/test/ken/shift.go
@@ -1,9 +1,11 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
+// Test shift.
+
package main
var ians [18]int;
diff --git a/test/ken/simparray.go b/test/ken/simparray.go
index 1b6f245ee..0e81a341b 100644
--- a/test/ken/simparray.go
+++ b/test/ken/simparray.go
@@ -1,9 +1,11 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
+// Test simple operations on arrays.
+
package main
var b[10] float32;
diff --git a/test/ken/simpbool.go b/test/ken/simpbool.go
index dbd9c8d8b..ab2ecc21a 100644
--- a/test/ken/simpbool.go
+++ b/test/ken/simpbool.go
@@ -1,9 +1,11 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
+// Test basic operations on bool.
+
package main
type s struct {
diff --git a/test/ken/simpconv.go b/test/ken/simpconv.go
index feb85d299..22cad2ad0 100644
--- a/test/ken/simpconv.go
+++ b/test/ken/simpconv.go
@@ -1,9 +1,11 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
+// Test simple arithmetic conversion.
+
package main
type vlong int64
diff --git a/test/ken/simpfun.go b/test/ken/simpfun.go
index ba9ce6f7b..e5dc2b249 100644
--- a/test/ken/simpfun.go
+++ b/test/ken/simpfun.go
@@ -1,9 +1,10 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
+// Test simple functions.
package main
diff --git a/test/ken/simpprint.go b/test/ken/simpprint.go
deleted file mode 100644
index 6077f7eb0..000000000
--- a/test/ken/simpprint.go
+++ /dev/null
@@ -1,13 +0,0 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
-
-// Copyright 2009 The Go Authors. All rights reserved.
-// Use of this source code is governed by a BSD-style
-// license that can be found in the LICENSE file.
-
-
-package main
-
-func
-main() {
- print("hello world\n");
-}
diff --git a/test/ken/simpswitch.go b/test/ken/simpswitch.go
index ab5dd356b..b28250b1d 100644
--- a/test/ken/simpswitch.go
+++ b/test/ken/simpswitch.go
@@ -1,24 +1,28 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
+// Test simple switch.
+
package main
-func
-main() {
- a := 3;
- for i:=0; i<10; i=i+1 {
- switch(i) {
+func main() {
+ r := ""
+ a := 3
+ for i := 0; i < 10; i = i + 1 {
+ switch i {
case 5:
- print("five");
- case a,7:
- print("a");
+ r += "five"
+ case a, 7:
+ r += "a"
default:
- print(i);
+ r += string(i + '0')
}
- print("out", i);
+ r += "out" + string(i+'0')
+ }
+ if r != "0out01out12out2aout34out4fiveout56out6aout78out89out9" {
+ panic(r)
}
- print("\n");
}
diff --git a/test/ken/simpvar.go b/test/ken/simpvar.go
index fd060b0e2..c6eefbb5a 100644
--- a/test/ken/simpvar.go
+++ b/test/ken/simpvar.go
@@ -1,9 +1,11 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
+// Test scoping of variables.
+
package main
diff --git a/test/ken/slicearray.go b/test/ken/slicearray.go
index 5c31270fc..6cf676c58 100644
--- a/test/ken/slicearray.go
+++ b/test/ken/slicearray.go
@@ -1,9 +1,11 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
+// Test basic operations of slices and arrays.
+
package main
var bx [10]byte
diff --git a/test/ken/sliceslice.go b/test/ken/sliceslice.go
index 639042128..c07c59125 100644
--- a/test/ken/sliceslice.go
+++ b/test/ken/sliceslice.go
@@ -1,9 +1,11 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
+// Test slicing and re-slicing.
+
package main
var bx []byte
diff --git a/test/ken/string.go b/test/ken/string.go
index cbedad4e8..6df8dc4dd 100644
--- a/test/ken/string.go
+++ b/test/ken/string.go
@@ -1,9 +1,10 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// cmpout
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
+// Test string operations including printing.
package main
@@ -71,16 +72,14 @@ func main() {
/* create string with integer constant */
c = string('x')
if c != "x" {
- print("create int ", c)
- panic("fail")
+ panic("create int " + c)
}
/* create string with integer variable */
v := 'x'
c = string(v)
if c != "x" {
- print("create int ", c)
- panic("fail")
+ panic("create int " + c)
}
/* create string with byte array */
@@ -90,19 +89,17 @@ func main() {
z1[2] = 'c'
c = string(z1[0:])
if c != "abc" {
- print("create byte array ", c)
- panic("fail")
+ panic("create byte array " + c)
}
/* create string with int array */
- var z2 [3]int
+ var z2 [3]rune
z2[0] = 'a'
z2[1] = '\u1234'
z2[2] = 'c'
c = string(z2[0:])
if c != "a\u1234c" {
- print("create int array ", c)
- panic("fail")
+ panic("create int array " + c)
}
/* create string with byte array pointer */
@@ -112,7 +109,6 @@ func main() {
z3[2] = 'c'
c = string(z3[0:])
if c != "abc" {
- print("create array pointer ", c)
- panic("fail")
+ panic("create array pointer " + c)
}
}
diff --git a/test/ken/string.out b/test/ken/string.out
new file mode 100644
index 000000000..8bc36bc6f
--- /dev/null
+++ b/test/ken/string.out
@@ -0,0 +1 @@
+abcxyz-abcxyz-abcxyz-abcxyz-abcxyz-abcxyz-abcxyz
diff --git a/test/ken/strvar.go b/test/ken/strvar.go
index dfaaf1213..4d511fe67 100644
--- a/test/ken/strvar.go
+++ b/test/ken/strvar.go
@@ -1,9 +1,10 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
+// Test struct-valued variables (not pointers).
package main
diff --git a/test/label.go b/test/label.go
index e3d853266..b30c27ec4 100644
--- a/test/label.go
+++ b/test/label.go
@@ -1,10 +1,12 @@
-// errchk $G -e $D/$F.go
+// errorcheck
// Copyright 2011 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
-// Pass 1 label errors.
+// Verify that erroneous labels are caught by the compiler.
+// This set is caught by pass 1.
+// Does not compile.
package main
diff --git a/test/label1.go b/test/label1.go
index 656daaeea..f923a1882 100644
--- a/test/label1.go
+++ b/test/label1.go
@@ -1,10 +1,13 @@
-// errchk $G -e $D/$F.go
+// errorcheck
// Copyright 2011 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
-// Pass 2 label errors.
+
+// Verify that erroneous labels are caught by the compiler.
+// This set is caught by pass 2. That's why this file is label1.go.
+// Does not compile.
package main
diff --git a/test/linkx.go b/test/linkx.go
new file mode 100644
index 000000000..d2c954567
--- /dev/null
+++ b/test/linkx.go
@@ -0,0 +1,17 @@
+// $G $D/$F.go && $L -X main.tbd hello $F.$A && ./$A.out
+
+// Copyright 2012 The Go Authors. All rights reserved.
+// Use of this source code is governed by a BSD-style
+// license that can be found in the LICENSE file.
+
+// Test the -X facility of the gc linker (6l etc.).
+
+package main
+
+var tbd string
+
+func main() {
+ if tbd != "hello" {
+ println("BUG: test/linkx", len(tbd), tbd)
+ }
+}
diff --git a/test/literal.go b/test/literal.go
index bf0538812..ba185fc9a 100644
--- a/test/literal.go
+++ b/test/literal.go
@@ -1,9 +1,11 @@
-// $G $F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
+// Test literal syntax for basic types.
+
package main
var nbad int
diff --git a/test/malloc1.go b/test/malloc1.go
deleted file mode 100644
index 61f1797c7..000000000
--- a/test/malloc1.go
+++ /dev/null
@@ -1,25 +0,0 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
-
-// Copyright 2009 The Go Authors. All rights reserved.
-// Use of this source code is governed by a BSD-style
-// license that can be found in the LICENSE file.
-
-// trivial malloc test
-
-package main
-
-import (
- "flag"
- "fmt"
- "runtime"
-)
-
-var chatty = flag.Bool("v", false, "chatty")
-
-func main() {
- runtime.Free(runtime.Alloc(1))
- runtime.UpdateMemStats()
- if *chatty {
- fmt.Printf("%+v %v\n", runtime.MemStats, uint64(0))
- }
-}
diff --git a/test/mallocfin.go b/test/mallocfin.go
index dc6d74bad..be6d79b2b 100644
--- a/test/mallocfin.go
+++ b/test/mallocfin.go
@@ -1,10 +1,10 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
-// trivial finalizer test
+// Test basic operation of finalizers.
package main
@@ -47,18 +47,28 @@ func finalB(b *B) {
nfinal++
}
+func nofinalB(b *B) {
+ panic("nofinalB run")
+}
+
func main() {
runtime.GOMAXPROCS(4)
for i = 0; i < N; i++ {
b := &B{i}
a := &A{b, i}
+ c := new(B)
+ runtime.SetFinalizer(c, nofinalB)
runtime.SetFinalizer(b, finalB)
runtime.SetFinalizer(a, finalA)
+ runtime.SetFinalizer(c, nil)
}
for i := 0; i < N; i++ {
runtime.GC()
runtime.Gosched()
time.Sleep(1e6)
+ if nfinal >= N*8/10 {
+ break
+ }
}
if nfinal < N*8/10 {
println("not enough finalizing:", nfinal, "/", N)
diff --git a/test/mallocrand.go b/test/mallocrand.go
deleted file mode 100644
index f014b441b..000000000
--- a/test/mallocrand.go
+++ /dev/null
@@ -1,92 +0,0 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
-
-// Copyright 2009 The Go Authors. All rights reserved.
-// Use of this source code is governed by a BSD-style
-// license that can be found in the LICENSE file.
-
-// Random malloc test.
-
-package main
-
-import (
- "flag"
- "rand"
- "runtime"
- "unsafe"
-)
-
-var chatty = flag.Bool("v", false, "chatty")
-
-var footprint uint64
-var allocated uint64
-
-func bigger() {
- runtime.UpdateMemStats()
- if f := runtime.MemStats.Sys; footprint < f {
- footprint = f
- if *chatty {
- println("Footprint", footprint, " for ", allocated)
- }
- if footprint > 1e9 {
- println("too big")
- panic("fail")
- }
- }
-}
-
-// Prime the data structures by allocating one of
-// each block in order. After this, there should be
-// little reason to ask for more memory from the OS.
-func prime() {
- for i := 0; i < 16; i++ {
- b := runtime.Alloc(1 << uint(i))
- runtime.Free(b)
- }
- for i := uintptr(0); i < 256; i++ {
- b := runtime.Alloc(i << 12)
- runtime.Free(b)
- }
-}
-
-func memset(b *byte, c byte, n uintptr) {
- np := uintptr(n)
- for i := uintptr(0); i < np; i++ {
- *(*byte)(unsafe.Pointer(uintptr(unsafe.Pointer(b)) + i)) = c
- }
-}
-
-func main() {
- flag.Parse()
- // prime()
- var blocks [1]struct {
- base *byte
- siz uintptr
- }
- for i := 0; i < 1<<10; i++ {
- if i%(1<<10) == 0 && *chatty {
- println(i)
- }
- b := rand.Int() % len(blocks)
- if blocks[b].base != nil {
- // println("Free", blocks[b].siz, blocks[b].base)
- runtime.Free(blocks[b].base)
- blocks[b].base = nil
- allocated -= uint64(blocks[b].siz)
- continue
- }
- siz := uintptr(rand.Int() >> (11 + rand.Uint32()%20))
- base := runtime.Alloc(siz)
- // ptr := uintptr(syscall.BytePtr(base))+uintptr(siz/2)
- // obj, size, ref, ok := allocator.find(ptr)
- // if obj != base || *ref != 0 || !ok {
- // println("find", siz, obj, ref, ok)
- // panic("fail")
- // }
- blocks[b].base = base
- blocks[b].siz = siz
- allocated += uint64(siz)
- // println("Alloc", siz, base)
- memset(base, 0xbb, siz)
- bigger()
- }
-}
diff --git a/test/mallocrep.go b/test/mallocrep.go
deleted file mode 100644
index 9f47e52e2..000000000
--- a/test/mallocrep.go
+++ /dev/null
@@ -1,69 +0,0 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
-
-// Copyright 2009 The Go Authors. All rights reserved.
-// Use of this source code is governed by a BSD-style
-// license that can be found in the LICENSE file.
-
-// Repeated malloc test.
-
-package main
-
-import (
- "flag"
- "runtime"
-)
-
-var chatty = flag.Bool("v", false, "chatty")
-
-var oldsys uint64
-
-func bigger() {
- runtime.UpdateMemStats()
- if st := runtime.MemStats; oldsys < st.Sys {
- oldsys = st.Sys
- if *chatty {
- println(st.Sys, " system bytes for ", st.Alloc, " Go bytes")
- }
- if st.Sys > 1e9 {
- println("too big")
- panic("fail")
- }
- }
-}
-
-func main() {
- runtime.GC() // clean up garbage from init
- runtime.MemProfileRate = 0 // disable profiler
- runtime.MemStats.Alloc = 0 // ignore stacks
- flag.Parse()
- for i := 0; i < 1<<7; i++ {
- for j := 1; j <= 1<<22; j <<= 1 {
- if i == 0 && *chatty {
- println("First alloc:", j)
- }
- if a := runtime.MemStats.Alloc; a != 0 {
- println("no allocations but stats report", a, "bytes allocated")
- panic("fail")
- }
- b := runtime.Alloc(uintptr(j))
- runtime.UpdateMemStats()
- during := runtime.MemStats.Alloc
- runtime.Free(b)
- runtime.UpdateMemStats()
- if a := runtime.MemStats.Alloc; a != 0 {
- println("allocated ", j, ": wrong stats: during=", during, " after=", a, " (want 0)")
- panic("fail")
- }
- bigger()
- }
- if i%(1<<10) == 0 && *chatty {
- println(i)
- }
- if i == 0 {
- if *chatty {
- println("Primed", i)
- }
- // runtime.frozen = true
- }
- }
-}
diff --git a/test/mallocrep1.go b/test/mallocrep1.go
deleted file mode 100644
index 0b1479900..000000000
--- a/test/mallocrep1.go
+++ /dev/null
@@ -1,143 +0,0 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
-
-// Copyright 2009 The Go Authors. All rights reserved.
-// Use of this source code is governed by a BSD-style
-// license that can be found in the LICENSE file.
-
-// Repeated malloc test.
-
-package main
-
-import (
- "flag"
- "fmt"
- "runtime"
- "strconv"
-)
-
-var chatty = flag.Bool("v", false, "chatty")
-var reverse = flag.Bool("r", false, "reverse")
-var longtest = flag.Bool("l", false, "long test")
-
-var b []*byte
-var stats = &runtime.MemStats
-
-func OkAmount(size, n uintptr) bool {
- if n < size {
- return false
- }
- if size < 16*8 {
- if n > size+16 {
- return false
- }
- } else {
- if n > size*9/8 {
- return false
- }
- }
- return true
-}
-
-func AllocAndFree(size, count int) {
- if *chatty {
- fmt.Printf("size=%d count=%d ...\n", size, count)
- }
- runtime.UpdateMemStats()
- n1 := stats.Alloc
- for i := 0; i < count; i++ {
- b[i] = runtime.Alloc(uintptr(size))
- base, n := runtime.Lookup(b[i])
- if base != b[i] || !OkAmount(uintptr(size), n) {
- println("lookup failed: got", base, n, "for", b[i])
- panic("fail")
- }
- runtime.UpdateMemStats()
- if stats.Sys > 1e9 {
- println("too much memory allocated")
- panic("fail")
- }
- }
- runtime.UpdateMemStats()
- n2 := stats.Alloc
- if *chatty {
- fmt.Printf("size=%d count=%d stats=%+v\n", size, count, *stats)
- }
- n3 := stats.Alloc
- for j := 0; j < count; j++ {
- i := j
- if *reverse {
- i = count - 1 - j
- }
- alloc := uintptr(stats.Alloc)
- base, n := runtime.Lookup(b[i])
- if base != b[i] || !OkAmount(uintptr(size), n) {
- println("lookup failed: got", base, n, "for", b[i])
- panic("fail")
- }
- runtime.Free(b[i])
- runtime.UpdateMemStats()
- if stats.Alloc != uint64(alloc-n) {
- println("free alloc got", stats.Alloc, "expected", alloc-n, "after free of", n)
- panic("fail")
- }
- if runtime.MemStats.Sys > 1e9 {
- println("too much memory allocated")
- panic("fail")
- }
- }
- runtime.UpdateMemStats()
- n4 := stats.Alloc
-
- if *chatty {
- fmt.Printf("size=%d count=%d stats=%+v\n", size, count, *stats)
- }
- if n2-n1 != n3-n4 {
- println("wrong alloc count: ", n2-n1, n3-n4)
- panic("fail")
- }
-}
-
-func atoi(s string) int {
- i, _ := strconv.Atoi(s)
- return i
-}
-
-func main() {
- runtime.MemProfileRate = 0 // disable profiler
- flag.Parse()
- b = make([]*byte, 10000)
- if flag.NArg() > 0 {
- AllocAndFree(atoi(flag.Arg(0)), atoi(flag.Arg(1)))
- return
- }
- maxb := 1 << 22
- if !*longtest {
- maxb = 1 << 19
- }
- for j := 1; j <= maxb; j <<= 1 {
- n := len(b)
- max := uintptr(1 << 28)
- if !*longtest {
- max = uintptr(maxb)
- }
- if uintptr(j)*uintptr(n) > max {
- n = int(max / uintptr(j))
- }
- if n < 10 {
- n = 10
- }
- for m := 1; m <= n; {
- AllocAndFree(j, m)
- if m == n {
- break
- }
- m = 5 * m / 4
- if m < 4 {
- m++
- }
- if m > n {
- m = n
- }
- }
- }
-}
diff --git a/test/map.go b/test/map.go
index c3963499b..6dec0dfd7 100644
--- a/test/map.go
+++ b/test/map.go
@@ -1,14 +1,18 @@
-// $G $F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
+// Test maps, almost exhaustively.
+
package main
import (
"fmt"
+ "math"
"strconv"
+ "time"
)
const count = 100
@@ -26,6 +30,12 @@ func P(a []string) string {
}
func main() {
+ testbasic()
+ testfloat()
+ testnan()
+}
+
+func testbasic() {
// Test a map literal.
mlit := map[string]int{"0": 0, "1": 1, "2": 2, "3": 3, "4": 4}
for i := 0; i < len(mlit); i++ {
@@ -479,7 +489,7 @@ func main() {
mipM[i][i]++
if mipM[i][i] != (i+1)+1 {
- fmt.Printf("update mipM[%d][%d] = %i\n", i, i, mipM[i][i])
+ fmt.Printf("update mipM[%d][%d] = %d\n", i, i, mipM[i][i])
}
}
@@ -489,3 +499,195 @@ func main() {
panic("range mnil")
}
}
+
+func testfloat() {
+ // Test floating point numbers in maps.
+ // Two map keys refer to the same entry if the keys are ==.
+ // The special cases, then, are that +0 == -0 and that NaN != NaN.
+
+ {
+ var (
+ pz = float32(0)
+ nz = math.Float32frombits(1 << 31)
+ nana = float32(math.NaN())
+ nanb = math.Float32frombits(math.Float32bits(nana) ^ 2)
+ )
+
+ m := map[float32]string{
+ pz: "+0",
+ nana: "NaN",
+ nanb: "NaN",
+ }
+ if m[pz] != "+0" {
+ fmt.Println("float32 map cannot read back m[+0]:", m[pz])
+ }
+ if m[nz] != "+0" {
+ fmt.Println("float32 map does not treat", pz, "and", nz, "as equal for read")
+ fmt.Println("float32 map does not treat -0 and +0 as equal for read")
+ }
+ m[nz] = "-0"
+ if m[pz] != "-0" {
+ fmt.Println("float32 map does not treat -0 and +0 as equal for write")
+ }
+ if _, ok := m[nana]; ok {
+ fmt.Println("float32 map allows NaN lookup (a)")
+ }
+ if _, ok := m[nanb]; ok {
+ fmt.Println("float32 map allows NaN lookup (b)")
+ }
+ if len(m) != 3 {
+ fmt.Println("float32 map should have 3 entries:", m)
+ }
+ m[nana] = "NaN"
+ m[nanb] = "NaN"
+ if len(m) != 5 {
+ fmt.Println("float32 map should have 5 entries:", m)
+ }
+ }
+
+ {
+ var (
+ pz = float64(0)
+ nz = math.Float64frombits(1 << 63)
+ nana = float64(math.NaN())
+ nanb = math.Float64frombits(math.Float64bits(nana) ^ 2)
+ )
+
+ m := map[float64]string{
+ pz: "+0",
+ nana: "NaN",
+ nanb: "NaN",
+ }
+ if m[nz] != "+0" {
+ fmt.Println("float64 map does not treat -0 and +0 as equal for read")
+ }
+ m[nz] = "-0"
+ if m[pz] != "-0" {
+ fmt.Println("float64 map does not treat -0 and +0 as equal for write")
+ }
+ if _, ok := m[nana]; ok {
+ fmt.Println("float64 map allows NaN lookup (a)")
+ }
+ if _, ok := m[nanb]; ok {
+ fmt.Println("float64 map allows NaN lookup (b)")
+ }
+ if len(m) != 3 {
+ fmt.Println("float64 map should have 3 entries:", m)
+ }
+ m[nana] = "NaN"
+ m[nanb] = "NaN"
+ if len(m) != 5 {
+ fmt.Println("float64 map should have 5 entries:", m)
+ }
+ }
+
+ {
+ var (
+ pz = complex64(0)
+ nz = complex(0, math.Float32frombits(1<<31))
+ nana = complex(5, float32(math.NaN()))
+ nanb = complex(5, math.Float32frombits(math.Float32bits(float32(math.NaN()))^2))
+ )
+
+ m := map[complex64]string{
+ pz: "+0",
+ nana: "NaN",
+ nanb: "NaN",
+ }
+ if m[nz] != "+0" {
+ fmt.Println("complex64 map does not treat -0 and +0 as equal for read")
+ }
+ m[nz] = "-0"
+ if m[pz] != "-0" {
+ fmt.Println("complex64 map does not treat -0 and +0 as equal for write")
+ }
+ if _, ok := m[nana]; ok {
+ fmt.Println("complex64 map allows NaN lookup (a)")
+ }
+ if _, ok := m[nanb]; ok {
+ fmt.Println("complex64 map allows NaN lookup (b)")
+ }
+ if len(m) != 3 {
+ fmt.Println("complex64 map should have 3 entries:", m)
+ }
+ m[nana] = "NaN"
+ m[nanb] = "NaN"
+ if len(m) != 5 {
+ fmt.Println("complex64 map should have 5 entries:", m)
+ }
+ }
+
+ {
+ var (
+ pz = complex128(0)
+ nz = complex(0, math.Float64frombits(1<<63))
+ nana = complex(5, float64(math.NaN()))
+ nanb = complex(5, math.Float64frombits(math.Float64bits(float64(math.NaN()))^2))
+ )
+
+ m := map[complex128]string{
+ pz: "+0",
+ nana: "NaN",
+ nanb: "NaN",
+ }
+ if m[nz] != "+0" {
+ fmt.Println("complex128 map does not treat -0 and +0 as equal for read")
+ }
+ m[nz] = "-0"
+ if m[pz] != "-0" {
+ fmt.Println("complex128 map does not treat -0 and +0 as equal for write")
+ }
+ if _, ok := m[nana]; ok {
+ fmt.Println("complex128 map allows NaN lookup (a)")
+ }
+ if _, ok := m[nanb]; ok {
+ fmt.Println("complex128 map allows NaN lookup (b)")
+ }
+ if len(m) != 3 {
+ fmt.Println("complex128 map should have 3 entries:", m)
+ }
+ m[nana] = "NaN"
+ m[nanb] = "NaN"
+ if len(m) != 5 {
+ fmt.Println("complex128 map should have 5 entries:", m)
+ }
+ }
+}
+
+func testnan() {
+ // Test that NaNs in maps don't go quadratic.
+ t := func(n int) time.Duration {
+ t0 := time.Now()
+ m := map[float64]int{}
+ nan := math.NaN()
+ for i := 0; i < n; i++ {
+ m[nan] = 1
+ }
+ if len(m) != n {
+ panic("wrong size map after nan insertion")
+ }
+ return time.Since(t0)
+ }
+
+ // Depending on the machine and OS, this test might be too fast
+ // to measure with accurate enough granularity. On failure,
+ // make it run longer, hoping that the timing granularity
+ // is eventually sufficient.
+
+ n := 30000 // 0.02 seconds on a MacBook Air
+ fails := 0
+ for {
+ t1 := t(n)
+ t2 := t(2 * n)
+ // should be 2x (linear); allow up to 3x
+ if t2 < 3*t1 {
+ return
+ }
+ fails++
+ if fails == 4 {
+ fmt.Printf("too slow: %d inserts: %v; %d inserts: %v\n", n, t1, 2*n, t2)
+ return
+ }
+ n *= 2
+ }
+}
diff --git a/test/map1.go b/test/map1.go
new file mode 100644
index 000000000..369e49da5
--- /dev/null
+++ b/test/map1.go
@@ -0,0 +1,44 @@
+// errorcheck
+
+// Copyright 2011 The Go Authors. All rights reserved.
+// Use of this source code is governed by a BSD-style
+// license that can be found in the LICENSE file.
+
+// Test map declarations of many types, including erroneous ones.
+// Does not compile.
+
+package main
+
+func main() {}
+
+type v bool
+
+var (
+ // valid
+ _ map[int8]v
+ _ map[uint8]v
+ _ map[int16]v
+ _ map[uint16]v
+ _ map[int32]v
+ _ map[uint32]v
+ _ map[int64]v
+ _ map[uint64]v
+ _ map[int]v
+ _ map[uint]v
+ _ map[uintptr]v
+ _ map[float32]v
+ _ map[float64]v
+ _ map[complex64]v
+ _ map[complex128]v
+ _ map[bool]v
+ _ map[string]v
+ _ map[chan int]v
+ _ map[*int]v
+ _ map[struct{}]v
+ _ map[[10]int]v
+
+ // invalid
+ _ map[[]int]v // ERROR "invalid map key"
+ _ map[func()]v // ERROR "invalid map key"
+ _ map[map[int]int]v // ERROR "invalid map key"
+)
diff --git a/test/method.go b/test/method.go
index b5a02c687..0c239afbd 100644
--- a/test/method.go
+++ b/test/method.go
@@ -1,9 +1,12 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
+// Test simple methods of various types, with pointer and
+// value receivers.
+
package main
type S string
@@ -91,27 +94,27 @@ func main() {
}
if val(s) != 1 {
- println("s.val:", val(s))
+ println("val(s):", val(s))
panic("fail")
}
if val(ps) != 2 {
- println("ps.val:", val(ps))
+ println("val(ps):", val(ps))
panic("fail")
}
if val(i) != 3 {
- println("i.val:", val(i))
+ println("val(i):", val(i))
panic("fail")
}
if val(pi) != 4 {
- println("pi.val:", val(pi))
+ println("val(pi):", val(pi))
panic("fail")
}
if val(t) != 7 {
- println("t.val:", val(t))
+ println("val(t):", val(t))
panic("fail")
}
if val(pt) != 8 {
- println("pt.val:", val(pt))
+ println("val(pt):", val(pt))
panic("fail")
}
@@ -124,4 +127,124 @@ func main() {
println("Val.val(v):", Val.val(v))
panic("fail")
}
+
+ var zs struct { S }
+ var zps struct { *S1 }
+ var zi struct { I }
+ var zpi struct { *I1 }
+ var zpt struct { *T1 }
+ var zt struct { T }
+ var zv struct { Val }
+
+ if zs.val() != 1 {
+ println("zs.val:", zs.val())
+ panic("fail")
+ }
+ if zps.val() != 2 {
+ println("zps.val:", zps.val())
+ panic("fail")
+ }
+ if zi.val() != 3 {
+ println("zi.val:", zi.val())
+ panic("fail")
+ }
+ if zpi.val() != 4 {
+ println("zpi.val:", zpi.val())
+ panic("fail")
+ }
+ if zt.val() != 7 {
+ println("zt.val:", zt.val())
+ panic("fail")
+ }
+ if zpt.val() != 8 {
+ println("zpt.val:", zpt.val())
+ panic("fail")
+ }
+
+ if val(zs) != 1 {
+ println("val(zs):", val(zs))
+ panic("fail")
+ }
+ if val(zps) != 2 {
+ println("val(zps):", val(zps))
+ panic("fail")
+ }
+ if val(zi) != 3 {
+ println("val(zi):", val(zi))
+ panic("fail")
+ }
+ if val(zpi) != 4 {
+ println("val(zpi):", val(zpi))
+ panic("fail")
+ }
+ if val(zt) != 7 {
+ println("val(zt):", val(zt))
+ panic("fail")
+ }
+ if val(zpt) != 8 {
+ println("val(zpt):", val(zpt))
+ panic("fail")
+ }
+
+ zv.Val = zi
+ if zv.val() != 3 {
+ println("zv.val():", zv.val())
+ panic("fail")
+ }
+
+ if (&zs).val() != 1 {
+ println("(&zs).val:", (&zs).val())
+ panic("fail")
+ }
+ if (&zps).val() != 2 {
+ println("(&zps).val:", (&zps).val())
+ panic("fail")
+ }
+ if (&zi).val() != 3 {
+ println("(&zi).val:", (&zi).val())
+ panic("fail")
+ }
+ if (&zpi).val() != 4 {
+ println("(&zpi).val:", (&zpi).val())
+ panic("fail")
+ }
+ if (&zt).val() != 7 {
+ println("(&zt).val:", (&zt).val())
+ panic("fail")
+ }
+ if (&zpt).val() != 8 {
+ println("(&zpt).val:", (&zpt).val())
+ panic("fail")
+ }
+
+ if val(&zs) != 1 {
+ println("val(&zs):", val(&zs))
+ panic("fail")
+ }
+ if val(&zps) != 2 {
+ println("val(&zps):", val(&zps))
+ panic("fail")
+ }
+ if val(&zi) != 3 {
+ println("val(&zi):", val(&zi))
+ panic("fail")
+ }
+ if val(&zpi) != 4 {
+ println("val(&zpi):", val(&zpi))
+ panic("fail")
+ }
+ if val(&zt) != 7 {
+ println("val(&zt):", val(&zt))
+ panic("fail")
+ }
+ if val(&zpt) != 8 {
+ println("val(&zpt):", val(&zpt))
+ panic("fail")
+ }
+
+ zv.Val = &zi
+ if zv.val() != 3 {
+ println("zv.val():", zv.val())
+ panic("fail")
+ }
}
diff --git a/test/method1.go b/test/method1.go
index ec14ef9e4..365b8ca55 100644
--- a/test/method1.go
+++ b/test/method1.go
@@ -1,9 +1,12 @@
-// errchk $G $D/$F.go
+// errorcheck
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
+// Verify that method redeclarations are caught by the compiler.
+// Does not compile.
+
package main
type T struct { }
diff --git a/test/method2.go b/test/method2.go
index 2fdc9fc3c..b63da10dc 100644
--- a/test/method2.go
+++ b/test/method2.go
@@ -1,9 +1,12 @@
-// errchk $G $D/$F.go
+// errorcheck
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
+// Verify that pointers and interface types cannot be method receivers.
+// Does not compile.
+
package main
type T struct {
@@ -12,14 +15,14 @@ type T struct {
type P *T
type P1 *T
-func (p P) val() int { return 1 } // ERROR "receiver.* pointer"
-func (p *P1) val() int { return 1 } // ERROR "receiver.* pointer"
+func (p P) val() int { return 1 } // ERROR "receiver.* pointer|invalid pointer or interface receiver"
+func (p *P1) val() int { return 1 } // ERROR "receiver.* pointer|invalid pointer or interface receiver"
type I interface{}
type I1 interface{}
-func (p I) val() int { return 1 } // ERROR "receiver.*interface"
-func (p *I1) val() int { return 1 } // ERROR "receiver.*interface"
+func (p I) val() int { return 1 } // ERROR "receiver.*interface|invalid pointer or interface receiver"
+func (p *I1) val() int { return 1 } // ERROR "receiver.*interface|invalid pointer or interface receiver"
type Val interface {
val() int
diff --git a/test/method3.go b/test/method3.go
index 7946a8750..fd6477152 100644
--- a/test/method3.go
+++ b/test/method3.go
@@ -1,10 +1,10 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out || echo BUG method3
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
-// test that methods on slices work
+// Test methods on slices.
package main
diff --git a/test/method4.go b/test/method4.go
new file mode 100644
index 000000000..77e409b91
--- /dev/null
+++ b/test/method4.go
@@ -0,0 +1,106 @@
+// $G $D/method4a.go && $G $D/$F.go && $L $F.$A && ./$A.out
+
+// Copyright 2012 The Go Authors. All rights reserved.
+// Use of this source code is governed by a BSD-style
+// license that can be found in the LICENSE file.
+
+// Test method expressions with arguments.
+
+package main
+
+import "./method4a"
+
+type T1 int
+
+type T2 struct {
+ f int
+}
+
+type I1 interface {
+ Sum([]int, int) int
+}
+
+type I2 interface {
+ Sum(a []int, b int) int
+}
+
+func (i T1) Sum(a []int, b int) int {
+ r := int(i) + b
+ for _, v := range a {
+ r += v
+ }
+ return r
+}
+
+func (p *T2) Sum(a []int, b int) int {
+ r := p.f + b
+ for _, v := range a {
+ r += v
+ }
+ return r
+}
+
+func eq(v1, v2 int) {
+ if v1 != v2 {
+ panic(0)
+ }
+}
+
+func main() {
+ a := []int{1, 2, 3}
+ t1 := T1(4)
+ t2 := &T2{4}
+
+ eq(t1.Sum(a, 5), 15)
+ eq(t2.Sum(a, 6), 16)
+
+ eq(T1.Sum(t1, a, 7), 17)
+ eq((*T2).Sum(t2, a, 8), 18)
+
+ f1 := T1.Sum
+ eq(f1(t1, a, 9), 19)
+ f2 := (*T2).Sum
+ eq(f2(t2, a, 10), 20)
+
+ eq(I1.Sum(t1, a, 11), 21)
+ eq(I1.Sum(t2, a, 12), 22)
+
+ f3 := I1.Sum
+ eq(f3(t1, a, 13), 23)
+ eq(f3(t2, a, 14), 24)
+
+ eq(I2.Sum(t1, a, 15), 25)
+ eq(I2.Sum(t2, a, 16), 26)
+
+ f4 := I2.Sum
+ eq(f4(t1, a, 17), 27)
+ eq(f4(t2, a, 18), 28)
+
+ mt1 := method4a.T1(4)
+ mt2 := &method4a.T2{4}
+
+ eq(mt1.Sum(a, 30), 40)
+ eq(mt2.Sum(a, 31), 41)
+
+ eq(method4a.T1.Sum(mt1, a, 32), 42)
+ eq((*method4a.T2).Sum(mt2, a, 33), 43)
+
+ g1 := method4a.T1.Sum
+ eq(g1(mt1, a, 34), 44)
+ g2 := (*method4a.T2).Sum
+ eq(g2(mt2, a, 35), 45)
+
+ eq(method4a.I1.Sum(mt1, a, 36), 46)
+ eq(method4a.I1.Sum(mt2, a, 37), 47)
+
+ g3 := method4a.I1.Sum
+ eq(g3(mt1, a, 38), 48)
+ eq(g3(mt2, a, 39), 49)
+
+ eq(method4a.I2.Sum(mt1, a, 40), 50)
+ eq(method4a.I2.Sum(mt2, a, 41), 51)
+
+ g4 := method4a.I2.Sum
+ eq(g4(mt1, a, 42), 52)
+ eq(g4(mt2, a, 43), 53)
+}
diff --git a/test/method4a.go b/test/method4a.go
new file mode 100644
index 000000000..d23039bfa
--- /dev/null
+++ b/test/method4a.go
@@ -0,0 +1,40 @@
+// skip
+
+// Copyright 2012 The Go Authors. All rights reserved.
+// Use of this source code is governed by a BSD-style
+// license that can be found in the LICENSE file.
+
+// Test method expressions with arguments.
+// This file is not tested by itself; it is imported by method4.go.
+
+package method4a
+
+type T1 int
+
+type T2 struct {
+ F int
+}
+
+type I1 interface {
+ Sum([]int, int) int
+}
+
+type I2 interface {
+ Sum(a []int, b int) int
+}
+
+func (i T1) Sum(a []int, b int) int {
+ r := int(i) + b
+ for _, v := range a {
+ r += v
+ }
+ return r
+}
+
+func (p *T2) Sum(a []int, b int) int {
+ r := p.F + b
+ for _, v := range a {
+ r += v
+ }
+ return r
+}
diff --git a/test/named.go b/test/named.go
index 5b6bb81fe..d0330ab23 100644
--- a/test/named.go
+++ b/test/named.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/named1.go b/test/named1.go
index 7e7aab9c1..62b874c5c 100644
--- a/test/named1.go
+++ b/test/named1.go
@@ -1,4 +1,4 @@
-// errchk $G -e $D/$F.go
+// errorcheck
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
@@ -6,6 +6,7 @@
// Test that basic operations on named types are valid
// and preserve the type.
+// Does not compile.
package main
@@ -37,11 +38,10 @@ func main() {
asBool(true)
asBool(*&b)
asBool(Bool(true))
- asBool(1 != 2) // ERROR "cannot use.*type bool.*as type Bool"
- asBool(i < j) // ERROR "cannot use.*type bool.*as type Bool"
+ asBool(1 != 2) // ok now
+ asBool(i < j) // ok now
_, b = m[2] // ERROR "cannot .* bool.*type Bool"
- m[2] = 1, b // ERROR "cannot use.*type Bool.*as type bool"
var inter interface{}
_, b = inter.(Map) // ERROR "cannot .* bool.*type Bool"
@@ -55,8 +55,8 @@ func main() {
_, bb := <-c
asBool(bb) // ERROR "cannot use.*type bool.*as type Bool"
- _, b = <-c // ERROR "cannot .* bool.*type Bool"
+ _, b = <-c // ERROR "cannot .* bool.*type Bool"
_ = b
- asString(String(slice)) // ERROR "cannot .*type Slice.*type String"
+ asString(String(slice)) // ok
}
diff --git a/test/nil.go b/test/nil.go
index 30cc2705b..9f7bcbb59 100644
--- a/test/nil.go
+++ b/test/nil.go
@@ -1,9 +1,11 @@
-// $G $F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
+// Test nil.
+
package main
import (
@@ -150,7 +152,7 @@ func maptest() {
m[2] = 3
})
shouldPanic(func() {
- m[2] = 0, false
+ delete(m, 2)
})
}
diff --git a/test/nilptr.go b/test/nilptr.go
new file mode 100644
index 000000000..b784914e5
--- /dev/null
+++ b/test/nilptr.go
@@ -0,0 +1,132 @@
+// run
+
+// Copyright 2011 The Go Authors. All rights reserved.
+// Use of this source code is governed by a BSD-style
+// license that can be found in the LICENSE file.
+
+// Test that the implementation catches nil ptr indirection
+// in a large address space.
+
+package main
+
+import "unsafe"
+
+// Having a big address space means that indexing
+// at a 256 MB offset from a nil pointer might not
+// cause a memory access fault. This test checks
+// that Go is doing the correct explicit checks to catch
+// these nil pointer accesses, not just relying on the hardware.
+var dummy [256 << 20]byte // give us a big address space
+
+func main() {
+ // the test only tests what we intend to test
+ // if dummy starts in the first 256 MB of memory.
+ // otherwise there might not be anything mapped
+ // at the address that might be accidentally
+ // dereferenced below.
+ if uintptr(unsafe.Pointer(&dummy)) > 256<<20 {
+ panic("dummy too far out")
+ }
+
+ shouldPanic(p1)
+ shouldPanic(p2)
+ shouldPanic(p3)
+ shouldPanic(p4)
+ shouldPanic(p5)
+ shouldPanic(p6)
+ shouldPanic(p7)
+ shouldPanic(p8)
+ shouldPanic(p9)
+ shouldPanic(p10)
+}
+
+func shouldPanic(f func()) {
+ defer func() {
+ if recover() == nil {
+ panic("memory reference did not panic")
+ }
+ }()
+ f()
+}
+
+func p1() {
+ // Array index.
+ var p *[1 << 30]byte = nil
+ println(p[256<<20]) // very likely to be inside dummy, but should panic
+}
+
+var xb byte
+
+func p2() {
+ var p *[1 << 30]byte = nil
+ xb = 123
+
+ // Array index.
+ println(p[uintptr(unsafe.Pointer(&xb))]) // should panic
+}
+
+func p3() {
+ // Array to slice.
+ var p *[1 << 30]byte = nil
+ var x []byte = p[0:] // should panic
+ _ = x
+}
+
+var q *[1 << 30]byte
+
+func p4() {
+ // Array to slice.
+ var x []byte
+ var y = &x
+ *y = q[0:] // should crash (uses arraytoslice runtime routine)
+}
+
+func fb([]byte) {
+ panic("unreachable")
+}
+
+func p5() {
+ // Array to slice.
+ var p *[1 << 30]byte = nil
+ fb(p[0:]) // should crash
+}
+
+func p6() {
+ // Array to slice.
+ var p *[1 << 30]byte = nil
+ var _ []byte = p[10 : len(p)-10] // should crash
+}
+
+type T struct {
+ x [256 << 20]byte
+ i int
+}
+
+func f() *T {
+ return nil
+}
+
+var y *T
+var x = &y
+
+func p7() {
+ // Struct field access with large offset.
+ println(f().i) // should crash
+}
+
+func p8() {
+ // Struct field access with large offset.
+ println((*x).i) // should crash
+}
+
+func p9() {
+ // Struct field access with large offset.
+ var t *T
+ println(&t.i) // should crash
+}
+
+func p10() {
+ // Struct field access with large offset.
+ var t *T
+ println(t.i) // should crash
+}
diff --git a/test/nilptr/arrayindex.go b/test/nilptr/arrayindex.go
deleted file mode 100644
index fa26532c6..000000000
--- a/test/nilptr/arrayindex.go
+++ /dev/null
@@ -1,26 +0,0 @@
-// $G $D/$F.go && $L $F.$A &&
-// ((! sh -c ./$A.out) >/dev/null 2>&1 || echo BUG: should fail)
-
-// Copyright 2009 The Go Authors. All rights reserved.
-// Use of this source code is governed by a BSD-style
-// license that can be found in the LICENSE file.
-
-package main
-
-import "unsafe"
-
-var x byte
-
-func main() {
- var p *[1<<30]byte = nil
- x = 123
-
- // The problem here is not the use of unsafe:
- // it is that indexing into p[] with a large
- // enough index jumps out of the unmapped section
- // at the beginning of memory and into valid memory.
- // Pointer offsets and array indices, if they are
- // very large, need to dereference the base pointer
- // to trigger a trap.
- println(p[uintptr(unsafe.Pointer(&x))]) // should crash
-}
diff --git a/test/nilptr/arrayindex1.go b/test/nilptr/arrayindex1.go
deleted file mode 100644
index 64f46e14d..000000000
--- a/test/nilptr/arrayindex1.go
+++ /dev/null
@@ -1,31 +0,0 @@
-// $G $D/$F.go && $L $F.$A &&
-// ((! sh -c ./$A.out) >/dev/null 2>&1 || echo BUG: should fail)
-
-// Copyright 2009 The Go Authors. All rights reserved.
-// Use of this source code is governed by a BSD-style
-// license that can be found in the LICENSE file.
-
-package main
-
-import "unsafe"
-
-var dummy [512<<20]byte // give us a big address space
-func main() {
- // the test only tests what we intend to test
- // if dummy starts in the first 256 MB of memory.
- // otherwise there might not be anything mapped
- // at the address that might be accidentally
- // dereferenced below.
- if uintptr(unsafe.Pointer(&dummy)) > 256<<20 {
- panic("dummy too far out")
- }
-
- // The problem here is that indexing into p[] with a large
- // enough index jumps out of the unmapped section
- // at the beginning of memory and into valid memory.
- // Pointer offsets and array indices, if they are
- // very large, need to dereference the base pointer
- // to trigger a trap.
- var p *[1<<30]byte = nil
- println(p[256<<20]) // very likely to be inside dummy, but should crash
-}
diff --git a/test/nilptr/arraytoslice.go b/test/nilptr/arraytoslice.go
deleted file mode 100644
index 03879fb42..000000000
--- a/test/nilptr/arraytoslice.go
+++ /dev/null
@@ -1,36 +0,0 @@
-// $G $D/$F.go && $L $F.$A &&
-// ((! sh -c ./$A.out) >/dev/null 2>&1 || echo BUG: should fail)
-
-// Copyright 2009 The Go Authors. All rights reserved.
-// Use of this source code is governed by a BSD-style
-// license that can be found in the LICENSE file.
-
-package main
-
-import "unsafe"
-
-func f([]byte) {
- panic("unreachable")
-}
-
-var dummy [512<<20]byte // give us a big address space
-func main() {
- // the test only tests what we intend to test
- // if dummy starts in the first 256 MB of memory.
- // otherwise there might not be anything mapped
- // at the address that might be accidentally
- // dereferenced below.
- if uintptr(unsafe.Pointer(&dummy)) > 256<<20 {
- panic("dummy too far out")
- }
-
- // The problem here is that indexing into p[] with a large
- // enough index can jump out of the unmapped section
- // at the beginning of memory and into valid memory.
- //
- // To avoid needing a check on every slice beyond the
- // usual len and cap, we require the *array -> slice
- // conversion to do the check.
- var p *[1<<30]byte = nil
- f(p[0:]) // should crash
-}
diff --git a/test/nilptr/arraytoslice1.go b/test/nilptr/arraytoslice1.go
deleted file mode 100644
index c86070fa4..000000000
--- a/test/nilptr/arraytoslice1.go
+++ /dev/null
@@ -1,33 +0,0 @@
-// $G $D/$F.go && $L $F.$A &&
-// ((! sh -c ./$A.out) >/dev/null 2>&1 || echo BUG: should fail)
-
-// Copyright 2009 The Go Authors. All rights reserved.
-// Use of this source code is governed by a BSD-style
-// license that can be found in the LICENSE file.
-
-package main
-
-import "unsafe"
-
-var dummy [512<<20]byte // give us a big address space
-func main() {
- // the test only tests what we intend to test
- // if dummy starts in the first 256 MB of memory.
- // otherwise there might not be anything mapped
- // at the address that might be accidentally
- // dereferenced below.
- if uintptr(unsafe.Pointer(&dummy)) > 256<<20 {
- panic("dummy too far out")
- }
-
- // The problem here is that indexing into p[] with a large
- // enough index can jump out of the unmapped section
- // at the beginning of memory and into valid memory.
- //
- // To avoid needing a check on every slice beyond the
- // usual len and cap, we require the *array -> slice
- // conversion to do the check.
- var p *[1<<30]byte = nil
- var x []byte = p[0:] // should crash
- _ = x
-}
diff --git a/test/nilptr/arraytoslice2.go b/test/nilptr/arraytoslice2.go
deleted file mode 100644
index 68ea44083..000000000
--- a/test/nilptr/arraytoslice2.go
+++ /dev/null
@@ -1,34 +0,0 @@
-// $G $D/$F.go && $L $F.$A &&
-// ((! sh -c ./$A.out) >/dev/null 2>&1 || echo BUG: should fail)
-
-// Copyright 2009 The Go Authors. All rights reserved.
-// Use of this source code is governed by a BSD-style
-// license that can be found in the LICENSE file.
-
-package main
-
-import "unsafe"
-
-var dummy [512<<20]byte // give us a big address space
-var q *[1<<30]byte
-func main() {
- // the test only tests what we intend to test
- // if dummy starts in the first 256 MB of memory.
- // otherwise there might not be anything mapped
- // at the address that might be accidentally
- // dereferenced below.
- if uintptr(unsafe.Pointer(&dummy)) > 256<<20 {
- panic("dummy too far out")
- }
-
- // The problem here is that indexing into p[] with a large
- // enough index can jump out of the unmapped section
- // at the beginning of memory and into valid memory.
- //
- // To avoid needing a check on every slice beyond the
- // usual len and cap, we require the *array -> slice
- // conversion to do the check.
- var x []byte
- var y = &x
- *y = q[0:] // should crash (uses arraytoslice runtime routine)
-}
diff --git a/test/nilptr/slicearray.go b/test/nilptr/slicearray.go
deleted file mode 100644
index 26ca42773..000000000
--- a/test/nilptr/slicearray.go
+++ /dev/null
@@ -1,32 +0,0 @@
-// $G $D/$F.go && $L $F.$A &&
-// ((! sh -c ./$A.out) >/dev/null 2>&1 || echo BUG: should fail)
-
-// Copyright 2009 The Go Authors. All rights reserved.
-// Use of this source code is governed by a BSD-style
-// license that can be found in the LICENSE file.
-
-package main
-
-import "unsafe"
-
-var dummy [512<<20]byte // give us a big address space
-func main() {
- // the test only tests what we intend to test
- // if dummy starts in the first 256 MB of memory.
- // otherwise there might not be anything mapped
- // at the address that might be accidentally
- // dereferenced below.
- if uintptr(unsafe.Pointer(&dummy)) > 256<<20 {
- panic("dummy too far out")
- }
-
- // The problem here is that indexing into p[] with a large
- // enough index can jump out of the unmapped section
- // at the beginning of memory and into valid memory.
- //
- // To avoid needing a check on every slice beyond the
- // usual len and cap, we require the slice operation
- // to do the check.
- var p *[1<<30]byte = nil
- var _ []byte = p[10:len(p)-10] // should crash
-}
diff --git a/test/nilptr/structfield.go b/test/nilptr/structfield.go
deleted file mode 100644
index 35196bb68..000000000
--- a/test/nilptr/structfield.go
+++ /dev/null
@@ -1,34 +0,0 @@
-// $G $D/$F.go && $L $F.$A &&
-// ((! sh -c ./$A.out) >/dev/null 2>&1 || echo BUG: should fail)
-
-// Copyright 2009 The Go Authors. All rights reserved.
-// Use of this source code is governed by a BSD-style
-// license that can be found in the LICENSE file.
-
-package main
-
-import "unsafe"
-
-var dummy [512<<20]byte // give us a big address space
-type T struct {
- x [256<<20] byte
- i int
-}
-
-func main() {
- // the test only tests what we intend to test
- // if dummy starts in the first 256 MB of memory.
- // otherwise there might not be anything mapped
- // at the address that might be accidentally
- // dereferenced below.
- if uintptr(unsafe.Pointer(&dummy)) > 256<<20 {
- panic("dummy too far out")
- }
-
- // The problem here is that indexing into t with a large
- // enough index can jump out of the unmapped section
- // at the beginning of memory and into valid memory.
- // We require the pointer dereference to check.
- var t *T
- println(t.i) // should crash
-}
diff --git a/test/nilptr/structfield1.go b/test/nilptr/structfield1.go
deleted file mode 100644
index 7c7abed1a..000000000
--- a/test/nilptr/structfield1.go
+++ /dev/null
@@ -1,37 +0,0 @@
-// $G $D/$F.go && $L $F.$A &&
-// ((! sh -c ./$A.out) >/dev/null 2>&1 || echo BUG: should fail)
-
-// Copyright 2009 The Go Authors. All rights reserved.
-// Use of this source code is governed by a BSD-style
-// license that can be found in the LICENSE file.
-
-package main
-
-import "unsafe"
-
-var dummy [512<<20]byte // give us a big address space
-type T struct {
- x [256<<20] byte
- i int
-}
-
-func f() *T {
- return nil
-}
-
-func main() {
- // the test only tests what we intend to test
- // if dummy starts in the first 256 MB of memory.
- // otherwise there might not be anything mapped
- // at the address that might be accidentally
- // dereferenced below.
- if uintptr(unsafe.Pointer(&dummy)) > 256<<20 {
- panic("dummy too far out")
- }
-
- // The problem here is that indexing into t with a large
- // enough index can jump out of the unmapped section
- // at the beginning of memory and into valid memory.
- // We require the pointer dereference to check.
- println(f().i) // should crash
-}
diff --git a/test/nilptr/structfield2.go b/test/nilptr/structfield2.go
deleted file mode 100644
index 02a44f173..000000000
--- a/test/nilptr/structfield2.go
+++ /dev/null
@@ -1,36 +0,0 @@
-// $G $D/$F.go && $L $F.$A &&
-// ((! sh -c ./$A.out) >/dev/null 2>&1 || echo BUG: should fail)
-
-// Copyright 2009 The Go Authors. All rights reserved.
-// Use of this source code is governed by a BSD-style
-// license that can be found in the LICENSE file.
-
-package main
-
-import "unsafe"
-
-var dummy [512<<20]byte // give us a big address space
-type T struct {
- x [256<<20] byte
- i int
-}
-
-var y *T
-var x = &y
-
-func main() {
- // the test only tests what we intend to test
- // if dummy starts in the first 256 MB of memory.
- // otherwise there might not be anything mapped
- // at the address that might be accidentally
- // dereferenced below.
- if uintptr(unsafe.Pointer(&dummy)) > 256<<20 {
- panic("dummy too far out")
- }
-
- // The problem here is that indexing into t with a large
- // enough index can jump out of the unmapped section
- // at the beginning of memory and into valid memory.
- // We require the pointer dereference to check.
- println((*x).i) // should crash
-}
diff --git a/test/nilptr/structfieldaddr.go b/test/nilptr/structfieldaddr.go
deleted file mode 100644
index f3177bafb..000000000
--- a/test/nilptr/structfieldaddr.go
+++ /dev/null
@@ -1,34 +0,0 @@
-// $G $D/$F.go && $L $F.$A &&
-// ((! sh -c ./$A.out) >/dev/null 2>&1 || echo BUG: should fail)
-
-// Copyright 2009 The Go Authors. All rights reserved.
-// Use of this source code is governed by a BSD-style
-// license that can be found in the LICENSE file.
-
-package main
-
-import "unsafe"
-
-var dummy [512<<20]byte // give us a big address space
-type T struct {
- x [256<<20] byte
- i int
-}
-
-func main() {
- // the test only tests what we intend to test
- // if dummy starts in the first 256 MB of memory.
- // otherwise there might not be anything mapped
- // at the address that might be accidentally
- // dereferenced below.
- if uintptr(unsafe.Pointer(&dummy)) > 256<<20 {
- panic("dummy too far out")
- }
-
- // The problem here is that indexing into t with a large
- // enough index can jump out of the unmapped section
- // at the beginning of memory and into valid memory.
- // We require the address calculation to check.
- var t *T
- println(&t.i) // should crash
-}
diff --git a/test/parentype.go b/test/parentype.go
index 1872cd0eb..eafa07648 100644
--- a/test/parentype.go
+++ b/test/parentype.go
@@ -1,9 +1,11 @@
-// $G $D/$F.go
+// compile
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
+// Test that types can be parenthesized.
+
package main
func f(interface{})
diff --git a/test/peano.go b/test/peano.go
index f4c59d1e1..745f5153f 100644
--- a/test/peano.go
+++ b/test/peano.go
@@ -1,14 +1,16 @@
-// $G $F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
+// Test that heavy recursion works. Simple torture test for
+// segmented stacks: do math in unary by recursion.
+
package main
type Number *Number
-
// -------------------------------------
// Peano primitives
@@ -16,24 +18,20 @@ func zero() *Number {
return nil
}
-
func is_zero(x *Number) bool {
return x == nil
}
-
func add1(x *Number) *Number {
e := new(Number)
*e = x
return e
}
-
func sub1(x *Number) *Number {
return *x
}
-
func add(x, y *Number) *Number {
if is_zero(y) {
return x
@@ -42,7 +40,6 @@ func add(x, y *Number) *Number {
return add(add1(x), sub1(y))
}
-
func mul(x, y *Number) *Number {
if is_zero(x) || is_zero(y) {
return zero()
@@ -51,7 +48,6 @@ func mul(x, y *Number) *Number {
return add(mul(x, sub1(y)), x)
}
-
func fact(n *Number) *Number {
if is_zero(n) {
return add1(zero())
@@ -60,7 +56,6 @@ func fact(n *Number) *Number {
return mul(fact(sub1(n)), n)
}
-
// -------------------------------------
// Helpers to generate/count Peano integers
@@ -72,7 +67,6 @@ func gen(n int) *Number {
return zero()
}
-
func count(x *Number) int {
if is_zero(x) {
return 0
@@ -81,7 +75,6 @@ func count(x *Number) int {
return count(sub1(x)) + 1
}
-
func check(x *Number, expected int) {
var c = count(x)
if c != expected {
@@ -90,7 +83,6 @@ func check(x *Number, expected int) {
}
}
-
// -------------------------------------
// Test basic functionality
@@ -115,12 +107,19 @@ func init() {
check(fact(gen(5)), 120)
}
-
// -------------------------------------
// Factorial
+var results = [...]int{
+ 1, 1, 2, 6, 24, 120, 720, 5040, 40320, 362880, 3628800,
+ 39916800, 479001600,
+}
+
func main() {
for i := 0; i <= 9; i++ {
- print(i, "! = ", count(fact(gen(i))), "\n")
+ if f := count(fact(gen(i))); f != results[i] {
+ println("FAIL:", i, "!:", f, "!=", results[i])
+ panic(0)
+ }
}
}
diff --git a/test/printbig.go b/test/printbig.go
index bbb707004..5693c58d4 100644
--- a/test/printbig.go
+++ b/test/printbig.go
@@ -1,9 +1,11 @@
-// $G $F.go && $L $F.$A && ./$A.out
+// cmpout
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
+// Test that big numbers work as constants and print can print them.
+
package main
func main() {
diff --git a/test/printbig.out b/test/printbig.out
new file mode 100644
index 000000000..6a16b15d9
--- /dev/null
+++ b/test/printbig.out
@@ -0,0 +1,2 @@
+-9223372036854775808
+9223372036854775807
diff --git a/test/range.go b/test/range.go
index 91ccd6307..b0f3ae605 100644
--- a/test/range.go
+++ b/test/range.go
@@ -1,9 +1,11 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
+// Test the 'for range' construct.
+
package main
// test range over channels
@@ -172,7 +174,7 @@ func makestring() string {
}
func teststring() {
- s := 0
+ var s rune
nmake = 0
for _, v := range makestring() {
s += v
@@ -208,7 +210,7 @@ func teststring1() {
func makemap() map[int]int {
nmake++
- return map[int]int{0:'a', 1:'b', 2:'c', 3:'d', 4:'☺'}
+ return map[int]int{0: 'a', 1: 'b', 2: 'c', 3: 'd', 4: '☺'}
}
func testmap() {
diff --git a/test/recover.go b/test/recover.go
index ca6f07288..eea655ec5 100644
--- a/test/recover.go
+++ b/test/recover.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2010 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
@@ -244,3 +244,30 @@ func test7() {
die()
}
}
+
+func varargs(s *int, a ...int) {
+ *s = 0
+ for _, v := range a {
+ *s += v
+ }
+ if recover() != nil {
+ *s += 100
+ }
+}
+
+func test8a() (r int) {
+ defer varargs(&r, 1, 2, 3)
+ panic(0)
+}
+
+func test8b() (r int) {
+ defer varargs(&r, 4, 5, 6)
+ return
+}
+
+func test8() {
+ if test8a() != 106 || test8b() != 15 {
+ println("wrong value")
+ die()
+ }
+}
diff --git a/test/recover1.go b/test/recover1.go
index db584738b..b763a1074 100644
--- a/test/recover1.go
+++ b/test/recover1.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2010 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/recover2.go b/test/recover2.go
index 9affe25d4..946d05ae6 100644
--- a/test/recover2.go
+++ b/test/recover2.go
@@ -1,4 +1,4 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2010 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
@@ -11,10 +11,7 @@
package main
-import (
- "os"
- "strings"
-)
+import "strings"
var x = make([]byte, 10)
@@ -33,7 +30,7 @@ func mustRecover(s string) {
if v == nil {
panic("expected panic")
}
- if e := v.(os.Error).String(); strings.Index(e, s) < 0 {
+ if e := v.(error).Error(); strings.Index(e, s) < 0 {
panic("want: " + s + "; have: " + e)
}
}
@@ -63,6 +60,7 @@ func test4() {
type T struct {
a, b int
+ c []int
}
func test5() {
diff --git a/test/recover3.go b/test/recover3.go
index 2aa1df616..98700231e 100644
--- a/test/recover3.go
+++ b/test/recover3.go
@@ -1,9 +1,11 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2010 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
+// Test recovering from runtime errors.
+
package main
import (
@@ -35,7 +37,7 @@ func check(name string, f func(), err string) {
println(name, "panicked but not with runtime.Error")
return
}
- s := runt.String()
+ s := runt.Error()
if strings.Index(s, err) < 0 {
bug()
println(name, "panicked with", s, "not", err)
diff --git a/test/rename.go b/test/rename.go
index f21ef015b..e54427455 100644
--- a/test/rename.go
+++ b/test/rename.go
@@ -1,73 +1,99 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
+// Test that predeclared names can be redeclared by the user.
+
package main
import "fmt"
func main() {
n :=
- bool +
+ append +
+ bool +
byte +
- float +
+ complex +
+ complex64 +
+ complex128 +
+ cap +
+ close +
+ delete +
+ error +
+ false +
float32 +
float64 +
+ imag +
int +
int8 +
int16 +
int32 +
int64 +
+ len +
+ make +
+ new +
+ nil +
+ panic +
+ print +
+ println +
+ real +
+ recover +
+ rune +
+ string +
+ true +
uint +
uint8 +
uint16 +
uint32 +
uint64 +
uintptr +
- true +
- false +
- iota +
- nil +
- cap +
- len +
- make +
- new +
- panic +
- print +
- println
- if n != 27*28/2 {
- fmt.Println("BUG: wrong n", n, 27*28/2)
+ iota
+ if n != NUM*(NUM-1)/2 {
+ fmt.Println("BUG: wrong n", n, NUM*(NUM-1)/2)
}
}
const (
- bool = 1
- byte = 2
- float = 3
- float32 = 4
- float64 = 5
- int = 6
- int8 = 7
- int16 = 8
- int32 = 9
- int64 = 10
- uint = 11
- uint8 = 12
- uint16 = 13
- uint32 = 14
- uint64 = 15
- uintptr = 16
- true = 17
- false = 18
- iota = 19
- nil = 20
- cap = 21
- len = 22
- make = 23
- new = 24
- panic = 25
- print = 26
- println = 27
+ // cannot use iota here, because iota = 38 below
+ append = 1
+ bool = 2
+ byte = 3
+ complex = 4
+ complex64 = 5
+ complex128 = 6
+ cap = 7
+ close = 8
+ delete = 9
+ error = 10
+ false = 11
+ float32 = 12
+ float64 = 13
+ imag = 14
+ int = 15
+ int8 = 16
+ int16 = 17
+ int32 = 18
+ int64 = 19
+ len = 20
+ make = 21
+ new = 22
+ nil = 23
+ panic = 24
+ print = 25
+ println = 26
+ real = 27
+ recover = 28
+ rune = 29
+ string = 30
+ true = 31
+ uint = 32
+ uint8 = 33
+ uint16 = 34
+ uint32 = 35
+ uint64 = 36
+ uintptr = 37
+ iota = 38
+ NUM = 39
)
diff --git a/test/rename1.go b/test/rename1.go
index 3e78bfca0..53db68de1 100644
--- a/test/rename1.go
+++ b/test/rename1.go
@@ -1,14 +1,17 @@
-// errchk $G -e $D/$F.go
+// errorcheck
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
+// Verify that renamed identifiers no longer have their old meaning.
+// Does not compile.
+
package main
func main() {
var n byte // ERROR "not a type|expected type"
- var y = float(0) // ERROR "cannot call|expected function"
+ var y = float32(0) // ERROR "cannot call|expected function"
const (
a = 1 + iota // ERROR "string|incompatible types" "convert iota"
)
@@ -16,31 +19,42 @@ func main() {
}
const (
- bool = 1
- byte = 2
- float = 3
- float32 = 4
- float64 = 5
- int = 6
- int8 = 7
- int16 = 8
- int32 = 9
- int64 = 10
- uint = 11
- uint8 = 12
- uint16 = 13
- uint32 = 14
- uint64 = 15
- uintptr = 16
- true = 17
- false = 18
- iota = "abc"
- nil = 20
- cap = 21
- len = 22
- make = 23
- new = 24
- panic = 25
- print = 26
- println = 27
+ append = 1
+ bool = 2
+ byte = 3
+ complex = 4
+ complex64 = 5
+ complex128 = 6
+ cap = 7
+ close = 8
+ delete = 9
+ error = 10
+ false = 11
+ float32 = 12
+ float64 = 13
+ imag = 14
+ int = 15
+ int8 = 16
+ int16 = 17
+ int32 = 18
+ int64 = 19
+ len = 20
+ make = 21
+ new = 22
+ nil = 23
+ panic = 24
+ print = 25
+ println = 26
+ real = 27
+ recover = 28
+ rune = 29
+ string = 30
+ true = 31
+ uint = 32
+ uint8 = 33
+ uint16 = 34
+ uint32 = 35
+ uint64 = 36
+ uintptr = 37
+ iota = "38"
)
diff --git a/test/reorder.go b/test/reorder.go
new file mode 100644
index 000000000..007039e8a
--- /dev/null
+++ b/test/reorder.go
@@ -0,0 +1,121 @@
+// run
+
+// Copyright 2011 The Go Authors. All rights reserved.
+// Use of this source code is governed by a BSD-style
+// license that can be found in the LICENSE file.
+
+// Test reordering of assignments.
+
+package main
+
+import "fmt"
+
+func main() {
+ p1()
+ p2()
+ p3()
+ p4()
+ p5()
+ p6()
+ p7()
+ p8()
+}
+
+var gx []int
+
+func f(i int) int {
+ return gx[i]
+}
+
+func check(x []int, x0, x1, x2 int) {
+ if x[0] != x0 || x[1] != x1 || x[2] != x2 {
+ fmt.Printf("%v, want %d,%d,%d\n", x, x0, x1, x2)
+ panic("failed")
+ }
+}
+
+func check3(x, y, z, xx, yy, zz int) {
+ if x != xx || y != yy || z != zz {
+ fmt.Printf("%d,%d,%d, want %d,%d,%d\n", x, y, z, xx, yy, zz)
+ panic("failed")
+ }
+}
+
+func p1() {
+ x := []int{1,2,3}
+ i := 0
+ i, x[i] = 1, 100
+ _ = i
+ check(x, 100, 2, 3)
+}
+
+func p2() {
+ x := []int{1,2,3}
+ i := 0
+ x[i], i = 100, 1
+ _ = i
+ check(x, 100, 2, 3)
+}
+
+func p3() {
+ x := []int{1,2,3}
+ y := x
+ gx = x
+ x[1], y[0] = f(0), f(1)
+ check(x, 2, 1, 3)
+}
+
+func p4() {
+ x := []int{1,2,3}
+ y := x
+ gx = x
+ x[1], y[0] = gx[0], gx[1]
+ check(x, 2, 1, 3)
+}
+
+func p5() {
+ x := []int{1,2,3}
+ y := x
+ p := &x[0]
+ q := &x[1]
+ *p, *q = x[1], y[0]
+ check(x, 2, 1, 3)
+}
+
+func p6() {
+ x := 1
+ y := 2
+ z := 3
+ px := &x
+ py := &y
+ *px, *py = y, x
+ check3(x, y, z, 2, 1, 3)
+}
+
+func f1(x, y, z int) (xx, yy, zz int) {
+ return x, y, z
+}
+
+func f2() (x, y, z int) {
+ return f1(2, 1, 3)
+}
+
+func p7() {
+ x, y, z := f2()
+ check3(x, y, z, 2, 1, 3)
+}
+
+func p8() {
+ x := []int{1,2,3}
+
+ defer func() {
+ err := recover()
+ if err == nil {
+ panic("not panicking")
+ }
+ check(x, 100, 2, 3)
+ }()
+
+ i := 0
+ i, x[i], x[5] = 1, 100, 500
+}
diff --git a/test/reorder2.go b/test/reorder2.go
new file mode 100644
index 000000000..d91f1d895
--- /dev/null
+++ b/test/reorder2.go
@@ -0,0 +1,174 @@
+// run
+
+// Copyright 2010 The Go Authors. All rights reserved.
+// Use of this source code is governed by a BSD-style
+// license that can be found in the LICENSE file.
+
+// Test reorderings; derived from fixedbugs/bug294.go.
+
+package main
+
+var log string
+
+type TT int
+
+func (t TT) a(s string) TT {
+ log += "a(" + s + ")"
+ return t
+}
+
+func (TT) b(s string) string {
+ log += "b(" + s + ")"
+ return s
+}
+
+type F func(s string) F
+
+func a(s string) F {
+ log += "a(" + s + ")"
+ return F(a)
+}
+
+func b(s string) string {
+ log += "b(" + s + ")"
+ return s
+}
+
+type I interface {
+ a(s string) I
+ b(s string) string
+}
+
+type T1 int
+
+func (t T1) a(s string) I {
+ log += "a(" + s + ")"
+ return t
+}
+
+func (T1) b(s string) string {
+ log += "b(" + s + ")"
+ return s
+}
+
+// f(g(), h()) where g is not inlinable but h is will have the same problem.
+// As will x := g() + h() (same conditions).
+// And g() <- h().
+func f(x, y string) {
+ log += "f(" + x + ", " + y + ")"
+}
+
+func ff(x, y string) {
+ for false {
+ } // prevent inl
+ log += "ff(" + x + ", " + y + ")"
+}
+
+func h(x string) string {
+ log += "h(" + x + ")"
+ return x
+}
+
+func g(x string) string {
+ for false {
+ } // prevent inl
+ log += "g(" + x + ")"
+ return x
+}
+
+func main() {
+ err := 0
+ var t TT
+ if a("1")("2")("3"); log != "a(1)a(2)a(3)" {
+ println("expecting a(1)a(2)a(3) , got ", log)
+ err++
+ }
+ log = ""
+
+ if t.a("1").a(t.b("2")); log != "a(1)b(2)a(2)" {
+ println("expecting a(1)b(2)a(2), got ", log)
+ err++
+ }
+ log = ""
+ if a("3")(b("4"))(b("5")); log != "a(3)b(4)a(4)b(5)a(5)" {
+ println("expecting a(3)b(4)a(4)b(5)a(5), got ", log)
+ err++
+ }
+ log = ""
+ var i I = T1(0)
+ if i.a("6").a(i.b("7")).a(i.b("8")).a(i.b("9")); log != "a(6)b(7)a(7)b(8)a(8)b(9)a(9)" {
+ println("expecting a(6)ba(7)ba(8)ba(9), got", log)
+ err++
+ }
+ log = ""
+
+ if s := t.a("1").b("3"); log != "a(1)b(3)" || s != "3" {
+ println("expecting a(1)b(3) and 3, got ", log, " and ", s)
+ err++
+ }
+ log = ""
+
+ if s := t.a("1").a(t.b("2")).b("3") + t.a("4").b("5"); log != "a(1)b(2)a(2)b(3)a(4)b(5)" || s != "35" {
+ println("expecting a(1)b(2)a(2)b(3)a(4)b(5) and 35, got ", log, " and ", s)
+ err++
+ }
+ log = ""
+
+ if s := t.a("4").b("5") + t.a("1").a(t.b("2")).b("3"); log != "a(4)b(5)a(1)b(2)a(2)b(3)" || s != "53" {
+ println("expecting a(4)b(5)a(1)b(2)a(2)b(3) and 35, got ", log, " and ", s)
+ err++
+ }
+ log = ""
+
+ if ff(g("1"), g("2")); log != "g(1)g(2)ff(1, 2)" {
+ println("expecting g(1)g(2)ff..., got ", log)
+ err++
+ }
+ log = ""
+
+ if ff(g("1"), h("2")); log != "g(1)h(2)ff(1, 2)" {
+ println("expecting g(1)h(2)ff..., got ", log)
+ err++
+ }
+ log = ""
+
+ if ff(h("1"), g("2")); log != "h(1)g(2)ff(1, 2)" {
+ println("expecting h(1)g(2)ff..., got ", log)
+ err++
+ }
+ log = ""
+
+ if ff(h("1"), h("2")); log != "h(1)h(2)ff(1, 2)" {
+ println("expecting h(1)h(2)ff..., got ", log)
+ err++
+ }
+ log = ""
+
+ if s := g("1") + g("2"); log != "g(1)g(2)" || s != "12" {
+ println("expecting g1g2 and 12, got ", log, " and ", s)
+ err++
+ }
+ log = ""
+
+ if s := g("1") + h("2"); log != "g(1)h(2)" || s != "12" {
+ println("expecting g1h2 and 12, got ", log, " and ", s)
+ err++
+ }
+ log = ""
+
+ if s := h("1") + g("2"); log != "h(1)g(2)" || s != "12" {
+ println("expecting h1g2 and 12, got ", log, " and ", s)
+ err++
+ }
+ log = ""
+
+ if s := h("1") + h("2"); log != "h(1)h(2)" || s != "12" {
+ println("expecting h1h2 and 12, got ", log, " and ", s)
+ err++
+ }
+ log = ""
+
+ if err > 0 {
+ panic("fail")
+ }
+}
diff --git a/test/run b/test/run
index fce4d012f..302578eaa 100755
--- a/test/run
+++ b/test/run
@@ -3,8 +3,8 @@
# Use of this source code is governed by a BSD-style
# license that can be found in the LICENSE file.
-eval $(gomake --no-print-directory -f ../src/Make.inc go-env)
-
+eval $(go tool dist env)
+export GOARCH GOOS GOROOT
export E=
case X"$GOARCH" in
@@ -23,19 +23,24 @@ Xarm)
exit 1
esac
-export G=${A}g
+export G="${A}g ${GCFLAGS}"
export L=${A}l
export GOTRACEBACK=0
export LANG=C
unset GREP_OPTIONS # in case user has a non-standard set
+unset GOROOT_FINAL # breaks ./ imports
+
failed=0
-PATH=/bin:/usr/bin:/usr/local/bin:${GOBIN:-$GOROOT/bin}:`pwd`
+PATH=${GOBIN:-$GOROOT/bin}:`pwd`:/bin:/usr/bin:/usr/local/bin
+
+# TODO: We add the tool directory to the PATH to avoid thinking about a better way.
+PATH="$GOTOOLDIR:$PATH"
-RUNFILE="/tmp/gorun-$$-$USER"
-TMP1FILE="/tmp/gotest1-$$-$USER"
-TMP2FILE="/tmp/gotest2-$$-$USER"
+RUNFILE="${TMPDIR:-/tmp}/gorun-$$-$USER"
+TMP1FILE="${TMPDIR:-/tmp}/gotest1-$$-$USER"
+TMP2FILE="${TMPDIR:-/tmp}/gotest2-$$-$USER"
# don't run the machine out of memory: limit individual processes to 4GB.
# on thresher, 3GB suffices to run the tests; with 2GB, peano fails.
@@ -53,7 +58,7 @@ filterout() {
grep '^'"$2"'$' $1 >/dev/null
}
-for dir in . ken chan interface nilptr syntax dwarf fixedbugs bugs
+for dir in . ken chan interface syntax dwarf safe fixedbugs bugs
do
echo
echo '==' $dir'/'
@@ -64,7 +69,8 @@ do
fi
export F=$(basename $i .go)
export D=$dir
- sed '/^\/\//!q' $i | sed 's@//@@; $d' |sed 's|./\$A.out|$E &|g' >"$RUNFILE"
+ echo '. ./testlib' >"$RUNFILE"
+ sed '/^\/\//!q' $i | sed 's@//@@; $d' |sed 's|./\$A.out|$E &|g' >>"$RUNFILE"
if ! { time -p bash -c "bash '$RUNFILE' >'$TMP1FILE' 2>&1" ; } 2>"$TMP2FILE"
then
echo
diff --git a/test/run.go b/test/run.go
new file mode 100644
index 000000000..ac6e3c0e2
--- /dev/null
+++ b/test/run.go
@@ -0,0 +1,465 @@
+// skip
+
+// Copyright 2012 The Go Authors. All rights reserved.
+// Use of this source code is governed by a BSD-style
+// license that can be found in the LICENSE file.
+
+// Run runs tests in the test directory.
+//
+// TODO(bradfitz): docs of some sort, once we figure out how we're changing
+// headers of files
+package main
+
+import (
+ "bytes"
+ "errors"
+ "flag"
+ "fmt"
+ "go/build"
+ "io/ioutil"
+ "log"
+ "os"
+ "os/exec"
+ "path/filepath"
+ "regexp"
+ "runtime"
+ "sort"
+ "strconv"
+ "strings"
+)
+
+var (
+ verbose = flag.Bool("v", false, "verbose. if set, parallelism is set to 1.")
+ numParallel = flag.Int("n", runtime.NumCPU(), "number of parallel tests to run")
+ summary = flag.Bool("summary", false, "show summary of results")
+ showSkips = flag.Bool("show_skips", false, "show skipped tests")
+)
+
+var (
+ // gc and ld are [568][gl].
+ gc, ld string
+
+ // letter is the build.ArchChar
+ letter string
+
+ // dirs are the directories to look for *.go files in.
+ // TODO(bradfitz): just use all directories?
+ dirs = []string{".", "ken", "chan", "interface", "syntax", "dwarf", "fixedbugs", "bugs"}
+
+ // ratec controls the max number of tests running at a time.
+ ratec chan bool
+
+ // toRun is the channel of tests to run.
+ // It is nil until the first test is started.
+ toRun chan *test
+)
+
+// maxTests is an upper bound on the total number of tests.
+// It is used as a channel buffer size to make sure sends don't block.
+const maxTests = 5000
+
+func main() {
+ flag.Parse()
+
+ // Disable parallelism if printing
+ if *verbose {
+ *numParallel = 1
+ }
+
+ ratec = make(chan bool, *numParallel)
+ var err error
+ letter, err = build.ArchChar(build.Default.GOARCH)
+ check(err)
+ gc = letter + "g"
+ ld = letter + "l"
+
+ var tests []*test
+ if flag.NArg() > 0 {
+ for _, arg := range flag.Args() {
+ if arg == "-" || arg == "--" {
+ // Permit running either:
+ // $ go run run.go - env.go
+ // $ go run run.go -- env.go
+ continue
+ }
+ if !strings.HasSuffix(arg, ".go") {
+ log.Fatalf("can't yet deal with non-go file %q", arg)
+ }
+ dir, file := filepath.Split(arg)
+ tests = append(tests, startTest(dir, file))
+ }
+ } else {
+ for _, dir := range dirs {
+ for _, baseGoFile := range goFiles(dir) {
+ tests = append(tests, startTest(dir, baseGoFile))
+ }
+ }
+ }
+
+ failed := false
+ resCount := map[string]int{}
+ for _, test := range tests {
+ <-test.donec
+ _, isSkip := test.err.(skipError)
+ errStr := "pass"
+ if isSkip {
+ errStr = "skip"
+ }
+ if test.err != nil {
+ errStr = test.err.Error()
+ if !isSkip {
+ failed = true
+ }
+ }
+ resCount[errStr]++
+ if isSkip && !*verbose && !*showSkips {
+ continue
+ }
+ if !*verbose && test.err == nil {
+ continue
+ }
+ fmt.Printf("%-10s %-20s: %s\n", test.action, test.goFileName(), errStr)
+ }
+
+ if *summary {
+ for k, v := range resCount {
+ fmt.Printf("%5d %s\n", v, k)
+ }
+ }
+
+ if failed {
+ os.Exit(1)
+ }
+}
+
+func toolPath(name string) string {
+ p := filepath.Join(os.Getenv("GOROOT"), "bin", "tool", name)
+ if _, err := os.Stat(p); err != nil {
+ log.Fatalf("didn't find binary at %s", p)
+ }
+ return p
+}
+
+func goFiles(dir string) []string {
+ f, err := os.Open(dir)
+ check(err)
+ dirnames, err := f.Readdirnames(-1)
+ check(err)
+ names := []string{}
+ for _, name := range dirnames {
+ if !strings.HasPrefix(name, ".") && strings.HasSuffix(name, ".go") {
+ names = append(names, name)
+ }
+ }
+ sort.Strings(names)
+ return names
+}
+
+// skipError describes why a test was skipped.
+type skipError string
+
+func (s skipError) Error() string { return string(s) }
+
+func check(err error) {
+ if err != nil {
+ log.Fatal(err)
+ }
+}
+
+// test holds the state of a test.
+type test struct {
+ dir, gofile string
+ donec chan bool // closed when done
+
+ src string
+ action string // "compile", "build", "run", "errorcheck", "skip"
+
+ tempDir string
+ err error
+}
+
+// startTest
+func startTest(dir, gofile string) *test {
+ t := &test{
+ dir: dir,
+ gofile: gofile,
+ donec: make(chan bool, 1),
+ }
+ if toRun == nil {
+ toRun = make(chan *test, maxTests)
+ go runTests()
+ }
+ select {
+ case toRun <- t:
+ default:
+ panic("toRun buffer size (maxTests) is too small")
+ }
+ return t
+}
+
+// runTests runs tests in parallel, but respecting the order they
+// were enqueued on the toRun channel.
+func runTests() {
+ for {
+ ratec <- true
+ t := <-toRun
+ go func() {
+ t.run()
+ <-ratec
+ }()
+ }
+}
+
+var cwd, _ = os.Getwd()
+
+func (t *test) goFileName() string {
+ return filepath.Join(t.dir, t.gofile)
+}
+
+// run runs a test.
+func (t *test) run() {
+ defer close(t.donec)
+
+ srcBytes, err := ioutil.ReadFile(t.goFileName())
+ if err != nil {
+ t.err = err
+ return
+ }
+ t.src = string(srcBytes)
+ if t.src[0] == '\n' {
+ t.err = skipError("starts with newline")
+ return
+ }
+ pos := strings.Index(t.src, "\n\n")
+ if pos == -1 {
+ t.err = errors.New("double newline not found")
+ return
+ }
+ action := t.src[:pos]
+ if strings.HasPrefix(action, "//") {
+ action = action[2:]
+ }
+
+ var args []string
+ f := strings.Fields(action)
+ if len(f) > 0 {
+ action = f[0]
+ args = f[1:]
+ }
+
+ switch action {
+ case "cmpout":
+ action = "run" // the run case already looks for <dir>/<test>.out files
+ fallthrough
+ case "compile", "build", "run", "errorcheck":
+ t.action = action
+ case "skip":
+ t.action = "skip"
+ return
+ default:
+ t.err = skipError("skipped; unknown pattern: " + action)
+ t.action = "??"
+ return
+ }
+
+ t.makeTempDir()
+ defer os.RemoveAll(t.tempDir)
+
+ err = ioutil.WriteFile(filepath.Join(t.tempDir, t.gofile), srcBytes, 0644)
+ check(err)
+
+ // A few tests (of things like the environment) require these to be set.
+ os.Setenv("GOOS", runtime.GOOS)
+ os.Setenv("GOARCH", runtime.GOARCH)
+
+ useTmp := true
+ runcmd := func(args ...string) ([]byte, error) {
+ cmd := exec.Command(args[0], args[1:]...)
+ var buf bytes.Buffer
+ cmd.Stdout = &buf
+ cmd.Stderr = &buf
+ if useTmp {
+ cmd.Dir = t.tempDir
+ }
+ err := cmd.Run()
+ return buf.Bytes(), err
+ }
+
+ long := filepath.Join(cwd, t.goFileName())
+ switch action {
+ default:
+ t.err = fmt.Errorf("unimplemented action %q", action)
+
+ case "errorcheck":
+ out, _ := runcmd("go", "tool", gc, "-e", "-o", "a."+letter, long)
+ t.err = t.errorCheck(string(out), long, t.gofile)
+ return
+
+ case "compile":
+ out, err := runcmd("go", "tool", gc, "-e", "-o", "a."+letter, long)
+ if err != nil {
+ t.err = fmt.Errorf("%s\n%s", err, out)
+ }
+
+ case "build":
+ out, err := runcmd("go", "build", "-o", "a.exe", long)
+ if err != nil {
+ t.err = fmt.Errorf("%s\n%s", err, out)
+ }
+
+ case "run":
+ useTmp = false
+ out, err := runcmd(append([]string{"go", "run", t.goFileName()}, args...)...)
+ if err != nil {
+ t.err = fmt.Errorf("%s\n%s", err, out)
+ }
+ if string(out) != t.expectedOutput() {
+ t.err = fmt.Errorf("incorrect output\n%s", out)
+ }
+ }
+}
+
+func (t *test) String() string {
+ return filepath.Join(t.dir, t.gofile)
+}
+
+func (t *test) makeTempDir() {
+ var err error
+ t.tempDir, err = ioutil.TempDir("", "")
+ check(err)
+}
+
+func (t *test) expectedOutput() string {
+ filename := filepath.Join(t.dir, t.gofile)
+ filename = filename[:len(filename)-len(".go")]
+ filename += ".out"
+ b, _ := ioutil.ReadFile(filename)
+ return string(b)
+}
+
+func (t *test) errorCheck(outStr string, full, short string) (err error) {
+ defer func() {
+ if *verbose && err != nil {
+ log.Printf("%s gc output:\n%s", t, outStr)
+ }
+ }()
+ var errs []error
+
+ var out []string
+ // 6g error messages continue onto additional lines with leading tabs.
+ // Split the output at the beginning of each line that doesn't begin with a tab.
+ for _, line := range strings.Split(outStr, "\n") {
+ if strings.HasPrefix(line, "\t") {
+ out[len(out)-1] += "\n" + line
+ } else {
+ out = append(out, line)
+ }
+ }
+
+ // Cut directory name.
+ for i := range out {
+ out[i] = strings.Replace(out[i], full, short, -1)
+ }
+
+ for _, we := range t.wantedErrors() {
+ var errmsgs []string
+ errmsgs, out = partitionStrings(we.filterRe, out)
+ if len(errmsgs) == 0 {
+ errs = append(errs, fmt.Errorf("%s:%d: missing error %q", we.file, we.lineNum, we.reStr))
+ continue
+ }
+ matched := false
+ for _, errmsg := range errmsgs {
+ if we.re.MatchString(errmsg) {
+ matched = true
+ } else {
+ out = append(out, errmsg)
+ }
+ }
+ if !matched {
+ errs = append(errs, fmt.Errorf("%s:%d: no match for %q in%s", we.file, we.lineNum, we.reStr, strings.Join(out, "\n")))
+ continue
+ }
+ }
+
+ if len(errs) == 0 {
+ return nil
+ }
+ if len(errs) == 1 {
+ return errs[0]
+ }
+ var buf bytes.Buffer
+ fmt.Fprintf(&buf, "\n")
+ for _, err := range errs {
+ fmt.Fprintf(&buf, "%s\n", err.Error())
+ }
+ return errors.New(buf.String())
+
+}
+
+func partitionStrings(rx *regexp.Regexp, strs []string) (matched, unmatched []string) {
+ for _, s := range strs {
+ if rx.MatchString(s) {
+ matched = append(matched, s)
+ } else {
+ unmatched = append(unmatched, s)
+ }
+ }
+ return
+}
+
+type wantedError struct {
+ reStr string
+ re *regexp.Regexp
+ lineNum int
+ file string
+ filterRe *regexp.Regexp // /^file:linenum\b/m
+}
+
+var (
+ errRx = regexp.MustCompile(`// (?:GC_)?ERROR (.*)`)
+ errQuotesRx = regexp.MustCompile(`"([^"]*)"`)
+ lineRx = regexp.MustCompile(`LINE(([+-])([0-9]+))?`)
+)
+
+func (t *test) wantedErrors() (errs []wantedError) {
+ for i, line := range strings.Split(t.src, "\n") {
+ lineNum := i + 1
+ if strings.Contains(line, "////") {
+ // double comment disables ERROR
+ continue
+ }
+ m := errRx.FindStringSubmatch(line)
+ if m == nil {
+ continue
+ }
+ all := m[1]
+ mm := errQuotesRx.FindAllStringSubmatch(all, -1)
+ if mm == nil {
+ log.Fatalf("invalid errchk line in %s: %s", t.goFileName(), line)
+ }
+ for _, m := range mm {
+ rx := lineRx.ReplaceAllStringFunc(m[1], func(m string) string {
+ n := lineNum
+ if strings.HasPrefix(m, "LINE+") {
+ delta, _ := strconv.Atoi(m[5:])
+ n += delta
+ } else if strings.HasPrefix(m, "LINE-") {
+ delta, _ := strconv.Atoi(m[5:])
+ n -= delta
+ }
+ return fmt.Sprintf("%s:%d", t.gofile, n)
+ })
+ filterPattern := fmt.Sprintf(`^(\w+/)?%s:%d[:[]`, t.gofile, lineNum)
+ errs = append(errs, wantedError{
+ reStr: rx,
+ re: regexp.MustCompile(rx),
+ filterRe: regexp.MustCompile(filterPattern),
+ lineNum: lineNum,
+ file: t.gofile,
+ })
+ }
+ }
+
+ return
+}
diff --git a/test/rune.go b/test/rune.go
new file mode 100644
index 000000000..c013c471d
--- /dev/null
+++ b/test/rune.go
@@ -0,0 +1,47 @@
+// compile
+
+// Copyright 2011 The Go Authors. All rights reserved.
+// Use of this source code is governed by a BSD-style
+// license that can be found in the LICENSE file.
+
+// Test rune constants, expressions and types.
+// Compiles but does not run.
+
+package rune
+
+var (
+ r0 = 'a'
+ r1 = 'a'+1
+ r2 = 1+'a'
+ r3 = 'a'*2
+ r4 = 'a'/2
+ r5 = 'a'<<1
+ r6 = 'b'<<2
+ r7 int32
+
+ r = []rune{r0, r1, r2, r3, r4, r5, r6, r7}
+)
+
+var (
+ f0 = 1.2
+ f1 = 1.2/'a'
+
+ f = []float64{f0, f1}
+)
+
+var (
+ i0 = 1
+ i1 = 1<<'\x01'
+
+ i = []int{i0, i1}
+)
+
+const (
+ maxRune = '\U0010FFFF'
+)
+
+var (
+ b0 = maxRune < r0
+
+ b = []bool{b0}
+)
diff --git a/test/runtime.go b/test/runtime.go
index 4be1d055b..89f59e3ed 100644
--- a/test/runtime.go
+++ b/test/runtime.go
@@ -1,15 +1,16 @@
-// errchk $G $D/$F.go
+// errorcheck
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
-// make sure that even if a file imports runtime,
+// Test that even if a file imports runtime,
// it cannot get at the low-level runtime definitions
-// known to the compiler. for normal packages
+// known to the compiler. For normal packages
// the compiler doesn't even record the lower case
// functions in its symbol table, but some functions
// in runtime are hard-coded into the compiler.
+// Does not compile.
package main
diff --git a/test/safe/main.go b/test/safe/main.go
new file mode 100644
index 000000000..d173ed926
--- /dev/null
+++ b/test/safe/main.go
@@ -0,0 +1,14 @@
+// true
+
+// Copyright 2012 The Go Authors. All rights reserved.
+// Use of this source code is governed by a BSD-style
+// license that can be found in the LICENSE file.
+
+package main
+
+// can't use local path with -u, use -I. instead
+import "pkg" // ERROR "import unsafe package"
+
+func main() {
+ print(pkg.Float32bits(1.0))
+}
diff --git a/test/safe/nousesafe.go b/test/safe/nousesafe.go
new file mode 100644
index 000000000..f61e7fe4f
--- /dev/null
+++ b/test/safe/nousesafe.go
@@ -0,0 +1,8 @@
+// $G $D/pkg.go && pack grc pkg.a pkg.$A 2> /dev/null && rm pkg.$A && errchk $G -I. -u $D/main.go
+// rm -f pkg.a
+
+// Copyright 2012 The Go Authors. All rights reserved.
+// Use of this source code is governed by a BSD-style
+// license that can be found in the LICENSE file.
+
+package ignored
diff --git a/test/safe/pkg.go b/test/safe/pkg.go
new file mode 100644
index 000000000..bebc43a21
--- /dev/null
+++ b/test/safe/pkg.go
@@ -0,0 +1,16 @@
+// true
+
+// Copyright 2012 The Go Authors. All rights reserved.
+// Use of this source code is governed by a BSD-style
+// license that can be found in the LICENSE file.
+
+// a package that uses unsafe on the inside but not in it's api
+
+package pkg
+
+import "unsafe"
+
+// this should be inlinable
+func Float32bits(f float32) uint32 {
+ return *(*uint32)(unsafe.Pointer(&f))
+} \ No newline at end of file
diff --git a/test/safe/usesafe.go b/test/safe/usesafe.go
new file mode 100644
index 000000000..07c13c1c3
--- /dev/null
+++ b/test/safe/usesafe.go
@@ -0,0 +1,8 @@
+// $G $D/pkg.go && pack grcS pkg.a pkg.$A 2> /dev/null && rm pkg.$A && $G -I. -u $D/main.go
+// rm -f pkg.a
+
+// Copyright 2012 The Go Authors. All rights reserved.
+// Use of this source code is governed by a BSD-style
+// license that can be found in the LICENSE file.
+
+package ignored
diff --git a/test/shift1.go b/test/shift1.go
index 6a8e26e5e..b33d22ff8 100644
--- a/test/shift1.go
+++ b/test/shift1.go
@@ -1,10 +1,12 @@
-// errchk $G -e $D/$F.go
+// errorcheck
// Copyright 2011 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
+// Test illegal shifts.
// Issue 1708, illegal cases.
+// Does not compile.
package p
@@ -15,14 +17,14 @@ func h(x float64) int { return 0 }
// from the spec
var (
s uint = 33
- u = 1.0 << s // ERROR "invalid operation"
- v float32 = 1 << s // ERROR "invalid operation" "as type float32"
+ u = 1.0 << s // ERROR "invalid operation|shift of non-integer operand"
+ v float32 = 1 << s // ERROR "invalid" "as type float32"
)
// non-constant shift expressions
var (
- e1 = g(2.0 << s) // ERROR "invalid operation" "as type interface"
- f1 = h(2 << s) // ERROR "invalid operation" "as type float64"
+ e1 = g(2.0 << s) // ERROR "invalid" "as type interface"
+ f1 = h(2 << s) // ERROR "invalid" "as type float64"
g1 int64 = 1.1 << s // ERROR "truncated"
)
diff --git a/test/shift2.go b/test/shift2.go
index ec4c7addc..88ef3c40f 100644
--- a/test/shift2.go
+++ b/test/shift2.go
@@ -1,10 +1,12 @@
-// $G $D/$F.go || echo BUG: shift2
+// compile
// Copyright 2011 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
+// Test legal shifts.
// Issue 1708, legal cases.
+// Compiles but does not run.
package p
diff --git a/test/sieve.go b/test/sieve.go
index 4fa111582..0cd120c54 100644
--- a/test/sieve.go
+++ b/test/sieve.go
@@ -1,9 +1,12 @@
-// $G $F.go && $L $F.$A # don't run it - goes forever
+// build
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
+// Test basic concurrency: the classic prime sieve.
+// Do not run - loops forever.
+
package main
// Send the sequence 2, 3, 4, ... to channel 'ch'.
diff --git a/test/sigchld.go b/test/sigchld.go
index 1fb2e21bd..25625a6f4 100644
--- a/test/sigchld.go
+++ b/test/sigchld.go
@@ -1,9 +1,12 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// [ "$GOOS" == windows ] ||
+// ($G $D/$F.go && $L $F.$A && ./$A.out 2>&1 | cmp - $D/$F.out)
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
+// Test that a program can survive SIGCHLD.
+
package main
import "syscall"
diff --git a/test/sigchld.out b/test/sigchld.out
new file mode 100644
index 000000000..477d02579
--- /dev/null
+++ b/test/sigchld.out
@@ -0,0 +1 @@
+survived SIGCHLD
diff --git a/test/simassign.go b/test/simassign.go
index 28408abc2..6ba5c783e 100644
--- a/test/simassign.go
+++ b/test/simassign.go
@@ -1,9 +1,11 @@
-// $G $F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
+// Test simultaneous assignment.
+
package main
var a, b, c, d, e, f, g, h, i int
diff --git a/test/sinit.go b/test/sinit.go
index 2adb931e1..1bc281037 100644
--- a/test/sinit.go
+++ b/test/sinit.go
@@ -1,53 +1,56 @@
-// $G -S $D/$F.go | egrep initdone >/dev/null && echo FAIL || true
+// $G -S $D/$F.go | egrep initdone >/dev/null && echo BUG sinit || true
// Copyright 2010 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
+// Test that many initializations can be done at link time and
+// generate no executable init functions.
+
package p
// Should be no init func in the assembly.
// All these initializations should be done at link time.
-type S struct{ a,b,c int }
-type SS struct{ aa,bb,cc S }
-type SA struct{ a,b,c [3]int }
-type SC struct{ a,b,c []int }
+type S struct{ a, b, c int }
+type SS struct{ aa, bb, cc S }
+type SA struct{ a, b, c [3]int }
+type SC struct{ a, b, c []int }
var (
- zero = 2
- one = 1
- pi = 3.14
- slice = []byte{1,2,3}
- sliceInt = []int{1,2,3}
- hello = "hello, world"
- bytes = []byte("hello, world")
- four, five = 4, 5
- x, y = 0.1, "hello"
- nilslice []byte = nil
- nilmap map[string]int = nil
- nilfunc func() = nil
- nilchan chan int = nil
- nilptr *byte = nil
+ zero = 2
+ one = 1
+ pi = 3.14
+ slice = []byte{1, 2, 3}
+ sliceInt = []int{1, 2, 3}
+ hello = "hello, world"
+ bytes = []byte("hello, world")
+ four, five = 4, 5
+ x, y = 0.1, "hello"
+ nilslice []byte = nil
+ nilmap map[string]int = nil
+ nilfunc func() = nil
+ nilchan chan int = nil
+ nilptr *byte = nil
)
-var a = [3]int{1001, 1002, 1003}
-var s = S{1101, 1102, 1103}
-var c = []int{1201, 1202, 1203}
+var a = [3]int{1001, 1002, 1003}
+var s = S{1101, 1102, 1103}
+var c = []int{1201, 1202, 1203}
-var aa = [3][3]int{[3]int{2001,2002,2003}, [3]int{2004,2005,2006}, [3]int{2007,2008,2009}}
-var as = [3]S{S{2101,2102,2103},S{2104,2105,2106},S{2107,2108,2109}}
-var ac = [3][]int{[]int{2201,2202,2203}, []int{2204,2205,2206}, []int{2207,2208,2209}}
+var aa = [3][3]int{[3]int{2001, 2002, 2003}, [3]int{2004, 2005, 2006}, [3]int{2007, 2008, 2009}}
+var as = [3]S{S{2101, 2102, 2103}, S{2104, 2105, 2106}, S{2107, 2108, 2109}}
+var ac = [3][]int{[]int{2201, 2202, 2203}, []int{2204, 2205, 2206}, []int{2207, 2208, 2209}}
-var sa = SA{[3]int{3001,3002,3003},[3]int{3004,3005,3006},[3]int{3007,3008,3009}}
-var ss = SS{S{3101,3102,3103},S{3104,3105,3106},S{3107,3108,3109}}
-var sc = SC{[]int{3201,3202,3203},[]int{3204,3205,3206},[]int{3207,3208,3209}}
+var sa = SA{[3]int{3001, 3002, 3003}, [3]int{3004, 3005, 3006}, [3]int{3007, 3008, 3009}}
+var ss = SS{S{3101, 3102, 3103}, S{3104, 3105, 3106}, S{3107, 3108, 3109}}
+var sc = SC{[]int{3201, 3202, 3203}, []int{3204, 3205, 3206}, []int{3207, 3208, 3209}}
-var ca = [][3]int{[3]int{4001,4002,4003}, [3]int{4004,4005,4006}, [3]int{4007,4008,4009}}
-var cs = []S{S{4101,4102,4103},S{4104,4105,4106},S{4107,4108,4109}}
-var cc = [][]int{[]int{4201,4202,4203}, []int{4204,4205,4206}, []int{4207,4208,4209}}
+var ca = [][3]int{[3]int{4001, 4002, 4003}, [3]int{4004, 4005, 4006}, [3]int{4007, 4008, 4009}}
+var cs = []S{S{4101, 4102, 4103}, S{4104, 4105, 4106}, S{4107, 4108, 4109}}
+var cc = [][]int{[]int{4201, 4202, 4203}, []int{4204, 4205, 4206}, []int{4207, 4208, 4209}}
-var answers = [...]int {
+var answers = [...]int{
// s
1101, 1102, 1103,
@@ -98,3 +101,158 @@ var answers = [...]int {
2008, 2208, 2308, 4008, 4208, 4308, 5008, 5208, 5308,
2009, 2209, 2309, 4009, 4209, 4309, 5009, 5209, 5309,
}
+
+var (
+ copy_zero = zero
+ copy_one = one
+ copy_pi = pi
+ copy_slice = slice
+ copy_sliceInt = sliceInt
+ copy_hello = hello
+ copy_bytes = bytes
+ copy_four, copy_five = four, five
+ copy_x, copy_y = x, y
+ copy_nilslice = nilslice
+ copy_nilmap = nilmap
+ copy_nilfunc = nilfunc
+ copy_nilchan = nilchan
+ copy_nilptr = nilptr
+)
+
+var copy_a = a
+var copy_s = s
+var copy_c = c
+
+var copy_aa = aa
+var copy_as = as
+var copy_ac = ac
+
+var copy_sa = sa
+var copy_ss = ss
+var copy_sc = sc
+
+var copy_ca = ca
+var copy_cs = cs
+var copy_cc = cc
+
+var copy_answers = answers
+
+var bx bool
+var b0 = false
+var b1 = true
+
+var fx float32
+var f0 = float32(0)
+var f1 = float32(1)
+
+var gx float64
+var g0 = float64(0)
+var g1 = float64(1)
+
+var ix int
+var i0 = 0
+var i1 = 1
+
+var jx uint
+var j0 = uint(0)
+var j1 = uint(1)
+
+var cx complex64
+var c0 = complex64(0)
+var c1 = complex64(1)
+
+var dx complex128
+var d0 = complex128(0)
+var d1 = complex128(1)
+
+var sx []int
+var s0 = []int{0, 0, 0}
+var s1 = []int{1, 2, 3}
+
+func fi() int
+
+var ax [10]int
+var a0 = [10]int{0, 0, 0}
+var a1 = [10]int{1, 2, 3, 4}
+
+type T struct{ X, Y int }
+
+var tx T
+var t0 = T{}
+var t0a = T{0, 0}
+var t0b = T{X: 0}
+var t1 = T{X: 1, Y: 2}
+var t1a = T{3, 4}
+
+var psx *[]int
+var ps0 = &[]int{0, 0, 0}
+var ps1 = &[]int{1, 2, 3}
+
+var pax *[10]int
+var pa0 = &[10]int{0, 0, 0}
+var pa1 = &[10]int{1, 2, 3}
+
+var ptx *T
+var pt0 = &T{}
+var pt0a = &T{0, 0}
+var pt0b = &T{X: 0}
+var pt1 = &T{X: 1, Y: 2}
+var pt1a = &T{3, 4}
+
+var copy_bx = bx
+var copy_b0 = b0
+var copy_b1 = b1
+
+var copy_fx = fx
+var copy_f0 = f0
+var copy_f1 = f1
+
+var copy_gx = gx
+var copy_g0 = g0
+var copy_g1 = g1
+
+var copy_ix = ix
+var copy_i0 = i0
+var copy_i1 = i1
+
+var copy_jx = jx
+var copy_j0 = j0
+var copy_j1 = j1
+
+var copy_cx = cx
+var copy_c0 = c0
+var copy_c1 = c1
+
+var copy_dx = dx
+var copy_d0 = d0
+var copy_d1 = d1
+
+var copy_sx = sx
+var copy_s0 = s0
+var copy_s1 = s1
+
+var copy_ax = ax
+var copy_a0 = a0
+var copy_a1 = a1
+
+var copy_tx = tx
+var copy_t0 = t0
+var copy_t0a = t0a
+var copy_t0b = t0b
+var copy_t1 = t1
+var copy_t1a = t1a
+
+var copy_psx = psx
+var copy_ps0 = ps0
+var copy_ps1 = ps1
+
+var copy_pax = pax
+var copy_pa0 = pa0
+var copy_pa1 = pa1
+
+var copy_ptx = ptx
+var copy_pt0 = pt0
+var copy_pt0a = pt0a
+var copy_pt0b = pt0b
+var copy_pt1 = pt1
+var copy_pt1a = pt1a
diff --git a/test/sizeof.go b/test/sizeof.go
index 544e4c52c..a6abdd5c6 100644
--- a/test/sizeof.go
+++ b/test/sizeof.go
@@ -1,9 +1,11 @@
-// $G $D/$F.go
+// compile
// Copyright 2011 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
+// Test unsafe.Sizeof, unsafe.Alignof, and unsafe.Offsetof all return uintptr.
+
package main
import "unsafe"
diff --git a/test/solitaire.go b/test/solitaire.go
index c789bf24a..ac54cec0a 100644
--- a/test/solitaire.go
+++ b/test/solitaire.go
@@ -1,9 +1,13 @@
-// $G $F.go && $L $F.$A # don't run it - produces too much output
+// build
// Copyright 2010 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
+// Test general operation by solving a peg solitaire game.
+// A version of this is in the Go playground.
+// Don't run it - produces too much output.
+
// This program solves the (English) peg solitaire board game.
// See also: http://en.wikipedia.org/wiki/Peg_solitaire
@@ -14,7 +18,7 @@ const N = 11 + 1 // length of a board row (+1 for newline)
// The board must be surrounded by 2 illegal fields in each direction
// so that move() doesn't need to check the board boundaries. Periods
// represent illegal fields, ● are pegs, and ○ are holes.
-var board = []int(
+var board = []rune(
`...........
...........
....●●●....
@@ -28,7 +32,6 @@ var board = []int(
...........
`)
-
// center is the position of the center hole if there is a single one;
// otherwise it is -1.
var center int
@@ -46,7 +49,6 @@ func init() {
}
}
-
var moves int // number of times move is called
// move tests if there is a peg at position pos that can jump over another peg
@@ -63,7 +65,6 @@ func move(pos, dir int) bool {
return false
}
-
// unmove reverts a previously executed valid move.
func unmove(pos, dir int) {
board[pos] = '●'
@@ -71,7 +72,6 @@ func unmove(pos, dir int) {
board[pos+2*dir] = '○'
}
-
// solve tries to find a sequence of moves such that there is only one peg left
// at the end; if center is >= 0, that last peg must be in the center position.
// If a solution is found, solve prints the board after each move in a backward
@@ -110,7 +110,6 @@ func solve() bool {
return false
}
-
func main() {
if !solve() {
println("no solution found")
diff --git a/test/stack.go b/test/stack.go
index 1fd57161f..b62febd48 100644
--- a/test/stack.go
+++ b/test/stack.go
@@ -1,9 +1,10 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
+// Test stack splitting code.
// Try to tickle stack splitting bugs by doing
// go, defer, and closure calls at different stack depths.
diff --git a/test/string_lit.go b/test/string_lit.go
index 4358dd8e8..956330038 100644
--- a/test/string_lit.go
+++ b/test/string_lit.go
@@ -1,9 +1,11 @@
-// $G $F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
+// Test string literal syntax.
+
package main
import "os"
@@ -35,14 +37,14 @@ func assert(a, b, c string) {
}
const (
- gx1 = "aä本☺"
- gx2 = "aä\xFF\xFF本☺"
+ gx1 = "aä本☺"
+ gx2 = "aä\xFF\xFF本☺"
gx2fix = "aä\uFFFD\uFFFD本☺"
)
var (
- gr1 = []int(gx1)
- gr2 = []int(gx2)
+ gr1 = []rune(gx1)
+ gr2 = []rune(gx2)
gb1 = []byte(gx1)
gb2 = []byte(gx2)
)
@@ -93,26 +95,26 @@ func main() {
// test large runes. perhaps not the most logical place for this test.
var r int32
- r = 0x10ffff; // largest rune value
+ r = 0x10ffff // largest rune value
s = string(r)
assert(s, "\xf4\x8f\xbf\xbf", "largest rune")
r = 0x10ffff + 1
s = string(r)
assert(s, "\xef\xbf\xbd", "too-large rune")
- assert(string(gr1), gx1, "global ->[]int")
- assert(string(gr2), gx2fix, "global invalid ->[]int")
+ assert(string(gr1), gx1, "global ->[]rune")
+ assert(string(gr2), gx2fix, "global invalid ->[]rune")
assert(string(gb1), gx1, "->[]byte")
assert(string(gb2), gx2, "global invalid ->[]byte")
var (
- r1 = []int(gx1)
- r2 = []int(gx2)
+ r1 = []rune(gx1)
+ r2 = []rune(gx2)
b1 = []byte(gx1)
b2 = []byte(gx2)
)
- assert(string(r1), gx1, "->[]int")
- assert(string(r2), gx2fix, "invalid ->[]int")
+ assert(string(r1), gx1, "->[]rune")
+ assert(string(r2), gx2fix, "invalid ->[]rune")
assert(string(b1), gx1, "->[]byte")
assert(string(b2), gx2, "invalid ->[]byte")
diff --git a/test/stringrange.go b/test/stringrange.go
index d5ada2628..daaba91c6 100644
--- a/test/stringrange.go
+++ b/test/stringrange.go
@@ -1,36 +1,39 @@
-// $G $F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
+// Test range over strings.
+
package main
import (
"fmt"
"os"
- "utf8"
+ "unicode/utf8"
)
func main() {
s := "\000\123\x00\xca\xFE\u0123\ubabe\U0000babe\U0010FFFFx"
- expect := []int{ 0, 0123, 0, 0xFFFD, 0xFFFD, 0x123, 0xbabe, 0xbabe, 0x10FFFF, 'x' }
+ expect := []rune{0, 0123, 0, 0xFFFD, 0xFFFD, 0x123, 0xbabe, 0xbabe, 0x10FFFF, 'x'}
offset := 0
- var i, c int
+ var i int
+ var c rune
ok := true
cnum := 0
for i, c = range s {
- rune, size := utf8.DecodeRuneInString(s[i:len(s)]) // check it another way
+ r, size := utf8.DecodeRuneInString(s[i:len(s)]) // check it another way
if i != offset {
fmt.Printf("unexpected offset %d not %d\n", i, offset)
ok = false
}
- if rune != expect[cnum] {
- fmt.Printf("unexpected rune %d from DecodeRuneInString: %x not %x\n", i, rune, expect[cnum])
+ if r != expect[cnum] {
+ fmt.Printf("unexpected rune %d from DecodeRuneInString: %x not %x\n", i, r, expect[cnum])
ok = false
}
if c != expect[cnum] {
- fmt.Printf("unexpected rune %d from range: %x not %x\n", i, rune, expect[cnum])
+ fmt.Printf("unexpected rune %d from range: %x not %x\n", i, r, expect[cnum])
ok = false
}
offset += size
diff --git a/test/struct0.go b/test/struct0.go
new file mode 100644
index 000000000..e29eb30f5
--- /dev/null
+++ b/test/struct0.go
@@ -0,0 +1,34 @@
+// run
+
+// Copyright 2011 The Go Authors. All rights reserved.
+// Use of this source code is governed by a BSD-style
+// license that can be found in the LICENSE file.
+
+// Test zero length structs.
+// Used to not be evaluated.
+// Issue 2232.
+
+package main
+
+func recv(c chan interface{}) struct{} {
+ return (<-c).(struct{})
+}
+
+var m = make(map[interface{}]int)
+
+func recv1(c chan interface{}) {
+ defer rec()
+ m[(<-c).(struct{})] = 0
+}
+
+func rec() {
+ recover()
+}
+
+func main() {
+ c := make(chan interface{})
+ go recv(c)
+ c <- struct{}{}
+ go recv1(c)
+ c <- struct{}{}
+}
diff --git a/test/switch.go b/test/switch.go
index 0c253d6e2..09bf4341a 100644
--- a/test/switch.go
+++ b/test/switch.go
@@ -1,11 +1,15 @@
-// $G $F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
+// Test switch statements.
+
package main
+import "os"
+
func assert(cond bool, msg string) {
if !cond {
print("assertion fail: ", msg, "\n")
@@ -19,48 +23,75 @@ func main() {
hello := "hello"
switch true {
- case i5 < 5: assert(false, "<")
- case i5 == 5: assert(true, "!")
- case i5 > 5: assert(false, ">")
+ case i5 < 5:
+ assert(false, "<")
+ case i5 == 5:
+ assert(true, "!")
+ case i5 > 5:
+ assert(false, ">")
}
switch {
- case i5 < 5: assert(false, "<")
- case i5 == 5: assert(true, "!")
- case i5 > 5: assert(false, ">")
+ case i5 < 5:
+ assert(false, "<")
+ case i5 == 5:
+ assert(true, "!")
+ case i5 > 5:
+ assert(false, ">")
}
switch x := 5; true {
- case i5 < x: assert(false, "<")
- case i5 == x: assert(true, "!")
- case i5 > x: assert(false, ">")
+ case i5 < x:
+ assert(false, "<")
+ case i5 == x:
+ assert(true, "!")
+ case i5 > x:
+ assert(false, ">")
}
switch x := 5; true {
- case i5 < x: assert(false, "<")
- case i5 == x: assert(true, "!")
- case i5 > x: assert(false, ">")
+ case i5 < x:
+ assert(false, "<")
+ case i5 == x:
+ assert(true, "!")
+ case i5 > x:
+ assert(false, ">")
}
switch i5 {
- case 0: assert(false, "0")
- case 1: assert(false, "1")
- case 2: assert(false, "2")
- case 3: assert(false, "3")
- case 4: assert(false, "4")
- case 5: assert(true, "5")
- case 6: assert(false, "6")
- case 7: assert(false, "7")
- case 8: assert(false, "8")
- case 9: assert(false, "9")
- default: assert(false, "default")
+ case 0:
+ assert(false, "0")
+ case 1:
+ assert(false, "1")
+ case 2:
+ assert(false, "2")
+ case 3:
+ assert(false, "3")
+ case 4:
+ assert(false, "4")
+ case 5:
+ assert(true, "5")
+ case 6:
+ assert(false, "6")
+ case 7:
+ assert(false, "7")
+ case 8:
+ assert(false, "8")
+ case 9:
+ assert(false, "9")
+ default:
+ assert(false, "default")
}
switch i5 {
- case 0,1,2,3,4: assert(false, "4")
- case 5: assert(true, "5")
- case 6,7,8,9: assert(false, "9")
- default: assert(false, "default")
+ case 0, 1, 2, 3, 4:
+ assert(false, "4")
+ case 5:
+ assert(true, "5")
+ case 6, 7, 8, 9:
+ assert(false, "9")
+ default:
+ assert(false, "default")
}
switch i5 {
@@ -68,72 +99,197 @@ func main() {
case 1:
case 2:
case 3:
- case 4: assert(false, "4")
- case 5: assert(true, "5")
+ case 4:
+ assert(false, "4")
+ case 5:
+ assert(true, "5")
case 6:
case 7:
case 8:
case 9:
- default: assert(i5 == 5, "good")
+ default:
+ assert(i5 == 5, "good")
}
switch i5 {
- case 0: dummy := 0; _ = dummy; fallthrough
- case 1: dummy := 0; _ = dummy; fallthrough
- case 2: dummy := 0; _ = dummy; fallthrough
- case 3: dummy := 0; _ = dummy; fallthrough
- case 4: dummy := 0; _ = dummy; assert(false, "4")
- case 5: dummy := 0; _ = dummy; fallthrough
- case 6: dummy := 0; _ = dummy; fallthrough
- case 7: dummy := 0; _ = dummy; fallthrough
- case 8: dummy := 0; _ = dummy; fallthrough
- case 9: dummy := 0; _ = dummy; fallthrough
- default: dummy := 0; _ = dummy; assert(i5 == 5, "good")
+ case 0:
+ dummy := 0
+ _ = dummy
+ fallthrough
+ case 1:
+ dummy := 0
+ _ = dummy
+ fallthrough
+ case 2:
+ dummy := 0
+ _ = dummy
+ fallthrough
+ case 3:
+ dummy := 0
+ _ = dummy
+ fallthrough
+ case 4:
+ dummy := 0
+ _ = dummy
+ assert(false, "4")
+ case 5:
+ dummy := 0
+ _ = dummy
+ fallthrough
+ case 6:
+ dummy := 0
+ _ = dummy
+ fallthrough
+ case 7:
+ dummy := 0
+ _ = dummy
+ fallthrough
+ case 8:
+ dummy := 0
+ _ = dummy
+ fallthrough
+ case 9:
+ dummy := 0
+ _ = dummy
+ fallthrough
+ default:
+ dummy := 0
+ _ = dummy
+ assert(i5 == 5, "good")
}
fired := false
switch i5 {
- case 0: dummy := 0; _ = dummy; fallthrough; // tests scoping of cases
- case 1: dummy := 0; _ = dummy; fallthrough
- case 2: dummy := 0; _ = dummy; fallthrough
- case 3: dummy := 0; _ = dummy; fallthrough
- case 4: dummy := 0; _ = dummy; assert(false, "4")
- case 5: dummy := 0; _ = dummy; fallthrough
- case 6: dummy := 0; _ = dummy; fallthrough
- case 7: dummy := 0; _ = dummy; fallthrough
- case 8: dummy := 0; _ = dummy; fallthrough
- case 9: dummy := 0; _ = dummy; fallthrough
- default: dummy := 0; _ = dummy; fired = !fired; assert(i5 == 5, "good")
+ case 0:
+ dummy := 0
+ _ = dummy
+ fallthrough // tests scoping of cases
+ case 1:
+ dummy := 0
+ _ = dummy
+ fallthrough
+ case 2:
+ dummy := 0
+ _ = dummy
+ fallthrough
+ case 3:
+ dummy := 0
+ _ = dummy
+ fallthrough
+ case 4:
+ dummy := 0
+ _ = dummy
+ assert(false, "4")
+ case 5:
+ dummy := 0
+ _ = dummy
+ fallthrough
+ case 6:
+ dummy := 0
+ _ = dummy
+ fallthrough
+ case 7:
+ dummy := 0
+ _ = dummy
+ fallthrough
+ case 8:
+ dummy := 0
+ _ = dummy
+ fallthrough
+ case 9:
+ dummy := 0
+ _ = dummy
+ fallthrough
+ default:
+ dummy := 0
+ _ = dummy
+ fired = !fired
+ assert(i5 == 5, "good")
}
assert(fired, "fired")
count := 0
switch i5 {
- case 0: count = count + 1; fallthrough
- case 1: count = count + 1; fallthrough
- case 2: count = count + 1; fallthrough
- case 3: count = count + 1; fallthrough
- case 4: count = count + 1; assert(false, "4")
- case 5: count = count + 1; fallthrough
- case 6: count = count + 1; fallthrough
- case 7: count = count + 1; fallthrough
- case 8: count = count + 1; fallthrough
- case 9: count = count + 1; fallthrough
- default: assert(i5 == count, "good")
+ case 0:
+ count = count + 1
+ fallthrough
+ case 1:
+ count = count + 1
+ fallthrough
+ case 2:
+ count = count + 1
+ fallthrough
+ case 3:
+ count = count + 1
+ fallthrough
+ case 4:
+ count = count + 1
+ assert(false, "4")
+ case 5:
+ count = count + 1
+ fallthrough
+ case 6:
+ count = count + 1
+ fallthrough
+ case 7:
+ count = count + 1
+ fallthrough
+ case 8:
+ count = count + 1
+ fallthrough
+ case 9:
+ count = count + 1
+ fallthrough
+ default:
+ assert(i5 == count, "good")
}
assert(fired, "fired")
switch hello {
- case "wowie": assert(false, "wowie")
- case "hello": assert(true, "hello")
- case "jumpn": assert(false, "jumpn")
- default: assert(false, "default")
+ case "wowie":
+ assert(false, "wowie")
+ case "hello":
+ assert(true, "hello")
+ case "jumpn":
+ assert(false, "jumpn")
+ default:
+ assert(false, "default")
}
fired = false
switch i := i5 + 2; i {
- case i7: fired = true
- default: assert(false, "fail")
+ case i7:
+ fired = true
+ default:
+ assert(false, "fail")
}
assert(fired, "var")
+
+ // switch on nil-only comparison types
+ switch f := func() {}; f {
+ case nil:
+ assert(false, "f should not be nil")
+ default:
+ }
+
+ switch m := make(map[int]int); m {
+ case nil:
+ assert(false, "m should not be nil")
+ default:
+ }
+
+ switch a := make([]int, 1); a {
+ case nil:
+ assert(false, "m should not be nil")
+ default:
+ }
+
+ i := 0
+ switch x := 5; {
+ case i < x:
+ os.Exit(0)
+ case i == x:
+ case i > x:
+ os.Exit(1)
+ }
}
diff --git a/test/switch1.go b/test/switch1.go
deleted file mode 100644
index 5bd9d7c5d..000000000
--- a/test/switch1.go
+++ /dev/null
@@ -1,20 +0,0 @@
-// $G $F.go && $L $F.$A && ./$A.out
-
-// Copyright 2009 The Go Authors. All rights reserved.
-// Use of this source code is governed by a BSD-style
-// license that can be found in the LICENSE file.
-
-package main
-
-import "os"
-
-func main() {
- i := 0
- switch x := 5; {
- case i < x:
- os.Exit(0)
- case i == x:
- case i > x:
- os.Exit(1)
- }
-}
diff --git a/test/switch3.go b/test/switch3.go
new file mode 100644
index 000000000..dcb6fff20
--- /dev/null
+++ b/test/switch3.go
@@ -0,0 +1,61 @@
+// errorcheck
+
+// Copyright 2011 The Go Authors. All rights reserved.
+// Use of this source code is governed by a BSD-style
+// license that can be found in the LICENSE file.
+
+// Verify that erroneous switch statements are detected by the compiler.
+// Does not compile.
+
+package main
+
+type I interface {
+ M()
+}
+
+func bad() {
+ var i I
+ var s string
+
+ switch i {
+ case s: // ERROR "mismatched types string and I|incompatible types"
+ }
+
+ switch s {
+ case i: // ERROR "mismatched types I and string|incompatible types"
+ }
+
+ var m, m1 map[int]int
+ switch m {
+ case nil:
+ case m1: // ERROR "can only compare map m to nil|map can only be compared to nil"
+ default:
+ }
+
+ var a, a1 []int
+ switch a {
+ case nil:
+ case a1: // ERROR "can only compare slice a to nil|slice can only be compared to nil"
+ default:
+ }
+
+ var f, f1 func()
+ switch f {
+ case nil:
+ case f1: // ERROR "can only compare func f to nil|func can only be compared to nil"
+ default:
+ }
+}
+
+func good() {
+ var i interface{}
+ var s string
+
+ switch i {
+ case s:
+ }
+
+ switch s {
+ case i:
+ }
+}
diff --git a/test/syntax/chan.go b/test/syntax/chan.go
index ff3577502..3b68bda35 100644
--- a/test/syntax/chan.go
+++ b/test/syntax/chan.go
@@ -1,4 +1,4 @@
-// errchk $G -e $D/$F.go
+// errorcheck
// Copyright 2010 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/syntax/chan1.go b/test/syntax/chan1.go
index 9c12e5e6f..868a1226d 100644
--- a/test/syntax/chan1.go
+++ b/test/syntax/chan1.go
@@ -1,4 +1,4 @@
-// errchk $G -e $D/$F.go
+// errorcheck
// Copyright 2010 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/syntax/else.go b/test/syntax/else.go
new file mode 100644
index 000000000..e985a9c09
--- /dev/null
+++ b/test/syntax/else.go
@@ -0,0 +1,12 @@
+// errorcheck
+
+// Copyright 2011 The Go Authors. All rights reserved.
+// Use of this source code is governed by a BSD-style
+// license that can be found in the LICENSE file.
+
+package main
+
+func main() {
+ if true {
+ } else ; // ERROR "else must be followed by if or statement block|expected .if. or .{."
+}
diff --git a/test/syntax/forvar.go b/test/syntax/forvar.go
index f12ce55ca..dc592d2b6 100644
--- a/test/syntax/forvar.go
+++ b/test/syntax/forvar.go
@@ -1,4 +1,4 @@
-// errchk $G -e $D/$F.go
+// errorcheck
// Copyright 2010 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/syntax/if.go b/test/syntax/if.go
index a3b51f0c0..b2a65f9a5 100644
--- a/test/syntax/if.go
+++ b/test/syntax/if.go
@@ -1,4 +1,4 @@
-// errchk $G $D/$F.go
+// errorcheck
// Copyright 2011 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/syntax/import.go b/test/syntax/import.go
index dd1f26134..f0a792126 100644
--- a/test/syntax/import.go
+++ b/test/syntax/import.go
@@ -1,4 +1,4 @@
-// errchk $G -e $D/$F.go
+// errorcheck
// Copyright 2010 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/syntax/interface.go b/test/syntax/interface.go
index a7f43533a..0b76b5416 100644
--- a/test/syntax/interface.go
+++ b/test/syntax/interface.go
@@ -1,4 +1,4 @@
-// errchk $G -e $D/$F.go
+// errorcheck
// Copyright 2010 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/syntax/semi1.go b/test/syntax/semi1.go
index 547d9bf79..8fbfb206a 100644
--- a/test/syntax/semi1.go
+++ b/test/syntax/semi1.go
@@ -1,4 +1,4 @@
-// errchk $G -e $D/$F.go
+// errorcheck
// Copyright 2010 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/syntax/semi2.go b/test/syntax/semi2.go
index 28d1d3906..cfb0ed17b 100644
--- a/test/syntax/semi2.go
+++ b/test/syntax/semi2.go
@@ -1,4 +1,4 @@
-// errchk $G -e $D/$F.go
+// errorcheck
// Copyright 2010 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/syntax/semi3.go b/test/syntax/semi3.go
index ab5941bda..645af7354 100644
--- a/test/syntax/semi3.go
+++ b/test/syntax/semi3.go
@@ -1,4 +1,4 @@
-// errchk $G -e $D/$F.go
+// errorcheck
// Copyright 2010 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/syntax/semi4.go b/test/syntax/semi4.go
index 7a9c2956e..e192348aa 100644
--- a/test/syntax/semi4.go
+++ b/test/syntax/semi4.go
@@ -1,4 +1,4 @@
-// errchk $G -e $D/$F.go
+// errorcheck
// Copyright 2010 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/syntax/semi5.go b/test/syntax/semi5.go
index 5f8ccc688..cf690f084 100644
--- a/test/syntax/semi5.go
+++ b/test/syntax/semi5.go
@@ -1,4 +1,4 @@
-// errchk $G -e $D/$F.go
+// errorcheck
// Copyright 2010 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/syntax/semi6.go b/test/syntax/semi6.go
index b6279ed30..c1e1cc363 100644
--- a/test/syntax/semi6.go
+++ b/test/syntax/semi6.go
@@ -1,4 +1,4 @@
-// errchk $G -e $D/$F.go
+// errorcheck
// Copyright 2010 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/syntax/semi7.go b/test/syntax/semi7.go
index 5a7b3ff4c..6c9ade8bc 100644
--- a/test/syntax/semi7.go
+++ b/test/syntax/semi7.go
@@ -1,4 +1,4 @@
-// errchk $G -e $D/$F.go
+// errorcheck
// Copyright 2010 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/syntax/topexpr.go b/test/syntax/topexpr.go
index 93d86fbe9..c5958f5dd 100644
--- a/test/syntax/topexpr.go
+++ b/test/syntax/topexpr.go
@@ -1,4 +1,4 @@
-// errchk $G -e $D/$F.go
+// errorcheck
// Copyright 2010 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/syntax/typesw.go b/test/syntax/typesw.go
index 47f683cdf..cd8cf3523 100644
--- a/test/syntax/typesw.go
+++ b/test/syntax/typesw.go
@@ -1,4 +1,4 @@
-// errchk $G -e $D/$F.go
+// errorcheck
// Copyright 2011 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/syntax/vareq.go b/test/syntax/vareq.go
index 8525be8cf..f08955e91 100644
--- a/test/syntax/vareq.go
+++ b/test/syntax/vareq.go
@@ -1,4 +1,4 @@
-// errchk $G -e $D/$F.go
+// errorcheck
// Copyright 2010 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/syntax/vareq1.go b/test/syntax/vareq1.go
index 9d70bea39..e900eabeb 100644
--- a/test/syntax/vareq1.go
+++ b/test/syntax/vareq1.go
@@ -1,4 +1,4 @@
-// errchk $G -e $D/$F.go
+// errorcheck
// Copyright 2010 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
diff --git a/test/test0.go b/test/test0.go
deleted file mode 100644
index d8d86c427..000000000
--- a/test/test0.go
+++ /dev/null
@@ -1,92 +0,0 @@
-// $G $F.go && $L $F.$A && ./$A.out
-
-// Copyright 2009 The Go Authors. All rights reserved.
-// Use of this source code is governed by a BSD-style
-// license that can be found in the LICENSE file.
-
-package main
-
-const a_const = 0
-
-const (
- pi = /* the usual */ 3.14159265358979323
- e = 2.718281828
- mask1 int = 1 << iota
- mask2 = 1 << iota
- mask3 = 1 << iota
- mask4 = 1 << iota
-)
-
-type (
- Empty interface{}
- Point struct {
- x, y int
- }
- Point2 Point
-)
-
-func (p *Point) Initialize(x, y int) *Point {
- p.x, p.y = x, y
- return p
-}
-
-func (p *Point) Distance() int {
- return p.x*p.x + p.y*p.y
-}
-
-var (
- x1 int
- x2 int
- u, v, w float32
-)
-
-func foo() {}
-
-func min(x, y int) int {
- if x < y {
- return x
- }
- return y
-}
-
-func swap(x, y int) (u, v int) {
- u = y
- v = x
- return
-}
-
-func control_structs() {
- var p *Point = new(Point).Initialize(2, 3)
- i := p.Distance()
- var f float32 = 0.3
- _ = f
- for {
- }
- for {
- }
- for j := 0; j < i; j++ {
- if i == 0 {
- } else {
- i = 0
- }
- var x float32
- _ = x
- }
-foo: // a label
- var j int
- switch y := 0; true {
- case i < y:
- fallthrough
- case i < j:
- case i == 0, i == 1, i == j:
- i++
- i++
- goto foo
- default:
- i = -+-+i
- break
- }
-}
-
-func main() {
-}
diff --git a/test/testlib b/test/testlib
new file mode 100644
index 000000000..3858431a7
--- /dev/null
+++ b/test/testlib
@@ -0,0 +1,44 @@
+# Copyright 2012 The Go Authors. All rights reserved.
+# Use of this source code is governed by a BSD-style
+# license that can be found in the LICENSE file.
+
+# These function names are also known to
+# (and are the plan for transitioning to) run.go.
+
+compile() {
+ $G $D/$F.go
+}
+
+build() {
+ $G $D/$F.go && $L $F.$A
+}
+
+run() {
+ gofiles=""
+ ingo=true
+ while $ingo; do
+ case "$1" in
+ *.go)
+ gofiles="$gofiles $1"
+ shift
+ ;;
+ *)
+ ingo=false
+ ;;
+ esac
+ done
+
+ $G $D/$F.go $gofiles && $L $F.$A && ./$A.out "$@"
+}
+
+cmpout() {
+ $G $D/$F.go && $L $F.$A && ./$A.out 2>&1 | cmp - $D/$F.out
+}
+
+errorcheck() {
+ errchk $G -e $D/$F.go
+}
+
+skip() {
+ true
+}
diff --git a/test/turing.go b/test/turing.go
index 0af39de8b..acbe85b64 100644
--- a/test/turing.go
+++ b/test/turing.go
@@ -1,51 +1,58 @@
-// $G $F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
+// Test simulating a Turing machine, sort of.
+
package main
// brainfuck
var p, pc int
var a [30000]byte
+
const prog = "++++++++++[>+++++++>++++++++++>+++>+<<<<-]>++.>+.+++++++..+++.>++.<<+++++++++++++++.>.+++.------.--------.>+.>.!"
func scan(dir int) {
for nest := dir; dir*nest > 0; pc += dir {
switch prog[pc+dir] {
- case ']':
- nest--
- case '[':
- nest++
+ case ']':
+ nest--
+ case '[':
+ nest++
}
}
}
func main() {
+ r := ""
for {
switch prog[pc] {
- case '>':
- p++
- case '<':
- p--
- case '+':
- a[p]++
- case '-':
- a[p]--
- case '.':
- print(string(a[p]))
- case '[':
- if a[p] == 0 {
- scan(1)
- }
- case ']':
- if a[p] != 0 {
- scan(-1)
- }
- default:
- return
+ case '>':
+ p++
+ case '<':
+ p--
+ case '+':
+ a[p]++
+ case '-':
+ a[p]--
+ case '.':
+ r += string(a[p])
+ case '[':
+ if a[p] == 0 {
+ scan(1)
+ }
+ case ']':
+ if a[p] != 0 {
+ scan(-1)
+ }
+ default:
+ if r != "Hello World!\n" {
+ panic(r)
+ }
+ return
}
pc++
}
diff --git a/test/typeswitch.go b/test/typeswitch.go
index 83fb0985a..30a4b4975 100644
--- a/test/typeswitch.go
+++ b/test/typeswitch.go
@@ -1,9 +1,11 @@
-// $G $F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
+// Test simple type switches, including chans, maps etc.
+
package main
import "os"
@@ -82,9 +84,9 @@ func main() {
case []int:
assert(x[3] == 3 && i == Array, "array")
case map[string]int:
- assert(x == m && i == Map, "map")
+ assert(x != nil && i == Map, "map")
case func(i int) interface{}:
- assert(x == f && i == Func, "fun")
+ assert(x != nil && i == Func, "fun")
default:
assert(false, "unknown")
}
@@ -111,5 +113,4 @@ func main() {
default:
assert(false, "switch 4 unknown")
}
-
}
diff --git a/test/typeswitch1.go b/test/typeswitch1.go
index 9613b166f..a980ce4c0 100644
--- a/test/typeswitch1.go
+++ b/test/typeswitch1.go
@@ -1,9 +1,11 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
+// Test simple type switches on basic types.
+
package main
import "fmt"
diff --git a/test/typeswitch2.go b/test/typeswitch2.go
index f8fe396ea..6c703076a 100644
--- a/test/typeswitch2.go
+++ b/test/typeswitch2.go
@@ -1,9 +1,12 @@
-// errchk $G -e $D/$F.go
+// errorcheck
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
+// Verify that various erroneous type switches are caught be the compiler.
+// Does not compile.
+
package main
import "io"
@@ -18,11 +21,27 @@ func whatis(x interface{}) string {
return "Reader1"
case io.Reader: // ERROR "duplicate"
return "Reader2"
- case interface { r(); w() }:
+ case interface {
+ r()
+ w()
+ }:
return "rw"
- case interface { w(); r() }: // ERROR "duplicate"
+ case interface { // GCCGO_ERROR "duplicate"
+ w()
+ r()
+ }: // GC_ERROR "duplicate"
return "wr"
-
+
}
return ""
}
+
+func notused(x interface{}) {
+ // The first t is in a different scope than the 2nd t; it cannot
+ // be accessed (=> declared and not used error); but it is legal
+ // to declare it.
+ switch t := 0; t := x.(type) { // ERROR "declared and not used"
+ case int:
+ _ = t // this is using the t of "t := x.(type)"
+ }
+}
diff --git a/test/typeswitch3.go b/test/typeswitch3.go
new file mode 100644
index 000000000..5475a8a6d
--- /dev/null
+++ b/test/typeswitch3.go
@@ -0,0 +1,43 @@
+// errorcheck
+
+// Copyright 2011 The Go Authors. All rights reserved.
+// Use of this source code is governed by a BSD-style
+// license that can be found in the LICENSE file.
+
+// Verify that erroneous type switches are caught be the compiler.
+// Issue 2700, among other things.
+// Does not compile.
+
+package main
+
+import (
+ "io"
+)
+
+type I interface {
+ M()
+}
+
+func main(){
+ var x I
+ switch x.(type) {
+ case string: // ERROR "impossible"
+ println("FAIL")
+ }
+
+ // Issue 2700: if the case type is an interface, nothing is impossible
+
+ var r io.Reader
+
+ _, _ = r.(io.Writer)
+
+ switch r.(type) {
+ case io.Writer:
+ }
+
+ // Issue 2827.
+ switch _ := r.(type) { // ERROR "invalid variable name _"
+ }
+}
+
+
diff --git a/test/undef.go b/test/undef.go
index 7ef07882a..0a77e5937 100644
--- a/test/undef.go
+++ b/test/undef.go
@@ -1,10 +1,11 @@
-// errchk $G -e $D/$F.go
+// errorcheck
// Copyright 2010 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
-// Check line numbers in error messages.
+// Test line numbers in error messages.
+// Does not compile.
package main
diff --git a/test/utf.go b/test/utf.go
index a93fc2934..3ac79447e 100644
--- a/test/utf.go
+++ b/test/utf.go
@@ -1,15 +1,17 @@
-// $G $F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
+// Test UTF-8 in strings and character constants.
+
package main
-import "utf8"
+import "unicode/utf8"
func main() {
- var chars [6] int
+ var chars [6]rune
chars[0] = 'a'
chars[1] = 'b'
chars[2] = 'c'
@@ -21,16 +23,22 @@ func main() {
s += string(chars[i])
}
var l = len(s)
- for w, i, j := 0,0,0; i < l; i += w {
- var r int
+ for w, i, j := 0, 0, 0; i < l; i += w {
+ var r rune
r, w = utf8.DecodeRuneInString(s[i:len(s)])
- if w == 0 { panic("zero width in string") }
- if r != chars[j] { panic("wrong value from string") }
+ if w == 0 {
+ panic("zero width in string")
+ }
+ if r != chars[j] {
+ panic("wrong value from string")
+ }
j++
}
// encoded as bytes: 'a' 'b' 'c' e6 97 a5 e6 9c ac e8 aa 9e
const L = 12
- if L != l { panic("wrong length constructing array") }
+ if L != l {
+ panic("wrong length constructing array")
+ }
a := make([]byte, L)
a[0] = 'a'
a[1] = 'b'
@@ -44,11 +52,15 @@ func main() {
a[9] = 0xe8
a[10] = 0xaa
a[11] = 0x9e
- for w, i, j := 0,0,0; i < L; i += w {
- var r int
+ for w, i, j := 0, 0, 0; i < L; i += w {
+ var r rune
r, w = utf8.DecodeRune(a[i:L])
- if w == 0 { panic("zero width in bytes") }
- if r != chars[j] { panic("wrong value from bytes") }
+ if w == 0 {
+ panic("zero width in bytes")
+ }
+ if r != chars[j] {
+ panic("wrong value from bytes")
+ }
j++
}
}
diff --git a/test/varerr.go b/test/varerr.go
index ddd718f5b..22aa9324f 100644
--- a/test/varerr.go
+++ b/test/varerr.go
@@ -1,9 +1,12 @@
-// errchk $G $D/$F.go
+// errorcheck
// Copyright 2010 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
+// Verify that a couple of illegal variable declarations are caught by the compiler.
+// Does not compile.
+
package main
func main() {
diff --git a/test/varinit.go b/test/varinit.go
index c76877793..84a4a1aa5 100644
--- a/test/varinit.go
+++ b/test/varinit.go
@@ -1,9 +1,11 @@
-// $G $D/$F.go && $L $F.$A && ./$A.out || echo BUG wrong result
+// run
// Copyright 2009 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
+// Test var x = x + 1 works.
+
package main
func main() {
diff --git a/test/vectors.go b/test/vectors.go
deleted file mode 100644
index ed5905da3..000000000
--- a/test/vectors.go
+++ /dev/null
@@ -1,64 +0,0 @@
-// $G $F.go && $L $F.$A && ./$A.out
-
-// Copyright 2009 The Go Authors. All rights reserved.
-// Use of this source code is governed by a BSD-style
-// license that can be found in the LICENSE file.
-
-package main
-
-import "container/vector"
-
-
-type S struct {
- val int
-}
-
-
-func (p *S) Init(val int) *S {
- p.val = val
- return p
-}
-
-
-func test0() {
- v := new(vector.Vector)
- if v.Len() != 0 {
- print("len = ", v.Len(), "\n")
- panic("fail")
- }
-}
-
-
-func test1() {
- var a [1000]*S
- for i := 0; i < len(a); i++ {
- a[i] = new(S).Init(i)
- }
-
- v := new(vector.Vector)
- for i := 0; i < len(a); i++ {
- v.Insert(0, a[i])
- if v.Len() != i+1 {
- print("len = ", v.Len(), "\n")
- panic("fail")
- }
- }
-
- for i := 0; i < v.Len(); i++ {
- x := v.At(i).(*S)
- if x.val != v.Len()-i-1 {
- print("expected ", i, ", found ", x.val, "\n")
- panic("fail")
- }
- }
-
- for v.Len() > 10 {
- v.Delete(10)
- }
-}
-
-
-func main() {
- test0()
- test1()
-}
diff --git a/test/zerodivide.go b/test/zerodivide.go
index 1948528d2..673d1d18d 100644
--- a/test/zerodivide.go
+++ b/test/zerodivide.go
@@ -1,21 +1,20 @@
-// $G $F.go && $L $F.$A && ./$A.out
+// run
// Copyright 2010 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
+// Test that zero division causes a panic.
+
package main
import (
"fmt"
"math"
+ "runtime"
"strings"
)
-type Error interface {
- String() string
-}
-
type ErrorTest struct {
name string
fn func()
@@ -161,10 +160,10 @@ var errorTests = []ErrorTest{
ErrorTest{"complex128 1/0", func() { use(e128 / d128) }, ""},
}
-func error(fn func()) (error string) {
+func error_(fn func()) (error string) {
defer func() {
if e := recover(); e != nil {
- error = e.(Error).String()
+ error = e.(runtime.Error).Error()
}
}()
fn()
@@ -199,7 +198,7 @@ func main() {
if t.err != "" {
continue
}
- err := error(t.fn)
+ err := error_(t.fn)
switch {
case t.err == "" && err == "":
// fine